Chromosome Research (2007) DOI: 10.1007/s10577-007-1911-x
Invited abstracts 1-L
Origin and mechanisms of formation of chromosome aberrations Albert Schinzel Institut fu¨r Medizinische Genetik der Universita¨t Zu¨rich, Switzerland Chromosome aberrations can occur before, during and after meiosis. To their huge majority of probably 99%, they are prenatally lethal and largely contribute to the about 50% prenatal losses of human conceptions. If all Y viable and non-viable Y chromosome aberrations are taken together, they predominantly occur at meiosis although one must admit that premeiotically formed gonadal chromosome aberrations cannot be distinguished from meiotic ones and that the incidence of clonal chaotic aberrations with early embryonic lethality is unknown. Distinction of meiotic versus mitotic and meiosis I versus meiosis II nondisjunction is possible through molecular marker analysis. Demonstration of maintenance of parental heterozygosity is a proof of meiotic origin while reduction to homozygosity of parental heterozygosity is considered to demonstrate mitotic origin if found for all markers along the chromosome. This assumption neglects the possibility of nondisjunction following an achiasmatic meiosis. Meiosis I nondisjunction following meiotic recombination would lead to maintenance of heterozygosity of markers close to the centromere while more peripheral markers could be reduced to homozygosity, and the opposite applies for meiosis II nondisjunction. Meiotic origin does not only apply to the majority of trisomies; most triploidies of maternal origin and many instances of structural aberrations are also formed at meiosis as are the majority of mosaic trisomies and of instances of maternal uniparental disomy. For trisomies 21, 13, 18 and X, meiotic origin is found in about 90 percent. However, while meiosis I nondisjunction prevails in trisomies 21 and X, trisomy 18 more often is due to meiosis II nondisjunction, and the distribution is almost equal for trisomy 13. An exception of this rule is mosaic trisomy 8 which is predominantly of mitotic (postzygotic) origin. Additional isochromosomes and inv dup chromosomes,
# Springer 2007
both leading to partial tetrasomy, behave similar to trisomy 18: the first step is meiosis II nondisjunction which is (probably immediately) followed by isochromosome formation due to false centromere division. Tandem duplications can occur at meiosis (through unequal crossover), but a minority of them could theoretically also be formed postzygotically. The mechanism of formation of deletions is more difficult to evaluate if concerning terminal segments since no distal flanking markers are available for investigation. For interstitial deletions, meiotic origin can be shown if the segments proximal and distal of the deletion stem from different grandparents. Many of these deletions and some de novo duplications and even triplications occur secondary to pairing of similar repeats flanking the deleted segment, so for the deletions causing PraderWilli and Angelman syndrome, Williams-Beuren syndrome and DiGeorge/velocardiofacial syndrome. This mechanism also explains their relatively high frequency. It could recently be shown that a not negligible proportion of mosaic duplications do not occur postzygotically, but occur in different steps starting with a meiotic nondisjunction or uneven crossover; segmental uniparental disomy is often a consequence of these different steps of abnormal early chromosome segregation. Apparent isochromosomes replacing a normal homologue mostly show postzygotic origin, with reduction of parental heterozygosity at all markers to homozygosity. A small minority, however, have a different origin, thus showing that they are not isochromosomes sensu stricti. Sex chromosome aberrations deviate in some respects in origin from autosomal aberrations. For example, in Klinefelter syndrome (47,XXY) maternal additional chromosomes to a minority derive from meiosis II nondisjunction while paternal additional chromosomes must derive from meiosis I nondisjunction. A loss of sex chromosomes in Ullrich-Turner syndrome (45,X) probably invariably occurs postzygotically. In high-order sex chromosome hyperdiploidy, there seems to be a combination between meiosis I and meiosis II and/or mitotic nondisjunction. This is the only type of aberration where meiotic nondisjunction of 2 chromosomes can often be demonstrated, e.g. for additional X and Y in 48,XXYY. Mosaic additional chromosomes for the exception of chromosome 8 mostly are the result of somatic loss of the extra chromosome; thus, they also tend to start as trisomies. While an additional maternal
6th ECC: Abstracts
2 haploid chromosome set in triploidy mostly shows a meiotic origin, thus incorporation of a polar body into the oocyte, paternal triploidy most often is the consequence of dispermy. As to the parental origin, there is a strong bias for most chromosome aberrations. While trisomies occur predominantly during female meiosis and are age dependant, terminal deletions and ring chromosomes are to their majority paternal in origin. Interstitial deletions show an almost equal distribution with respect to parental origin. Additional isochromosomes behave similar to trisomies from which they originate while isochromosomes replacing a normal homologue show an almost equal distribution of parental origin. More complex aberrations, especially in a mosaic state, often have unexpectedly complex ways of formation, not infrequently with additional segmental uniparental disomy. About 3/4 of triploidies have an additional maternal and 1/4 an additional paternal haploid set.
2-L
Nuclear organisation of chromatin: links to normal genome function and to disease Wendy Bickmore MRC Human Genetics Unit, Edinburgh, UK In vivo the human genome is packaged as a complex 3D chromatin structure within the cell nucleus. We have shown that chromosomes and genes have preferred spatial positions within the human nucleus, and that there is differential chromatin condensation at different parts of the genome . I will describe what we know about how the human genome is organised within the nucleus, and how this might be altered during development and in disease states.
3-L
Skewed X inactivation and human disease Karen Helene Ørstavik Department of Medical Genetics, RikshospitaletRadiumhospitalet Medical Centre, Oslo, Faculty Division Rikshospitalet, University of Oslo, Oslo, Norway
In female mammalian cells, one of the two X chromosomes is inactivated in early embryonic life, making females mosaics for two cell lines, one with the maternal and one with the paternal X as the active chromosome. A skewed X inactivation pattern is a marked deviation from an equal distribution of the two cell lines, and may be due to chance, to a genetic influence, or to a selection process. The frequency of skewed X inactivation in peripheral blood cells increases with advancing age after about 55 years, probably through a selection mechanism. Unfavourable skewing of X inactivation, where the X chromosome carrying a mutant allele is the predominantly active X, has been found in blood cells in severely affected carriers of X-linked disorders. However, for many X-linked disorders, a consistent relationship between the pattern of X inactivation and clinical phenotype in female carriers has not been found. One reason for this may be that peripheral blood cells are not a relevant tissue. A favourable skewing of X inactivation is found in carriers of a number of severe X-linked disorders, probably due to a post-inactivation selection against cells where the X chromosome carrying the mutant allele is the active X.
4-L
Chromosome aberrations in ageing mentally retarded persons: a challenge for the clinician Griet Van Buggenhout1, Wim Avonds2, Wolfs I3, Beusen L4, Joris Vermeesch1 and Jean-Pierre Fryns1 1
Centre for Human Genetics, Leuven, Belgium; Zwart Goor, Merksplas, Belgium; 3PC Ziekeren, St Truiden; 4Belgium, Borgerstein, St Katelijne-Waver (Mechelen), Belgium 2
Studies in elderly mentally retarded patients are rare. Persons with more serious level of mental retardation are at higher risk for developing health problems. These problems are, besides for patients with Down syndrome, not well described in other genetic syndromes. A series of 256 (71 males and 185 females) institutionalised mentally retarded patients were investigated in the period 2002Y2005. These patients were residents of 3 institutions for mildly to severely mentally retarded patients. A standard clinical
6th ECC: Abstracts examination, cytogenetic and molecular studies were performed in all patients. We present an overview of the etiological diagnosis in this group of patients according to the following classification: chromosomal disorder, monogenetic disorder, acquired aetiology, central nervous malformation or unknown origin. Cerebral palsy, visual and hearing loss, mobility problems, epilepsy, language difficulties, emotional and/or mental problems are frequently reported among the elderly mentally retarded persons and add a new dimension to ageing. These problems may result in limiting social contacts and often in behavioural problems such as aggressive behaviour and self-mutilation in the severely to profoundly mentally retarded persons. Moderately mentally retarded persons may react with maladaptive behaviour and are candidates to develop depression. We focused to the changing phenotype in these ageing patients and to the diagnosis-related medical problems and behaviour. Therefore, we will present a series of older patients (above the age of 50 years) with a clear diagnosis, but with clinical features difficult to recognise at an older age.
5-L
Comparative cytogenetics and karyotype evolution of muntjacs (Muntiacus) Fengtang Yang The Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK The muntjacs (Muntiacus, Cervidae) are famous for their rapid and radical karyotypic diversification via repeated tandem chromosome fusions, constituting a paradigm for the studies of karyotypic evolution and speciation. Of the ten muntjac species so far discovered, five have been extensively investigated by a series of comparative genomic approaches including conventional chromosomal banding, fluorescent in situ hybridization-based molecular cytogenetic methods such as comparative chromosome painting, gene mapping, and bacterial artificial chromosome (BAC) mapping and most recently, by large-scale BAC sequencing. In this talk, I will review the recent contributions of such comparative genomics studies to our understanding of the
3 chromosomal and molecular mechanisms underlying the tandem chromosomal fusions and to the phylogenetic relationships of extant muntjac species.
6-L
Animal cytogenetics and karyotype evolution in bovids L. Iannuzzi National Research Council (CNR), Italy Karyotype evolution in the family Bovidae (123 species and 45 extant genera grouped in six subfamilies) is mainly based on four levels of chromosome differentiation: autosomes, gonosomes, nucleolus organizer chromosomes (NOCs) and heterochromatin. All comparative studies performed by both chromosome banding and FISH-mapping showed the following features: (a) while the diploid number varies between 30 to 60, the fundamental number (FN) most often varies between 58 to 62; (b) the reduction of diploid number has been accompanied by the formation of biarmed autosomes originating by centric fusion translocations (CFs) followed by loss of heretochromatin; (c) acrocentric autosomes (or chromosome arms) tend to be conserved among all species studied by chromosome band and comparative map analysis; (d) Bbovine[ and Bcaprine[ chromosomes 9 and 14 differ by a pericentromeric region translocated from Bbovine[ chromosome 9 to Bcaprine[ chromosome 14; (e) sex chromosomes have undergone complex evolution that has resulted in changes of morphology (due to the centromere position), size (due to heterochromatin variation) and gene order (due to chromosome transposition or inversions); (f) NORs have been labile and often present at the telomeres of different (non homologous) chromosomes in many species; (g) sex chromosomes are fused with autosomes in some species.
7-L
Cellular and clinical impact of genomic haploinsufficiency for genes involved in the ATR-dependent DNA damage response signalling pathway Mark O_Driscoll 1 , William B. Dobyns 2 , Johanna M. van Hagen3 and Penny A. Jeggo1
4
6th ECC: Abstracts
1
a single daughter with twice the normal chromosome and centrosome numbers. These cells are prone to multipolar mitosis in the next divisional cycle, but also have the extra chromosomes to help them to survive this hyper-reductional division. Cytokinesis is regulated in large part by phosphorylation of the myosin regulatory light chain. Previously published data show that tumor tissue samples show a change in myosin light chain kinase mRNA levels, suggesting that phosphorylation may be dysregulated in cancer cells. We show here that failure of cytokinesis in tumorderived cell lines is associated with decreased phosphorylation of the myosin regulatory light chain. Reduced phosphorylation in some cell lines is associated with elevated myosin phosphatase levels and we consistently see reduced myosin light chain kinase levels. When myosin light chain phosphorylation is restored to normal levels, cytokinesis failure, multinucleation, and multipolar mitosis, common mitotic defects seen in malignant cells, are all markedly reduced. Furthermore, either overexpression of myosin light chain phosphatase or inhibition of the myosin kinase can induce multinucleation, multipolar spindles and cytokinesis failure in nonmalignant cells. Furthermore, we show that myosin light chain kinase is inhibited in cancer cells, as purified kinase has lower activity in vitro than equal amounts of kinase from nonmalignant cells. These results show for the first time that ploidy defects and multipolar spindles in tumor-derived cells are caused by deficiencies in myosin light chain phosphorylation.
Genome Damage and Stability Centre, University of Sussex, Brighton, East Sussex, UK; 2Department of Human Genetics, The University of Chicago, Chicago, Illinois, USA; 3Department of Clinical Genetics, VU University Medical Center, Amsterdam, The Netherlands Ataxia telangiectasia and Rad3-related (ATR), a central kinase controlling the response to DNA damage, is mutated in ATR-Seckel Syndrome (ATR-SS) (MIM210600), a disorder characterised by severe microcephaly and growth delay. Impaired ATRsignalling is also observed in cell lines from additional disorders exhibiting microcephaly and growth delay. Examples include non-ATR-SS, Nijmegen Breakage Syndrome (MIM251260) and MCPH1-dependent Primary Microcephaly (MIM607117). Here, I examine three contiguous gene deletion disorders, a subset of Blepharophimosis-Ptosis-Epicanthus Inversus Syndrome (MIM110100), Miller-Dieker Lissencephaly Syndrome (MIM247200) and Williams-Beuren Syndrome (MIM194050), in which the heterozygously deleted region encompasses ATR (3q22 Y q24), RPA1 (17p13.3) or RFC2 (7q11.23) respectively. These three genes function in the ATR-signalling pathway. Strikingly, cell lines from these disorders display an impaired ATR-dependent DNA damage response. This implies that the ATRsignalling pathway is unusually sensitive to haploinsufficiency. This further correlation of ATR-pathway dysfunction in humans with the presence of microcephaly and growth delay reinforces a likely causal relationship. Furthermore, since none of the contiguous gene deletion disorders investigated here have hitherto been known to exhibit a defective DNA damage response, this data may have implications for the clinical management of these conditions.
8-L
Centrosomal amplification and spindle multipolarity in cancer cells Qian Wua, Ruta Sahasrabudhea, Susanne M. Gollinb and William S. Saundersa Departments of Biologic Sciencesa and Human Geneticsb, University of Pittsburgh, Pittsburgh, PA 15235, USA Cancer cells typically have unstable genomes, and an increase in ploidy plays an important role in malignant transformation in tumorigenetic models. Cancer cells can increase ploidy by failure of cytokinesis, producing
9-L
Maternal origin of the human aneuploidies Montserrat Garcia Calde´s Unitat de Biologia CelIlular i Gene`tica Me`dica, Departament de Biologı´a CelIlular, Fisiologia i Immunologia, Facultat de Medicina, Universitat Auto`noma de Barcelona In humans, it is estimated that there is a high percentage (10Y25Q) of conceptions with aneuploidies. These aneuploidies are mainly autosomopathies caused by errors produced during the first stages of the female meiotic process. In this lecture, I will summarize, mainly, what we know about it taking into account that the different
6th ECC: Abstracts used paths to go through have been closely related to the development of the Cellular Biology story. In fact, many differences concerning, mainly, pairing, homologue synapsis and the recombination progression process between male and female meiosis have been described both in humans and mice, suggesting that these phenomena may be involved in the differences observed in the origin of human aneuploidy. These alterations and variations, could explain, some atresia phenomena but, in any case, they would have enough importance to provoke real and big problems in the meiotic process. In this sense, in human oocytes, there are some important recognizable events: a) Pre-Meiotic Non-Disjunction b) Interference chromosomal effect (it depends on the chromosomes implicated) c) Pairing error rate (0.14Q) equivalent to all analyzed chromosomes In my opinion, pre-meiotic non-disjunction and the chromosome interference phenomenon are there to complicate and, even, to obstruct the modus operandi system but, anyhow, in oocytes, human-chromosome pairing-synapsing is a very efficient process that ensures the encounter of the homologues, therefore, pachytenestage bivalent-formation efficiency is very high. At this point, how can we combine the contradiction this very low rate (0.14Q) means when comparing it to the high rate (from 15Y25Q) of unbalanced oocyte IIs found in humans?
10-L
The study of chromosomal translocations in male gametes: segregation, interchromosomal effect and impact on fertility F. Pellestor Department of Medicine and Reproductive Biology, Arnaud de Villeneuve Hospital, INSERM U 847, Montpellier, France Translocations are the most frequent structural chromosomal abnormalities found in humans. Male carriers of translocations are often affected by reproductive failure due to the production of unbalanced
5 gametes. The presence of translocations might also alter spermatogenesis, resulting in various degrees of meiotic process disturbance. Fundamental information on the meiotic behaviour of translocations has been obtained on spermatozoa from heterozygous carriers, initially thanks to the development of the human-hamster in vitro fertilization system, and presently using sperm FISH techniques. Results of these direct investigations (more than 130 reports) have allowed a better understanding of the segregation mode of translocations and have clearly documented the wide variability in the meiotic production of imbalances. Sperm analysis studies have also constituted a direct approach to study the existence of an interchromosomal effect of translocations, but contradictory results have been reported. All these data are now currently integrated in genetic and reproductive counselling of translocations carriers, and provide important predictive information for IVF and PGD outcomes. However, little is known about the formation of translocations. Analysis of the breakpoints and the sequences surrounding them, in both Robertsonian and reciprocal translocations, provides new data on the molecular mechanisms that bring about their occurrences, but also on their relationships with infertility. Thus, new models are proposed for the formation of these structural rearangements.
11-L
Novel microdeletion syndromes Bert B. A. de Vries Dept. of Human Genetics, RUNMC, Nijmegen, The Netherlands Mental retardation, occuring in 2Y3Q of the general population, can be seen in isolation or in combination with other malformations and/or dysmorphisms, resulting in specific syndromes. Chromosome abnormalities are an important cause of mental retardation, detectable in ~10Q of cases. New molecular cytogenetic techniques such as FISH have led to the awareness that subtelomeric rearrangements below the level that can be detected by the light microscope (G5 Mb) are also a significant cause of human malformations and mental retardation in ~5Q of the patients. Recently new techniques such as MAPH and MLPA have become available to test
6th ECC: Abstracts
6 the subtelomeric integrity that also allow for detection of single subtelomeric duplications. Targeting the telomeric regions using the various new techniques has led to the identification of novel microdeletion syndromes related to the telomeres, such as 1qter, 3qter, 9qter and 22qter. In addition to microdeletions also novel microduplications of certain telomeric regions are found. So far, the latter are predominantly single cases and therefore not allowing for recognizing overlapping clinical features leading to the characterisation of a specific syndrome, yet. Using micro arrays with a resolution of 1 Mb up to 200 Kb, microdeletions and - duplications elsewhere in the genome have been identified in 10Y15Q of mentally retarded patients with additional dysmorphisms. To date, novel syndromes are identified and further characterised such as the 17q21.3 and 15q24 microdeletion syndromes. In both syndromes specific genomic structures, namely identical segmental duplications, are the underlying cause of the recurrence of these genomic disorders. The introduction of these novel techniques, that allow searching genome wide for submicroscopic chromosome aberrations at an unprecedented accuracy and level, will initiate the discovery of so many new microdeletion/duplication syndromes the coming years.
12-L
Application of MLPA for cytogenetic diagnostics and research Frank Kooy Department of Medical Genetics, University of Antwerp, Antwerp, Belgium Microdeletions, e.g., partial chromosome copy number changes too small to be detected by conventional cytogenetic analysis, have emerged as a significant cause of both idiopathic and familial mental retardation. A few clinically recognizable disorders, including the DiGeorge, Williams-Beuren and Smith-Magenis syndrome have been known for a long time. Awareness that microdeletions at many more positions in the genome occur was raised by publications in the 90-ies that subtelomeric rearrangements, e.g. microdeletions at or close to any chromosome end are recurrent in patients. Subtelomeric microdeletions were estimated responsible for 5Y10Q of cases of mental retardation.
Most recently novel genomic disorders have been discovered, caused by interstitial deletions, mostly flanked by low-copy repeats. Microdeletions are now held responsible for 10Y20Q of cases of unexplained mental retardation. As mental retardation is a common disorder affecting 1Y3Q of the population, many patients need to be diagnosed on a routine basis. This stimulated the development of novel technology and a variety of methods have been adapted to detect the known microdeletion syndromes. Currently, multiplex-ligation dependent probe amplification (MLPA) is one of the most widely used methods. Using commercially available kits, up to 40Y50 probes are simultaneously amplified following ligation and size-separated on a capillary sequencer. Unbalanced copy number changes are easily identified by comparing the relative peak intensities. However, the number of probes is limited by the resolution of the detection system, hampering the possibility to analyze more than a handful of loci at once. Therefore, we developed an array-based MLPA method, with probes separated by unique tag sequences, potentially allowing simultaneous analysis of hundreds of probes in a single experiment. As proof of principle, we developed a series of intragenic probes spaced by 0.5Y1 Mb for the most telomeric 10 Mb of both ends of chromosome 1. We were able to detect and delineate in one step a series of known cryptic 1p and 1q deletions, demonstrating the feasibility of our approach. Array-based MLPA may thus be a good candidate to develop probe sets to rapidly detect subtelomeric aberrations and the growing number of other diseases caused by copy number changes in the genome.
13-L
Quality assessment and validation in clinical cytogenetic services Ulf Kristoffersson Department of Clinical Genetics, University Hospital, Lund, Sweden Recent development have expanded cytogenetics form the conventional Bblack and white[ chromosomes to FISH, and other techniques using molecular
6th ECC: Abstracts methodology can sometimes reveal the same chromosomal abnormality, but in a different way. When introducing new techniques as tools for routine clinical diagnosis, it is important to consider in what way diagnosis is improved. In the clinical setting, the right test, done on the right person, for the right purpose, at the right time moment, at the right price, is the concept for high clinical quality service. The clinical context of testing must be considered Y screen test or directed test, presymptomatic or diagnostic context, e.g. there is a difference in Down syndrome testing if it is a newborn to be tested, or a prenatal test and that affects the choice of technique. The importance of proper clinical validation and quality assessment will be discussed in the context of the relative cytogenetic illiteracy among many clinicians, and the more fancy Bhigh tech[ methods that are available on the market and in the laboratories.
14-L
Quality Assessment in QF-PCR for rapid aneuploidy screening: The UK experience Susan J. Hamilton Regional Cytogenetics Unit, Saint Mary"s Hospital, Hathersage Road, Manchester M13 0JH, UK Since the year 2000, fifteen UK laboratories have developed in-house assays for rapid aneuploidy screening using QF-PCR, with a further 4 labs in the process of validating assays. A pilot NEQAS scheme devised in 2004 to assess laboratories on both testing and reporting of samples will form part of the full scheme from 2007. In 2005 a set of Best Practice Guidelines were ratified by the Association of Clinical Cytogeneticists and the Clinical Molecular Genetics Society. A revision of these guidelines has recently been undertaken to update them in view of the expansion of testing both in sample type and in the number of centres offering this test. A bursary from Clinical Pathology Accreditation UK in has enabled a National e-mail network to be put in place to allow rapid exchange of information. National data on rare
7 and discrepant findings is being collected both retrospectively and prospectively with a view to elucidating rare findings which are clinically significant. These measures enabled UK labs to ensure they provided a high quality service to over 20 000 patients last year.
15-L
To quit or not to quit prenatal cytogenetic diagnosis? John A. Crolla Wessex Regional Genetics Laboratory, Salisbury District Hospital, Salisbury, UK We have recently seen the development and use in cytogenetic prenatal diagnosis of molecular techniques for the rapid detection of numerical chromosome abnormalities which comprise ~80Q of all abnormalities detectable by karyotyping. Use of fluorescence in situ hybridization (FISH) or quantitative fluorescence polymerase chain reaction (QF-PCR) makes it possible to detect the common aneuploidies using uncultured amniotic fluid amniocytes (AF) or chorionic villus samples (CVS) with results usually available within 24Y48 hrs compared with the 7Y14 days needed to report a prenatal karyotype. In April 2007, the U.K._s National Screening Committee (a Quango established by the Department of Health) recommended that BQF-PCR alone (be offered) to women of increased (screened) risk of Down_s syndrome, but where the scan is normal (e.g. where a nuchal translucency G 3 mm is detected in first trimester screening). In this context QF-PCR should also be used to test for + 13, + 18, in addition to + 21[. The NSC continues to recommend QF-PCR and karyotyping in cases of abnormal ultrasound scans and known parental chromosome rearrangements. Funding for prenatal karyotyping has already been replaced with QF-PCR in two major English regions which serve populations of several million. In this context, the U.K. Association of Clinical Cytogeneticists (ACC) in 2005 published an audit of 142,605 invasive prenatal diagnoses reported from U.K. laboratories over 5 years. The karyotypes were analysed by referral reasons and the results show that QF-PCR replaces karyotyping, 1:100 (AF) and 1:40 (CVS) will have undetected abnormal karyotypes and 1:300 (AF) and 1:100 (CVS) of these will be
6th ECC: Abstracts
8 associated with a significant risk of an abnormal phenotypic outcome. Despite these concerns, some U.K. funding agencies have elected to quit karyotyping in favour of QF-PCR. The possible implications for a significant minority of patients will be discussed.
16-L
Linking cytogenetics to genotype analysis can uncover new events in leukaemia Bryan D. Young Cancer Research UK Medical Oncology Laboratory, Barts and the Royal London School of Medicine and Dentistry, Queen Mary College, Charterhouse Square, London EC1 6BQ, UK The introduction of array-based analysis of single nucleotide polymorphisms (SNPs) allows the rapid determination of genome-wide allelic information at a high density for a DNA sample. Hence, the allelic status (heterozygous or homozygous) of each of many thousands of SNPs in a tumour sample can be simultaneously determined and, by comparison with germline DNA, regions of change can be identified. This approach is, therefore, ideally suited to the search for loss of heterozygosity in cancer. We have performed a study designed to characterise a large number of DNA samples from presentation acute myeloid leukaemias (AMLs) with full cytogenetic information available. This analysis confirmed previous findings that approximately 15Y20Q of cases exhibited large regions of homozygosity that could not be accounted for by visible chromosomal abnormalities in the karyotype. Moreover, the signal values indicated no net loss in the regions of homozygosity. Further analysis confirmed that these patterns were due to segmental uniparental disomy (UPD). These cryptic chromosomal abnormalities, which appear to be non-random, have the characteristics of somatic recombination events. Apart from these events there was a good correspondance between the cytogenetic abnormalities and the genotype determined events. Events such as deletions and gains were detected and mapped molecularly. This approach has uncovered evidence of novel recurrent abnormalities important in the origin of AML. The implications of these findings for our understanding of oncogenic process will be discussed.
17-L
Integrative genomics in neuroblastoma research Frank Speleman, Katleen De Preter, Evi Michels, Jasmien Hoebeeck, Filip Pattyn, Joelle Vermeulen, Nadine Van Roy, Anne De Paepe, Genevie`ve Laureys and Jo Vandesompele Department of Medical Genetics, Department of Paediatric Haemato-Oncology, Ghent University Hospital, Ghent, Belgium Neuroblastoma is a paediatric tumour originating from primitive neuroblasts giving rise to the sympathetic nervous system and is characterized by a wide clinical and genetic heterogeneity. Despite multimodal therapies, survival rates for aggressive NBs are still disappointingly low. At present only two genes, MYCN and PHOX2B have been directly linked to NB development. Previous work has indicated the existence of three major NB subgroups based upon the occurrence of recurrent DNA imbalances and importantly, this classification was also relevant in respect to prognosis. Subtype 1 NB were characterised by near triploid DNA content and mainly whole chromosome gains and losses, typically in young children with very good prognosis. Subtype 2A and 2B tumours were mostly found in older children (91 yr) and either showed 11q deletion and MYCN single copy status or 1p deletion and MYCN amplification, respectively. Both subtype 2A and 2B tumours nearly always present with 17q gain (Vandesompele et al. 2005). We have now performed high resolution array CGH on 100 NB tumours. Hierarchical clustering confirms the existence of these three major subtypes and recognises also smaller genomic subgroups with prognostic significance. Our data also allowed to refine mapping of critical regions for loss such as deletions on 3p and 11q, for which candidate NB suppressor genes have been proposed (Michels et al. submitted). In addition, we anticipated that this data set, together with public available results from genome wide genomic, epigenomic and transcriptome analyses will allow identification of genes and pathways relevant in NB development. In a large meta-analysis study, the transcriptome profiles of tumours belonging to one of
6th ECC: Abstracts the 3 major genomic subclasses were compared. Therefore four published expression datasets were merged and subject to significance analysis of microarrays (SAM) in order to identify the differentially expressed genes. Within the obtained gene lists, relevant candidates were identified by gene ontology analysis, pathway analysis, chromosomal mapping and gene set enrichment analysis (GSEA). Expression profiles of the different neuroblastoma subtypes were also compared with the recently obtained and unique normal neuroblast expression signature (De Preter et al. 2006). Further candidates were pinpointed through integration of epigenetic data obtained through. Comparison of NB cell lines before and after with a demethylating agent 5-aza-2¶-deoxycytidine (DAC), thus allowing identification of genes silenced through promoter hypermethylation. Comparison of the list of re-activated genes to a list of genes known to be methylated in other tumour types lead to the identification of 12 potentially methylated TSGs located in critically deleted regions in neuroblastoma. Additionally, a selection of 100 differentially expressed genes was made based on promoter similarity with known methylation marker genes. This gene list contains promising candidate genes and will be compared to above-mentioned candidate gene lists in order to further refine it.
9 tion trap. By doing so, we found that PRCC interacts with Mad2B, the human homolog of the yeast protein Mad (mitotic arrest deficient). Despite the fact that the RCC-associated fusion protein PRCCTFE3 has retained the Mad2B interaction domain, it is no longer capable of binding Mad2B, thereby interfering with its normal function. Although Mad2B is considered to inhibit the anaphase-promoting complex APC, its exact role in cell cycle control still remains to be established. Therefore, we again used the yeast-two-hybrid interaction trap and identified a number of Mad2B partner proteins including Ran and CLTA, both of which are embedded at the the regulatory heart of the mitotic spindle checkpoint. Subsequent selective RNAi-mediated knockdown experiments revealed loss of colocalization of these proteins and abrogation of the mitotic spindle checkpoint. Besides these observations, we have recently shown that exogenous PRCCTFE3 expression in HEK293 cells provokes cell cycle arrest through the CDK inhibitor p21WAF1/CIP1. Since we also found that this cell cycle arrest is abrogated in PRCCTFE3-positive renal tumors, we propose that this (premature) response is numbed in vivo, thus representing an early step in the development of these tumors. The implications of these findings for the step-wise development of RCC will be discussed.
19-L 18-L
Cell cycle (de)regulation in t(X;1) (p11;q21)-positive renal cell cancer
Chromosome evolution and centres of diversity of crops J. S. Heslop-Harrison
Ad Geurts van Kessel
Department of Biology, University of Leicester, UK
Dept. of Human Genetics, Radboud University, Nijmegen Medical Center, Nijmegen, The Netherlands
The interface of Asia, Europe and Africa, lying between the Arabian Gulf, Caspian Sea, Black Sea and Mediterranean Sea, is the centre of diversity for many of the world_s most important crops. The wheats, rye, barley, many seed and forage legumes, as well as fruits, spices and oil crops have arisen in this, the Fertile Crescent, and are now culitvated over much of the world. In contrast, major centres of global biodiversity in the tropics, Africa and Asia are have given few crop species. In my introductory talk, I will review three aspects of cytogenetics, evolution and crop diversity using examples from cereals and legumes. What are the features of chromosomal evolution between crops
Previously, we found that in t(X;1)(p11;q21)-positive renal cell carcinomas (RCCs) the bHLH-LZ transcription factor TFE3 is fused to a novel protein designated PRCC. In addition, we found that expression of PRCCTFE3 leads to the in vitro and in vivo transformation of various cell types, including those of the kidney, indicating that this fusion product acts as an oncogenic protein. Since initially little was known about the function of the newly identified protein PRCC, we set out to identify partner proteins binding to PRCC using the yeast-two-hybrid interac-
6th ECC: Abstracts
10 and their wide relatives in terms of chromosome number and the DNA sequences Y genes and repetitive DNA Y present on the chromosomes? What role does polyploidy play in crop evolution? And finally, how can information about crop diversity, DNA sequence evolution and cytogenetics be exploited in the improvement of crop plants and this knowledge be used to generate and measure new diversity? References and the full talk will be available from www.molcyt.com.
20-L
Crocus in the northeastern Mediterranean region M. Ørgaard, N. Jacobsen and J. S. Heslop-Harrison University of Copenhagen, University of Leicester The genus Crocus includes more than 80 species, altogether more than 130 taxa, and is generally distributed in the Mediterranean region, with main distribution areas the Middle East, especially Turkey. Turkey is represented by more than 30 species and 50 taxa and is to be considered a centre of biodiversity for Crocus. The genus represents a large inter- and intra specific variation regarding morphology, cytogenetics and molecular composition. Crocus chromosome numbers vary from 2n = 6 to 2n = 64 and this variation is also to be found intraspecifically, e.g. at the subspecies and even population level. Crocus biflorus s.l. represents the one species with the most variation encountered. Chromosome numbers range from 2n = 8 to 2n = 28 and vary at subspecies and population level. These cyto-/ecotypes are often confined geographically to mountain peaks and ranges. Natural hybridization between populations and species occurs and give rise to new genotypes and eventually new species. Variation in chromosome numbers can be explained by the BTriploid pathway[. Expression of diversity can be speeded up when plants from different geographical areas are taken into in cultivation and allowed to hybridize through open pollination. This has resulted in more than 135 named and presently more than 40 marketed C. chrysanthus Y C. biflorus cultivars. The diversity is registered in morphological appearance, DNA polymorphism (e.g. results from RFLP, AFLP, in situ hybridization, DNA sequencing), chromosome number and crossability.
21-L
Cereal genomes and the evolution of diversity Alexander Belyayev and Olga Raskina Institute of Evolution, University of Haifa, Mt. Carmel, Haifa, 31905, Israel Biological diversity includes diversity within species, between species, and of ecosystems. The key question of biodiversity is how new forms arise in nature? The Middle East is considered to be the primary center of diploid and polyploid cereal species variability where local populations exhibit significant genetic diversity. Genes are most similar in closely related species and it seems that changes in non-coding repetitive DNA fraction (including transposable elements (TE)) back microevolutionary processes. It is now on record that TE may be among the most important internal sources for genotypic population change. This statement was supported by complex analysis of the individual genotypes from small marginal natural population of Aegilops speltoides Y the wild diploid progenitor of bread wheat. Tracing TE dynamics over succeeding generations reveal enhanced levels of TE activity, especially in generative tissues. TE copynumber temporal change is accompanied by a high level of morphological and chromosomal aberrations, and it is suggested that TE activity and chromosomal repatterning are interdependent. Comparative molecular cytogenetic analysis based on intra-population variability of rDNA chromosomal patterns and patterns of species-specific sequences revealed an ongoing dynamic process of permanent chromosomal rearrangements in explored populations. Inheritance of de novo chromosomal patterns happens frequently. However, the number of detected chromosomal mutations is limited, which suggests certain canalization of the microevolutionary process. Some of the rearrangements are proposed to be speciation-related on diploid (Sitopsis species) and polyploid (Triticum dicoccoides and T. aestivum) levels. Thus, the combination of genetic/epigenetic alterations caused by TE activity with karyotypic change could allow species with plastic genomes to survive as new forms/species under intensive environmental pressure.
6th ECC: Abstracts
22-L
Reorganization of genomes in the event of polyploidy and cereal ploidy Hakan Ozkan University of C¸ukurova, Faculty of Agriculture, Department of Field Crops, 01330 Adana, Turkey Polyploidy is an evolutionary process whereby two or more genomes are brought together into the same nucleus, usually by hybridization followed by chromosomes doubling. As a result, the new polyploidy is generated from its diploid progenitor(s) and a new species is formed. Polyploidy is a process that has played a decisive role in the origin and evolution of the most higher plants and animals. Recent studies with modern molecular biology techniques have shown that plants that were also considered to be classical diploid, such as maize, rice and Arabidopsis thaliana, are actually ancient polyploids. In addition to that there are several reports claiming that the most, if not all, metazoa underwent one to several rounds of chromosome doubling during their history. It seems that polyploidy played a very important role in the evolvement of higher, more complex organisms, e.g., metazoa, fungi, and higher plants, from simple ones, by providing them with a vast number of duplicated genes from which new genes with previously nonexistent functions were created. The ubiquitous role of genome duplications in evolution is one of the important discoveries of the postgenomic era, explaining the renewed interest in polyploidy. In this presentation, I will focus mainly on the effect of polyploidy on genome changes and genome evolution in grasses. I will review the most recent evidences of polyploidy as a trigger and/or facilitator for accelerated genome evolution in grasses.
23-L
Germplasm, diversity, cytogenetics around the Mediterranean Domenico Pignone CNR - IGV: Istituto di Genetica Vegetale (Institute of Plant Genetics), Via Amendola 165/A, 70126 BARI - Italy
11 The Mediterranean region is the centre of origin of several crop species and an important centre of diversification for introduced ones. Many crop wild relatives are present in this area and many wild plants are used as source of food or other uses. A large amount of the Mediterranean plant genetic diversity is threatened of genetic erosion, mostly due to the destruction of natural habitats for increased human activity, and to the rapid spreading of modern varieties of cultivated plants. At the IGV, Bari, research projects on collecting, storing and evaluating plant genetic resources (PGRs) have been carried out for over 35 years. In the recent years, a growing importance has been set to the evaluation and utilization of PGRs, as well as to developing new conservation strategies. One conceptually modern approach in this field is DNA conservation, intended as an accompanying tool, not alternative to seed conservation. As for PGRs evaluation, molecular tools, including molecular cytogenetics approaches, have allowed better insights into the understanding of how genetic diversity evolves and distributes into natural populations and/or crops. The same line of attack has also favoured the utilization of PGRs. Examples may be the transfer of disease resistance genes from wild species into cultivated wheat, thus reducing the need for chemical pesticides, or the search into the plant gene pool for new alleles of potentially useful genes to human health.
24-L
Microarrays in the diagnostic laboratory E. Maher and F. Sharkey South East Scotland Cytogenetics Service, MRC Human Genetics Unit, Edinburgh Microarray Comparative Genome Hybridisation (array CGH) allows for the detection of copy number changes throughout the entire genome at a resolution that far exceeds that of conventional cytogenetics. Although initially developed in research laboratories the technology has now matured so much that array CGH investigations are now beginning to be part of the standard repertoire of tests offered by diagnostic cytogenetics laboratories.
6th ECC: Abstracts
12 The types of referrals for which microarray analysis is appropriate include, characterising known chromosomal abnormalities, patients with an apparently balanced karyotype but with an abnormal phenotype, and children with learning difficulties and dysmorphic features. The transition of array CGH techniques out of the research environment into the diagnostic clinical laboratory setting raises many challenges. These include the availability of suitable arrays, the development of protocols capable of producing consistently high quality results, the introduction of new equipment, and the interpretation and reporting of the data. The automation of many of the processing stages such as labelling and hybridisation is likely to play an important role in consistency. As demand for array CGH investigations increases the use of automation will allow for high throughput whilst at the same time reliving staff from very repetitive work. The need for laboratory accreditation and external quality assessment will be discussed.
25-L
Application of metaphase and array CGH to preimplantation genetic diagnosis C. Le Caignec Service de Ge´ne´tique Me´dicale, CHU Nantes, France Chromosomal abnormalities are known to be common in early human embryos and are a significant cause of early pregnancy loss and implantation failure in IVF patients. Several methods, such as fluorescent in situ hybridisation (FISH) and PCR-based methods have been used to analyse chromosomes of a single cell, e.g., a blastomere biopsied from an 8-cell embryo. Currently, many IVF laboratories perform preimplantation genetic diagnosis (PGD) with FISH probes to select embryos that are free from some aneuploidies in an attempt to improve implantation, pregnancy and live birth rates in particular categories of IVF patients. However, FISH methods can only analyse a small number of genetic loci in a single cell. Complete karyotyping at the single cell level can be achieved by metaphase comparative genomic hybridization (metaphase CGH). Metaphase CGH demonstrated that, despite high levels of mosaicism,
some early human embryos do have normal chromosome number in every cell. Moreover, the method showed that chromosomal breakages and partial aneuploidies exist in embryos. Metaphase CGH has been applied to clinical PGD and has resulted in the birth of healthy babies from embryos whose full karyotype was determined in the preimplantation phase. Nonetheless, this method is labour intensive and time consuming, which limits its diagnostic potential and hampers its use in research. Based on the same principle as metaphase CGH, array CGH differs in that genomic clones from selected regions of the genome are spotted on a slide, replacing normal Bcontrol[ metaphase cells as the target DNA. This method has a high resolution and is amenable to automation. Recently, array CGH has been introduced as a rapid and high-resolution method for the detection of both benign and diseasecausing genomic copy-number variations. Until now, array CGH has been performed using a significant quantity of DNA derived from a pool of cells. Two independent teams developed an array CGH method that accurately detects chromosomal imbalances from a single cell. Trisomy 13, 18, 21 and monosomy X, as well as normal ploidy levels of all other chromosomes, were accurately determined from single lymphoblasts and fibroblasts. Moreover, segmental deletions could even be detected. Finally, it has been demonstrated the possibility to detect aneuploidies in single blastomeres derived from preimplantation embryos. This technique offers new possibilities for genetic analysis of single cells in general and opens the route towards aneuploidy screening and detection of unbalanced translocations in preimplantation embryos in particular.
26-L
Review: PGD for chromosomal abnormalities with FISH C. Staessen Centres for Medical Genetics, Dutch-speaking Brussels Free University, Laarbeeklaan 101, 1090 Brussels, Belgium Preimplantation genetic diagnosis (PGD) was introduced at the beginning of the 1990s (Handyside et al. 1990) as an alternative to prenatal diagnosis in
6th ECC: Abstracts couples with a high risk for offspring affected by a genetic disease. Since the introduction of preimplantation genetic diagnosis (PGD), the number of cycles and centres performing PGD has been steadily increasing and new technologies have been added. PGD is proposed for carriers of chromosome rearrangements who present repeated miscarriage, unbalanced offspring and termination of pregnancy or those who need assisted reproductive techniques. Fluorescence in-situ hybridisation (FISH) has been introduced as the primary technique to detect chromosome imbalance associated with chromosome rearrangements. The purpose of PGD is to identify chromosomal abnormalities prior to implantation, decreasing the risk of abnormalities in the fetus as well as the potential need for termination of affected fetuses after prenatal diagnosis. The overall pregnancy rates after PGD for translocations are of the same order as those after ICSI performed for infertility. Therefore, PGD may be seen as a useful adjunct to ART for couples with translocations who also have fertility problems. Prenatal diagnosis has been available to carriers of chromosome rearrangements for many years. However, termination of pregnancy is not an acceptable option for some couples carrying chromosome rearrangements with a high reproductive risk but without fertility problems. From carriers of these chromosome rearrangements, there is also growing interest in PGD in conjunction with ART. The purpose of this presentation is to review the techniques used in PGD for chromosomal abnormalities and to discuss the results obtained with the technique.
13
Handyside et al. (1990) Nature, 344, 768Y770. Munne´ et al. (2000) Fertil. Steril., 73, 1209Y1218.
mechanical difficulties of the ring during cell division, through continuous generation of secondary aneuploidy, lead to genetic instability. Consequently, in cases with constitutional ring chromosomes (population incidence ~1 in 3Y60 000 births) both genotype/phenotype, and karyotype/genotype correlations are poor. A review 20 years ago summarising more than 200 case reports found that in a fifth of cases the ring might be resulted from an event not involving deletion in the genetic sense, and the consequent ring syndrome[ could be attributed to the ring mechanics. These case reports had relied on standard cytogenetic banding techniques. The technical development, however, has brought new insights into the nature of ring chromosomes, contributing to the understanding of the genetic and clinical consequences. (1) Molecular techniques could detect deletion even in an apparently complete ring. Moreover, hemizygosity of certain gene residing at the telomeric regions may explain even some typical Bring syndrome[ features. Hence, the occurrence of pure Bring syndrome[ is probably less than previously was suggested. (2) On the other hand, it could also be demonstrated at the molecular level that ring chromosomes can in fact be formed without significant loss of genetic material, even by end-fusion of palindromic sequences. (3) Studies by molecular genetic techniques have indicated novel mechanisms for the formation both of a ring chromosome and its associated aberrations. (4) Extended studies of ring behaviour during embryonic development indicate that the formation of transient secondary aneuploid cells may further confound karyotype/ phenotype correlations. All of these indicate that detecting ring chromosome in clinical cytogenetics should be followed by detailed genetical and phenotypical analyses in order to get more information about the complexity of this peculiar anomaly.
27-L
28-L
Consequences of ring formation of human chromosomes
Array CGH findings of ring chromosomes
G. Kosztola´nyi
E. Rossi
Dept. Medical Genetics and Child Development, University of Pe´cs, Hungary
Dip. di Patologia Umana ed Ereditaria, sez. di Biologia Generale e Genetica Medica, Via Forlanini 14, 27100 Pavia, Italy
References
It is well known that the preceding events of ring chromosome formation lead to variability in the rings_ genetic make-up in different cases, and that the
Inverted duplications associated with a distal deletion (inv dup del) have been reported for several
6th ECC: Abstracts
14 chromosomes, but hardly ever in ring chromosomes. Characterizing, by array-CGH (Kit Agilent, 75 Kb and 6,5 Kb) and FISH, 25 different ring chromosomes in patients with phenotypic abnormalities, we identified in six of them inverted duplications associated with a terminal deletion at one end. At the opposite end no deletion was present in four cases, whereas a second deletion was present in two cases. Moreover, in one case with an inv dup del(13q), a further duplication of (13)(q12.21Y3.1) was present in mosaic state. Peripheral chromosomes analysis of the patients showed the following karyoptypes: Case Case Case Case Case Case
1: 2: 3: 4: 5: 6:
46,XX,r(13)(p11q34); 46,XX,r(15)(p11q26); 46,XX,r(18)(p11q23); 46,XX,r(13)(p11q34); 46,XX,r(22)(p11q26); 46,XX,r(18)(p11q23)
Mental retardation and dysmorphic features are common findings in the six patients. Our results suggest that a more complex mechanism may be involved in the formation of some ring chromosomes and that ring formation may represent a new mechanism involved in the stabilization of broken chromosomes. This new mechanism of ring formation has important phenotype/genotype implications since it implies that phenotypic correlations cannot be done assuming a simple deletion before having excluded this type of rearrangement.
29-L
Array CGH in prenatal diagnosis Heike Fiegler1, Lisa Rickman2, Diane Rigler1, John Anson3, Mike Evans3, Vincenzo Cirigliano4, Martin Bobrow2 and Nigel P. Carter1 1
The Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, UK; 2University of Cambridge, Department of Medical Genetics, Addenbrooke_s Hospital, Cambridge, UK; 3Oxford Gene Technology, Begbroke Science Park, Oxford, UK; 4Departament de Gene`tica Molecular, General Laboratory, Barcelona, Spain
For over 30 years conventional karyotyping has been the gold standard in prenatal diagnosis. Although reliable for identifying aneuploidies and large structural rearrangements, the disadvantage of this method is its requirement for cell culture with the effect of delaying reports of test results for as much as two weeks. To overcome this problem, array-CGH has been introduced into prenatal diagnosis offering a genome wide screen of copy number changes as well as a quick turnaround of the DNA samples. We have initially constructed a large-insert clone based DNA microarray with the aim to detect chromosome aneuploidies, known microdeletions and large unbalanced chromosomal rearrangements. The array performance was thoroughly analysed in a blind study using 60 cultured and uncultured pre-and postnatal samples with previously confirmed unbalanced rearrangements. We are now in the process of translating this array into an oligonucleotide based array assay to reduce costs and analysis time further, thus making it an attractive alternative for routine prentatal screening.
30-L
Non-invasive prenatal diagnosis M. Rodrı´guez de Alba, A. Bustamante-Aragone´s and C. Ramos Department of Genetics, Fundacio´n Jime´nez Dı´az-CIBERER (ISCIII), Madrid, Spain The obstetric care of a pregnancy, as it is practised today, includes non-invasive screening approaches as well as invasive procedures for the definitive prenatal diagnosis of foetal disorders. However since amniocentesis and CVS may carry a risk of foetal loss, considerable work has been done on developing noninvasive prenatal diagnostic methods. The first approach came as a result of the isolation of fetal nucleated red blood cells that have transferred into the maternal circulation. Their cytogenetic analysis, based on the application of the FISH technique, has been described as one of the best approaches to the noninvasive assesment of feotal aneuploidies. In fact, several groups have reported the diagnosis of the most frequent aneuploidies. Nevertheless the scarcity of these cells, the time consuming isolation methods and the difficulty in successfully hybridising them, encouraged
6th ECC: Abstracts researchers to look for alternative approaches. Anyhow, some groups are still working on the potential of their identification and quantification as a second step in screening for foetal aneuploidies. It was in 1997 when Lo et al. firstly described the presence of foetal DNA in maternal blood opening novel and exciting possibilities for non-invasive prenatal diagnosis of certain foetal conditions. Because maternal DNA is always present in the sample together with the foetal DNA, the diagnosis is limited to paternally inherited conditions. In this way, a number of studies have already been done in order to identify paternally inherited sequences, diagnose dominant disorders and detect the paternal allele in those disorders with a recessive inheritance. In the latter, if the paternal mutation is found it is still necessary to undergo prenatal diagnosis to know the foetal condition. In spite of all the promising results, to date only two Bdiagnosis[ have been translated into clinical application: foetal rhesus D blood typing and sex determination. However, in spite of being the main referal reason for prenatal diagnosis, a reliable cytogenetic analysis is currently not available and remains the subject of ongoing research. Recent studies are focussing on new approaches to detect foetal trisomies based on the analysis of epigenetic allelic ratios in maternal plasma and SNPs genotyping.
31-L
Towards automated FISH screening: Fully automated FISH examination of amniotic fluid cells J. Wouters Department of Medical Genetics, Cytogenetics and Molecular Cytogenetics, Antwerp University and University Hospital, Wilrijk, Belgium The efficacy of a fully automated system for FISH analysis as a rapid screen for common chromosome abnormalities in prenatal diagnosis was compared to standard manual FISH analysis in 152 amniotic fluid samples. Following hybridization with a standard panel of five chromosome FISH probes, one set of slides was evaluated using manual microscopy. The other set was evaluated using an automated microscopy system.
15 Results A diagnostic outcome was obtained for all 152 samples using manual microscopy and for 146 of 152 (96Q) samples using automated microscopy. Three cases of aneuploidy were detected. For those samples for which a diagnostic outcome was determined by both manual and automated microscopy, 100Q concordance was observed. The robustness of the automated system was demonstrated by the high degree of reproducibility between two separate instruments operating in two locations. All FISH analysis results were confirmed by karyotype. Conclusion These data suggest that an automated microscopy system is capable of providing accurate and rapid enumeration of FISH signals in amniocytes.
32-L
Human chromosomal bands: nested structure, high-definition map and molecular basis Maria Costantini1, Oliver Clay1, Concetta Federico2, Salvatore Saccone2, Fabio Auletta1 and Giorgio Bernardi1 1
Laboratory of Molecular Evolution, Stazione Zoologica Anton Dohrn, 80121 Naples, Italy; 2 Dipartimento di Biologia Animale BM. La Greca[, University of Catania, 95124 Catania, Italy We found the rules according to which the ~3,200 isochores of the human genome are assembled in high (850-band) resolution bands, and the latter in low (400-band) resolution bands, so forming the nested mosaic structure of chromosomes. Moreover, we identified the borders of both sets of chromosomal bands at the DNA sequence level on the basis of our recent map of isochores, which represent the highest-resolution, ultimate bands. Indeed, beyond the 100-kb resolution of the isochore map, the guanine and cytosine (GC) profile of DNA becomes turbulent owing to the contribution of specific sequences such as exons, introns, interspersed repeats, CpG islands, etc. The isochore-based level of definition (100 kb) of chromosomal bands is much higher than the cytogenetic definition level (2Y3 Mb). The major conclusions of this work concern the high
6th ECC: Abstracts
16 degree of order found in the structure of chromosomal bands, their mapping at a high definition, and the solution of the long-standing problem of the molecular basis of chromosomal bands, as these could be defined on the basis of compositional DNA properties alone.
34-L
Human neocentromeres and evolutionary-new centromeres M. Rocchi DAPEG, Instituto di Genetica, Bari, Italy
33-L
Mechanisms of DNA rearrangements underlying genomic disorders Pawel Stankiewicz Dept. of Medical Genetics, Institute of Mother and Child, Warsaw, Poland; Dept. of Molecular & Human Genetics, Baylor College of Medicine, Houston, Texas, USA Genomic disorders are a group of human genetic diseases caused by genomic rearrangements resulting in copy-number variation affecting a dosage sensitive gene(s) (Lupski 1998). Genome architectural features consisting of low-copy repeats (LCRs) or segmental duplications have been shown to be responsible for constitutional, evolutionary, and somatic genomic rearrangements (e.g. deletions, duplications, inversions, reciprocal translocations, jumping translocations, marker chromosomes, isochromosomes, and complex rearrangements). LCRs910 kb in size with 9 97Q DNA sequence identity can stimulate and mediate nonallelic homologous recombination (NAHR) (interchromosomal, intrachromosomal, or intrachromatid unequal crossing-over), a major mechanism for recurrent rearrangements. Analysis of the products of recombination at the junctions of the nonrecurrent rearrangements revealed both NAHR and nonhomologous end joining (where LCRs may stimulate, but not necessarily mediate the rearrangement) as causative mechanisms. Furthermore, smaller repetitive sequences, such as Alu elements, pericentromeric heterochromain, as well as simple repeating DNA sequences that have a potential of adopting non-B DNA conformations (e.g. triplexes, cruciforms, left-handed Z-DNA, and tetraplexes) have been shown to lead to gross genomic rearrangements associated with many genomic disorders. Finally, recent data suggest that some genomic disorders may result also from replication-based DNA rearrangements.
Karyotype evolution was initially studied using classical cytogenetics and, more recently, using molecular cytogenetic tools. Chromosome painting and reciprocal chromosome painting, in particular, have delineated the organization of the karyotype in primate ancestor and in mammal ancestor (Muller and Wienberg 2001; Murphy et al. 2001). More recently, the availability of BAC clones for molecular cytogenetics studies has allowed the accurate tracking of marker order changes along chromosomes during evolution. This approach has disclosed the unprecedented phenomenon of Bcentromere repositioning[, that is the movement of the centromere along the chromosome without marker order variation. The phenomenon implies the inactivation of the old centromere and the seeding of a new centromere. It has, therefore, a huge impact on chromosome architecture. Using FISH and bioinformatic tools, we have tracked, in primates and in selected non-primate mammals, the evolutionary history of chromosomes 9, 6, 14/15, 3, 20 (Eder et al. 2003; Misceo et al. 2005; Montefalcone et al. 1999; Ventura et al. 2003, 2004). Several examples of CR events were found, indicating that this a quite common evolutionary phenomenon. The evolution of chromosome 13, in particular, showed peculiar results. If the centromere is not taken into account, the same marker order was indeed found in humans, Old World monkeys, squirrel monkey (New World monkey), pig, and horse. The telomeric position of the centromere in humans and horse appears, very likely, to represent the ancestral form. In pig and Old World monkeys, however, the centromere was located in the middle of the chromosome, in a region corresponding to the human 13q21. In addition, two human neocentromeres were found to have emerged in this same region. These data strongly suggest an unprecedented scenario: the latent 13q21 centromeric competence in humans dates at least before mammalian clade III (primates) and IV (pig) divergence, that is at least 95 million years ago. Recently, we investigated chromosome conservation
6th ECC: Abstracts in Burchelli_s zebra (Equus burchelli), donkey (Equus asinus), and horse (Equus caballus). Surprisingly, at least 8 CRs took place during the evolution of this genus. Even more surprisingly, 5 cases of CR have occurred in the donkey after its divergence from zebra, that is in a very short evolutionary time (approximately one million years) (Carbone et al. 2006). To better understand the dynamics of an evolutionary-new centroemre progression we compared the centromere of macaque chromosome 4 with the human orthologous region, at 6q24.3, which conserves the ancestral genomic organization. A 250 kb segment was extensively duplicated around the macaque centromere. These duplications were strictly intrachromosomal. References Carbone et al. 2006. Evolutionary movement of centromeres in horse, donkey, and zebra. Genomics, 87: 777Y782. Eder et al. 2003. Chromosome 6 phylogeny in primates and centromere repositioning. Mol Biol Evol 20: 1506Y1512. Misceo et al. 2005. Evolutionary history of chromosome 20. Mol Biol Evol 22: 360Y366. Montefalcone et al. 1999. Centromere repositioning. Genome Res 9: 1184Y1188. Muller and Wienberg. 2001. BBar-coding[ primate chromosomes: molecular cytogenetic screening for the ancestral hominoid karyotype. Hum Genet 109: 85Y94. Murphy et al. 2001. Evolution of mammalian genome organization inferred from comparative gene mapping. Genome Biol 2: REVIEWS0005. Ventura et al. 2003. Neocentromeres in 15q24Y26 map to duplicons which flanked an ancestral centromere in 15q25. Genome Res 13: 2059Y2068. Ventura et al. 2004. Recurrent sites for new centromere seeding. Genome Res 14: 1696Y1703.
35-L
Frequency and types of unbalanced chromosomes rearrangements combining new and old data Orsetta Zuffardi Genetica Medica, Universita` di Pavia, Italy
17 In the last few years genome-wide arrays have demonstrated that human genome is much more unstable than previously thought. The presence of submicroscopic copy number variations (CNV) in normal population demonstrated that deletions and duplications/multiplication influencing gene expression are the main cause of our phenotypic variability. Concerning pathogenic CNVs, the scenario is totally changed: in 2000 the frequency of interstitial imbalances was considered of at least 1:4000 both for deletions and duplications (Shaffer and Lupski 2000). These frequencies were based not only on their estimated frequency but also considering that many interstitial duplications may be the reciprocal recombination product of deletions. Screenings of patients with mental retardation, with or without associated anomalies, by genome-wide arrays using platforms at different resolution revealed that interstitial deletions outnumber interstitial duplications of at least three times and that, based on the frequency of mental retardation in the general population of 2Q, pathogenic deletions have a population frequency of about 1:500 and pathogenic duplications of about 1:1600. Triplications/multiplications are a novelty: although they have been considered a very rare findings among patients having a chromosome imbalance they start to become relatively frequent among mentally retarded patients screened by genome-wide arrays. Finally the finding of the same imbalance in affected individuals and in the normal parent indeed complicates both the interpretation of the data (the thrombocytopeniaabsent radius story is paradigmatic) and the statement of the frequency of pathogenic imbalances in the general population leading to the main question of what can be really considered Bnormal[.
36-L
The history of chromosome 22q distal deletion: actual frequency and related phenotype Maria Clara Bonaglia IRCCS E. Medea, Bosisio Parini, Lecco, Italy The 22q13.3 deletion syndrome (MIM 606232), recently named Phelan-McDermid syndrome, is characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to
18 severely delayed speech and minor dysmorphic features. Facial features include dolichocephaly, full brow, ptosis, long eye lashes, wide nasal bridge, flat midface, puffy eyelids, full cheeks, bulbous nose, large/prominent ears, and pointed chin. Other features are large hands, dysplastic toenails, decreased perspiration, and sacral dimple. Behaviour is described as Bautistic-like[ and includes high tolerance to pain and habitual chewing or mouthing. No apparent lifethreatening organic abnormalities accompany the diagnosis of deletion 22q13. Affected individuals benefit from early intervention programs, intense occupational and communication therapies, adaptive exercise and sports programs, and other therapies to strengthen their muscles and increase their communication skills. The diagnosis of 22q13.3 syndrome is confirmed by the demonstration of a deletion or disruption of 22q13.3. Approximately 75Q of subjects with the 22q13.3 deletion syndrome have pure 22q deletions, (Wilson et al. 2003) either terminal or interstitial, and about 25Q have deletions resulting from an unbalanced translocation (Smith et al. 2000) or other structural rearrangement (Wilson et al. 2003) such as r(22) (Luciani et al. 2003) or reciprocal translocations (Bonaglia et al. 2001; Anderlid et al. 2002). The deletion occurs with equal frequency in males and females (Wilson et al. 2003). The increasing number of patients being reported supports the hypothesis that this syndrome may be a common source of mental retardation and the second most common subtelomeric deletion, after the 1p36.6 deletion (Heilstedt et al. 2003). Considering the non-specificity of the phenotype, all subjects presenting global developmental delay and severe speech delay should undergo appropriate tests for a cryptic 22q13 deletion. In spite of the increasing number of reported cases, the deletion 22q13.3 remains under-diagnosed due to failure to detect the deletion in routine chromosome analysis and to recognize the phenotype on clinical examination. As a consequence, its incidence is not yet established (Phelan 2005). In fact, the identification of the 22qter deletion has been serendipitous in some patients referred for VCF/DGS (Precht et al. 1998). Since the deletions have sizes ranging from 100 Kb (Anderlid et al. 2002) to more then 9 Mb (Wilson et al. 2003) high resolution karyotype analysis will miss many of them. FISH analysis with specific subtelomeric probes can also give ambiguous results,
6th ECC: Abstracts and requires careful evaluation of the hybridization signal intensity (Anderlid et al. 2002; Bonaglia et al. 2005). The molecular diagnosis of the 22q13 deletion syndrome is made by demonstration of a deletion of 22q13.3 that may be variable in size. In the deletion region lies SHANK3/PROSAP2 gene, that encodes a structural protein located in the post synaptic density (PSD) and belongs to a family of genes playing a pivotal role in the development of the human nervous system and in glutamatergic synapse functions (Sala et al. 2001; Roussignol et al. 2005). Haploinsufficiency of this gene seems to be causative for the major neurological features of the 22q13 deletion syndrome since a reciprocal translocation breaking SHANK3 resulted in the same phenotype of deletion patients (Bonaglia et al. 2001) and recently it was demonstrated that a mutation of one copy of SHANK3 can result in language and/or social communication impairment (Durand et al. 2006). This finding is supported by the observation of four affected individuals with a terminal deletion of 140 kb, all with identical breakpoint (defined at base-pair level) within an intron of SHANK3 (Bonaglia et al. 2005; Durand et al. 2006). Two other genes have been identified in the deleted 22q13.3 region: ACR (acrosin), and RABL2B. ACR codes for a serine protease in the acrosome of sperm heads and likely does not contribute to the syndrome phenotype but may affect fertility (Wong et al. 1997). RABL2B shares similarities with the RAB family of GTPases, which are involved in the control of vesicular trafficking. Its function is currently unknown; however, the existence of RABL2A (which is located at 2q13), that is also expressed and very close in sequence to RABL2B, makes RABL2B unlikely to be dose sensitive (Wong et al. 1999). These results indicate that the SHANK3 deletion represents a new recurrent genomic rearrangement and suggest that there may be an underlying genomic mechanism contributing to these recurring deletions. However, both subtelomeric FISH with commercially available kits (both 22q signals are still present although one is smaller), tyling-path BAC and even 44 k oligo-arrays overlook the deletion. The 44 k oligo-arrays Agilent platform indeed detects two deletion spots at the end of 22q, too few to make a call by the analysis software. On the contrary, the 244A platform (Agilent) covers the terminal 140 Kb
6th ECC: Abstracts with 12 probes, enough to make a call without any doubts. So, this new molecular cytogenetic approach (oligo Yarray CGH at resolution of ~5 Kb ) represents an excellent tool to precisely diagnose 22q13 deletion, search for other patients, enhance genotype/phenotype correlation and establish the true frequency of the 22q13 deletion syndrome.
37-L
BBalanced[ complex rearrangements: how many are really balanced? Joris Robert Vermeesch19, Liesbeth Backs19, Manuela De Gregori1, Roberto Ciccone1 Pamela Magini 1 , Francisco Cifuentes 2 , Tiziano Pramparo1, Stefania Gimelli1, Jole Messa1, Francesca Novara1, Annalisa Vetro1, Paola Maraschio1, Maria Clara Bonaglia3, Cecilia Anichini4, Giovanni Battista Ferrero5, Margherita Silengo5, Elisa Fazzi6, Adriana Zatterale7, Rita Fischetto8, Carlo Previdere´9, Serena Belli10, Alessandra Turci11, Giuseppe Calabrese12, Franca Bernardi13, Emanuela Meneghelli13, Mariluce Riegel14, Mariano Rocchi15, Silvana Guerneri 16 , Faustina Lalatta 16 , Corrado Romano17, Marco Fichera17, Teresa Mattina18, Albert Schinzel14 and Orsetta Zuffardi1,20 1
Biologia Generale e Genetica Medica, Universita` di Pavia, Pavia, Italy; 2Agilent technologies Santa Clara, California 95051, USA; 3IRCCS E. Medea, Bosisio Parini, Lecco, Italy; 4Pediatria, Universita` di Siena, Siena, Italy; 5Dip. di Scienze Pediatriche, Universita" di Torino, Torino, Italy; 6IRCCS C. Mondino, Universita` di Pavia, Pavia; 7Servizio di Citogenetica ASL-NA1, Napoli, Italy; 8Azienda Ospedaliera di Venere-Giovanni XXIII, Bari, Italy; 9Dip. di Medicina Legale e Sanita` Pubblica, Universita` di Pavia, Pavia, Italy; 10Consultorio Genetico, Trento, Italy; 11Citogenetica, Ospedale di Ravenna, Ravenna, Italy; 12 Genetica Medica, Universita` di Chieti, Chieti, Italy; 13Patologia Genetica e Prenatale, Policlinico G.B. Rossi, Verona, Italy; 14 Institute of Medical Genetics, University of Zurich, Zurich, Switzerland; 15Dip. di Genetica e Microbiologia, Universita` di Bari, Bari, Italy; 16Fondazione Ospedale
19 Maggiore, Mangiagalli e Regina Elena, Milano, Italy; 17 Oasi Institute for Research on Mental Retardation and Brain Aging, Troina, Italy; 18Genetica Medica, Universita` di Catania, Catania, Italy; 19Center for Human Genetics, University Hospital Gasthuisberg, Leuven, Belgium; 20 IRCSS Policlinico San Matteo, Pavia, Italy Several recent studies suggest that apparently balanced translocations may actually hide submicroscopic imbalances. An overview of current findings will be provided. In addition, we hereby report array-CGH findings (44B Agilent kit, resolution of 100 kb) in 28 cases of de-novo reciprocal translocations and 17 complex chromosome rearrangements (CCRs), all but one interpreted as balanced through conventional cytogenetic examinations. Thirteen CCRs were detected in individuals with abnormal phenotypes, two in females with repeated abortions and the remaining two were detected during prenatal screening for advanced maternal age. In fifteen (twelve patients with Bchromosomal phenotype[, one of the women with repeated abortions and the two fetuses) up to four deletions were detected either at the breakpoints or elsewhere in the genome. Imbalances were detected in eight out of nineteen patients with abnormal phenotype and apparently balanced reciprocal translocations. In nine fetuses with an apparently balanced translocation no imbalances were detected. Our findings suggest that phenotypic abnormalities, reported in half of the cases of apparently balanced de novo rearrangements, are due to cryptic deletions at the translocation breakpoints or elsewhere in the genome. Thus, molecular karyotyping is recommended in patients with an abnormal phenotype and apparently balanced reciprocal or complex chromosomal translocations. In addition, we show that all twenty-three imbalances originated at the paternal meiosis indicating that mainly male gametogenesis is prone to create complex chromosome rearrangements.
38-L
Triplication and more than triplication rearrangements Grace M. Hobson Nemours Biomedical Research, A. I. duPont Hospital for Children, Wilmington, DE, USA; Department of Pediatrics, Thomas Jefferson University, Philadelphia, PA, USA
20 Duplication of a genomic region of Xq22 that includes the proteolipid protein 1 gene (PLP1) is the most common mutation causing PelizaeusMerzbacher disease (PMD), an X-linked dysmyelinating leukodystrophy. The duplications in PMD are heterogeneous in size and in location of breakpoints. They arise most frequently by a grandpaternal intrachromosomal event and have a tandem headto-tail orientation. Our data obtained by interphase FISH, quantitative PCR, and junction analysis, suggested a coupled homologous and nonhomologous mechanism for formation of the duplications in PMD. This is in contrast to other genomic disorders where recurrent rearrangements are formed by nonallelic homologous recombination. We have shown that patients with three or more copies of PLP1 have a more severe phenotype than those with duplication. X-chromosome oligonucleotide array CGH data will be presented on seven PMD patients
6th ECC: Abstracts with copy number greater than duplication, two of which have more than triplication. The patients also have regions that are duplicated in addition to the higher copy number regions. Although the locations of the proximal ends of the higher copy number regions are variable, the distal ends in all but one patient are within the low copy repeat region (LCR) distal of PLP1, suggesting involvement of the LCR in formation of the rearrangements. Two of the seven patients have higher copy number regions that do not include PLP1, while their PLP1 gene is duplicated. One of these patients has a classic PMD presentation like that of most PLP1 duplication patients, but the other has a more severe phenotype like that of patients with PLP1 triplication. Our data demonstrate the power of the oligonucleotide array CGH technique for rapid and detailed examination of copy number. Limitations of the technique will be discussed.
6th ECC: Abstracts
Oral and poster abstracts 1.1-O
An apparently active r(X) in a female patient with Kabuki like features L. Rodrı´guez, D. Diego-Alvarez, I. Lorda-Sanchez, E. Mansilla, F. L. Gallardo, M. L. Martı´nez-Ferna´ndez, M. E. Arroyo-Mun˜oz and M. L. Martı´nez-Frı´as CIAC, Fundacio´n Jime´nez Dı´az., Hospital de Montilla, CIAC, Universidad Complutense Introduction: X chromosome inactivation occurs randomly as an irreversible process by the expression of XIST (Xq13.2). Nevertheless, when one X is structurally abnormal (duplicated, deleted, isochromosome or ring), it is preferentially inactivated giving rise to a Turner syndrome phenotype. However, Kabuki-like phenotype has been described in a few patients carrying a small X ring chromosome. We present molecular studies on a female patient with a 46,X,r(X) karyotype and clinical features resembling Kabuki syndrome. Clinical case: The patient was the first daughter from a healthy non-consanguineous couple, aged 30 and 32 years. Fetal biometry was concordant with gestational age until the 32nd week, when an abnormal short femur was observed. At birth (38th week) she weighed 2820g (p25), 45cm length (p25) and an OFC of 33.5cm (p50), showing craniofacial anomalies, lymphedema of the dorsum of hands and feet and hypoplasia of the labia majora. At 18 months of age, she had clinical characteristics compatible with Kabuki syndrome including a slight psychomotor delay and growth retardation. Genetic studies: High resolution karyotype and FISH on peripheral blood lymphocytes showed a small de novo r(X) in all analyzed cells, assessed to be paternal in origin by genotyping. Methylationspecific PCR assay was performed on AR gene (Xq11-q12), where methylation status correlates with X inactivation. Results showed the presence of two distinct alleles at this locus, both unmethylated. Discussion: The lack of expression of XIST on r(X) is probably because this gene is absent, disrupted or functionally abnormal on the ring. This
21 situation may lead to functional disomy of some of those genes contained on the r(X) causing Kabukilike phenotype. Further studies will be carried out using array CGH in order to determine the size and gene content of the ring and discard the presence of subtle imbalances across the whole genome.
1.2-O
Array painting using microdissected chromosomes to map chromosomal breakpoints L. Backx, H. Van Esch, C. Melotte, N. Kosyakova, J. P. Frijns, H. Starke, T. Liehr and J. R. Vermeesch University Hospital Leuven, Institut fu¨r Humangenetik und Anthropologie, Jena, Jena, Jena Molecular characterization of breakpoints of balanced chromosomal rearrangements is a successful strategy to identify candidate disease genes. The techniques that are traditionally used for this purpose are time consuming. Rapid high-resolution mapping of breakpoints was achieved by flow-sorting aberrant chromosomes followed by fluorescent labelling and hybridising to genomic arrays. We developed a variant technique, using a combination of chromosome microdissection and array comparative genomic hybridisation (CGH). Abnormal chromosomal fragments are dissected and subsequently DOP amplified, fluorescent labelled and hybridised to genomic array. High intensity hybridisation signals are observed at the targets mapping to the flow-sorted chromosomes, whereas low signals are detected for other chromosomes. The boundary between high and low intensity values indicates where the breakpoint is positioned. We dissected small supernumerary marker chromosomes (sSMC) from 15 patients and 1 large abnormal chromosome and identified the position of the chromosomal breakpoints in a single experiment. In addition, we dissected 10 translocation breakpoints. Array CGH indicated the position of the breakpoints and the location of the breakpoints were confirmed by FISH. Microdissection has the advantage to overcome some of the limitations of flow-sorting. First, it can be carried out with relatively simple apparatus. Secondly,
6th ECC: Abstracts
22 separate arm-specific probes can be constructed to analyze intrachromosomal rearrangements like inversions. Thirdly, small marker chromosomes, which cannot be separated by flow-sorting, can be easily dissected and analyzed. Finally, material present in only a small amount of all cells (for example tumor samples) with chromosomal rearrangements can be dissected and analyzed. Our results demonstrate the power of the technology to enable the molecular characterization of the breakpoints in a single experiment.
listed and light up in blue on a genome chart. Links to relevant literature are provided with the cytoband profile. The user chooses from 11 different domain specific vocabularies, such as disease, dysmorphology, anatomy, molecular function, to annotate the genome. These phenotypic genome maps facilitate clinical diagnostics and literature survey, and support identification of genetic loci involved in disease processes and delineation of novel clinically recognizable entities. The tool is available at http:// www.esat.kuleuven.be/abandapart.
1.3-O
Literature mining for constitutional cytogenetics S. Van Vooren, B. Coessens, B. Thienpont, J. Vermeesch, B. De Moor and Y. Moreau Katholieke Universiteit Leuven We present a text mining application that uses publicly available literature to statistically link phenotype descriptions to genomic deletions and duplications within the context of constitutional cytogenetics. Cytogeneticists are familiar with banding patterns of chromosomes at various levels of cytogenetic resolution. Hence, reports in the literature frequently mention bands to delineate a genomic region. A specific nomenclature allows unambiguous detection of cytobands. Based on this premise we constructed a database that links PUBMED abstracts to cytogenetic bands. This highly specific map is then used to characterise individual cytobands based on the content of linked abstracts. The tool functions in two directions. On the one hand, users enter or click a cytoband on the genome view. the tool will characterize that band with statistically overrepresented vocabulary concepts found in the literature. For example, when aBandApart is queried with F4p16.3_ and a disease vocabulary, the most significant concepts are achondroplasia, Wolf Hirschhorn syndrome, Huntington Disease, multiple myeloma, cherubism, dwarfism and hypochondroplasia, all of which are confirmed to be associated to that region. On the other hand, users can start from a concept and query the database for statistically overrepresented chromosomal regions. Overrepresented bands are
1.4-O
Trisomies represent risk factors for further independent non-disjunction events Baumer, S. Basaran, E. Wey, M. Taralczak, M. Kirgiz, K. Ozkan, A. Engu¨r, T. Dehgan, B. Karaman and A. Schinzel University of Zurich, Department of Pediatrics, PREMED, Center for Genetic Diagnosis, Tesvikiye, Istanbul, Turkey, Istanbul University, Istanbul Medical Faculty, Medical Genetics, Istanbul The vast majority of trisomies originate during the meiotic divisions in the maternal germ line. It is well documented that trisomies for certain chromosomes are more frequently due to non-disjunction events during either the first (e.g. trisomy 21) or the second meiotic division (e.g. trisomy 18). Less is known about the mode of formation of complex rearrangements; although on several occasions evidence (direct or indirect) was found of an initial trisomy, which is assumed to have subsequently led to further rearrangements. In this study we present molecular data regarding 22 foetuses with double or triple aneuploidies. The cases were separated in 2 groups: those showing at least one autosomal aneuploidy (n = 14) and those with aneuploidies concerning only the X and Y chromosomes (n =8). Most cases showed, as expected, a predominantly maternal non-disjunction event during meiosis I for the chromosomes involved. Interestingly, there is evidence in some cases that the non-disjunction events do not appear to have occurred during the same cellular division. This phenomenon is
6th ECC: Abstracts clearer for double aneuploidies concerning the X and Y chromosomes, however, was also observed in at least 4/14 cases with aneuploidies concerning autosomes. The multiple distinct non-disjunction events could theoretically have occurred by chance (the odds being extremely low); or alternatively, the initial trisomy may represent a risk factor for subsequent non-disjunction events concerning different chromosomes.
23 whole blood smear. Estimates of the level of mosaicism were generally higher for CMA compared with methodologies that use T-cells with standard chromosome and FISH analysis. Thus, we assert that CMA is more sensitive to the standard cytogenetics methods in detecting mosaicism and estimating the level of mosaicism for both autosomal and sex aneuploidy and uncovering other complex cytogenetic aberrations.
1.5-O
Detection of somatic mosaicism by Targeted aCGH: Clinical experience of 5000 samples
1.1-P
Cheung, C. Shaw, A. Patel, T. Sahoo, C. Bacino, A. Pursley, A. C. Chinault, P. Stankiewicz, J. R. Lupski and A. Beaudet
Maternal balanced translocation (4;21) leading to an offspring with partial duplication of 4q and 21q without phenotypic manifestations of Down syndrome
Baylor College of Medicine
M. El Ruby, Maha Zaki and Nevine Helmy
We have developed a targeted aCGH platform known as chromosome microarray analysis (CMA) for clinical use in our diagnostic laboratory. This platform contains bacterial artificial chromosome (BAC) clones that encompass subtelomeric and pericentromeric regions as well as regions of the genome involved in common microdeletion/microduplication (genomic) disorders. Therefore in a single assay, hundreds of genomic regions can be interrogated for gains or losses in copy number. We have performed CMA using the version 5 and version 6 of our array on over 5000 samples and identified over 30 cases in which the results were indicative of mosaicism. Mosaicism in autosomal aneuploidy (35%), sex chromosome aneuploidy (30%) including detection of three cell lines, marker chromosomes (30%) including three cases of PKS, various inv dup chromosomes and ring chromosomes. In 50% of cases, prior routine chromosome analysis had been normal. We therefore hypothesized that CMA may be a more sensitive method for detecting mosaicism. The presence of mosaicism in all cases was confirmed by one or more of the following methodologies: G banded chromosome analysis of stimulated T-cells from peripheral blood or cultured skin fibroblasts; FISH analysis on stimulated T-cells or unstimulated nucleated cells in
National Research Center, National Research Center, National Research Center We describe an 8-year old female with supernumerary chromosome der(21)t(4;21)(q25;q22) resulting in partial trisomy 4q25-qter and partial trisomy 21(pter-q22). The extra material had originated from a reciprocal balanced translocation carrier mother (4q;21q). Karyotyping was confirmed by FISH using whole chromosome painting probes for 4 and 21q and using 21q22.13-q22.2 specific probe. Phenotypic and cytogenetic findings were compared with previously published cases of partial trisomy 4q and 21q. Our patient had the major criteria of distal trisomy 4q namely severe psychomotor retardation, growth retardation, microcephaly, hearing impairment, specific facies (broad nasal root, hypertelorism, ptosis, narrow palpebral fissures, long eye lashes, long philtrum, carp mouth and malformed ears) and thumb and minor feet anomalies. Inspite of detection of most of the 3 copies of chromosome 21, specific features of Down syndrome (DS) were lacking in this patient, except for notable bilateral symmetrical calcification of basal ganglia. This report represents further delineation of phenotype-genotype correlation of trisomy 4q syndrome. It also supports the suggestion that DS phenotype is closely linked to 21q22. Nevertheless, presence of basal ganglia calcification in this patient
6th ECC: Abstracts
24 suggests a contribution of a more proximal region for its development in DS. Alternatively, genes outside the critical region may influence or control manifestations of DS features.
1.2-P
Small supernumerary marker chromosomes (sSMC) detected in connection with infertility Y new surprising results T. Liehr Institut fuer Humangenetik und Anthropologie A molecular cytogenetic study in 22 infertility cases was performed. These were identified to be carriers of small supernumerary marker chromosomes (sSMC) of different chromosomal origin. Together with the ones available in the literature there are now 81 sSMC-cases characterized for their genetic content and detected in connection with infertility in otherwise clinically healthy persons (see http:// markerchromosomes.ag.vu). This study confirmed the presence of abnormal karyotypes in a subgroup of patients seeking infertility treatment. According to this study, in 60% of the cases the sSMC originiate from chromosomes 14 or 15. Euchromatic imbalances are provided by the sSMC presence in 29% of the cases. Strikingly, we could show that 54% of the sSMC-carriers detected due to fertility problems obtained the sSMC from one of their parents. As we also found hints on a yet unknown mechanism for elimination of sSMC from human gene pool, sSMC could play a major role in the future to understand processes in chromosome gain and loss during evolution. Nonetheless, further detailed molecular analysis will be necessary in the future to characterize the mechanisms and genetic basis for this phenomenon. Supported in parts by the Dr. Robert Pfleger-Stiftung, Ernst-Abbe-Stiftung, the DFG (436 WER 17/1/04, 436 WER 17/5/, WE 3617/2Y105, 436 ARM 17/11/06, LI 820/9Y1, LI820/11Y1), the DAAD and the Evangelische Studienwerk e.V. Villigst. Cases were kindly provided by M Manvelyan (Armenia), J Andersen (Australia), M Riegel (Switzerland), C Fuster (Spain), F Pellestor (France), A Polityko (Belarus), M-L Mazaurik, B Schulze, H
Tittelbach, G Reising-Ackermann, B Belitz, U Hehr, C Kelbova, M Volleth and E Go¨dde (Germany).
1.3-P
A case of multiple congenital joint contractures in a newborn girl with partial 6q27 trisomy V. Antonenko, N. Shilova, T. Zolotuhina, L. Levina, L. Baranovskaya and V. Ivanov Research Centre for Medical Jenetics RAMS We present a newborn girl with complex chromosomal aberration: partial monosomy of the short arm of chromosome 1 (1p36-pter) and partial trisomy of long arm of chromosome 6 (6q27-qter), due to a balanced translocation in her mother. The karyotype of the child was: 46,XX,der(1)t(1;6)(p36;q27)mat. The presence of 6q material in the short arm of chromosome 1 was revealed by FISH probe wcp(6)(Vysis). Clinical findings in this patient were: low birth-weight; microcephaly; wide cranium sutures and large fontanelle; large ventricles; thin vertebrae; congenital heart defect (ventricular septum defect, patent ductus arteriosus); curling, hypoplastic aorta; multiple congenital contractures; oedema; muscular hypotonia; seizures. The dysmorphic features were: flat occiput; large, dysplastic, low-set ears; absent lobule; hypertelorism; epicanthic fold; wide, high nasal bridge; short palpebral fissures; short nose; hypoplastic alae nasae; long, flat philtrum, down-turned mouth; high palate; micrignathia; short neck; large hands and feet, fifth finger clinodactyly. Phenotypical manifestations in the patient were those usually found in 1p36 monosomy. However, multiple inborn contractures have never been described in this pathology. This characteristic was found in 20% of patients with duplications of the long arm of chromosome 6 including 6q23Y25 to 6qter segments. Our finding is the first case of multiple congenital joint contractures in 6q27 terminal segment trisomy.
1.4-P
Linear and whorled nevoid hypermelanosis in trisomy 13 S. Yuksel, S. Savaci, U. Bicak, C. Yakinci and B. Mizrak
6th ECC: Abstracts Inonu University, School of Medicine, Dep. Medical Biology and Genetics, Inonu University, School of Medicine, Dep. Pediatrics, Inonu University, School of Medicine, Dep. Pathology Linear and whorled nevoid hypermelanosis (LWNH) is a reticulate pigmentary disorder with a sporadic occurrence, representing genetic mosaicism. In this case a two-month-old girl was diagnosed as LWNH, congenital ventricular septal defect and various systemic anomalies. G-banding chromosomal analysis of the patient and the parents were performed on cultured peripheral blood lymphocytes. The karyotype of the patient was 47, XX, + 13[100], with no mosaicism. The karyotypes of the parents were normal. To our knowledge, we present the first patient with LWNH in whom full trisomy 13 was confirmed postnatally in cultured peripheral blood lymphocytes.
1.5-P
Translocation t(X;1)(p11.2;p33)mat in a severe oligospermic male: a rare cause of cytogenetically induced infertility Gabriela Kronberger, Andreas Sommerhuber and Olaf Rittinger Paracelsus Medical University, Salzburg, St. Vincent_s Hospital, Linz Cytogenetic aberrations are commonly found in infertile males affected with severe oligospermia or azoospermia, amounting about 10Y15% in the latter. Among these, Klinefelter syndrome, Robertsonian translocation and XX males are more frequently observed obstacles to fertilization success. In contrast, X-autosomal and Y-autosomal translocations are rarely observed, in our own serie of 760 infertile males we have observed each only one time over 10 years. We report here on a 38y old infertile man, who was admitted from the department of urology because of heavily disturbed semen quality including severe oligospermia. He presented with an otherwise normal phenotype. Karyotyping revealed a gonosomalautosomal translocation t(X;1)(p11.2;p33). Investigation of the maternal karyotype revealed the same t(X;1) translocation combined with a low degree mosaic form of a Turner syndrome: 45,t(X;1)[8]/46,X,t(X;1)[42].
25 This observation seems to be of interest for the following reasons: (1) the realistic although small possibility to fertilize an egg assisted by ICSI and to pass on the balanced translocation including infertility, as described recently (Ma et al. 2003), (2) the possible increased risk for additional numerical aberrations, (3) the necessity of skewed inactivation in possible female carriers to sustain a balanced state, even more in the case of Turner syndrome mosaic. We would like to comment also on the fertility outcome in comparable X-autosomal translocation patients.
1.6-P
The further delineation of 6q and 7q subtelomeric deletion phenotype: natural histories and review of the literature M. Krajewska-Walasek, A. Gutkowska, K. Spodar, A. Marczak, M. Gajdulewicz, A. Jezela-Stanek and K. H. Chrzanowska The Children’s Memorial Health Institute Subtelomeric deletions of the long arms of chromosome 6 and 7 are rare. We report on a family with three children who have inherited opposite derivatives of a balanced maternal translocation t(6;7)(q27;q36), resulting in a monosomy 6q26/trisomy7q27 in two severely mentally retarded daughters, aged 16 and 18 years, and a monosomy 7q/trisomy 6q27 in the third daughter aged 9 years. To date about 16 cases with subtelomeric deletions of 6q (5 isolated and 11 resulted from unbalanced rearrangements) have been reported in the literature. In a subset of cases the clinical presentation differs from the more common phenotype. In our patients clinical findings such as minor facial anomalies (short philtrum, wide mouth and large, cup-like ears), microcephaly, short neck and hypotonia support the previously reported relatively mild phenotypic presentation of some subtelomeric 6q deletions. Our studies further indicate that the facial dysmorphic features are subtle and in themselves not sufficient for clinical diagnosis. Microcephaly, hypotonia, mental retardation (frequently not recognized until after the first year of life), normal postnatal growth pattern in combination with the minor facial anomalies compose a minimal clinical spectrum and may help to identify other patients with the same 6q deletion. The third girl with
6th ECC: Abstracts
26 a submicroscopic 7q deletion and trisomy 6q was moderately mentally retarded. She was microcephalic and slightly hypotonic. She had congenital duodenal atresia and ASD II. She also had fusion of 9th and 10th and of 11th and 12th ribs and schisis of symphysis pubic. We compare the clinical and cytogenetical data with the previously reported cases. The study was supported in part by KBN, Project No 2 P05A 161 28.
1.7-P
Cytogenetic characteristics of Azoospermia N. Zotova, E. Markova, N. Kazmina, I. Timofeeva, O. Serebrennikova, T. Zaitseva and A. Svetlakov Center for Reproductive Medicine, cine Mainly genetic azoospermia cases are connected with sex chromosomal abnormalities. In this study we investigated cytogenetic causes of azoospermia. We analized karyotipes and microdeletions of Y chromosome in 57 patients (age 31.6T 0.7). Azoospermia was defined as the total absence of spermatozoa in ejaculate even after its centrifugation. Investigation for chromosomal anomalies was performed by GTG-banding technique for at least 12 metaphases of standard lymphocyte culture. FISH technique was used for 1000 cells with centromere probes for X and Y chromosomes in all cases of mosaic forms in karyotype. DNA was extracted from peripheral blood by the standard method with sorbent. The search for microdeletions was carried out by multiplex PCR 11 sequence-tagged sites (STS) involving the AZFa (sY82, sY84, sY86, sY182), AZFb (sY117, sY127, sY143), AZFc (sY147, sY158, sY254, sY255), and for partial AZFc microdeletions sY1191 and sY1291 loci. Chromosome abnormalities were observed in 21.6% cases, including 47,XXY karyotype in six cases (three of them were mosaic variants). One patient had an XX male syndrome, with presence of SRY gene. Y chromosome microdeletions were found in six cases of azoospermic men (10.5%): three with AZFc, one with AZFb, and two with both AZFc and AZFb. Partial AZFc microdeletions were determined in 9 cases of 44 (20.7%): six without sY1191, two without sY1291, and one without either sY1191 or sY1291. Two patients had combined defects. One of
them had cytogenetically detected deletion of Y chromosome and AZFb/c microdeletion. Another had both AZFb microdeletion, partial AZFc microdeletions (sY1191 and sY1291) and a high level of numeric sex chromosomal abnormalities. Thus, cytogenetic and molecular genetic causes determine about 30% of azoospermia cases. This rate is really high inncluding partial AZFc microdeletions, but their role in azoospermia is not yet understood.
1.8-P
Prenatal diagnosis of a de novo derivative chromosome 15 with extra genetic material derived from chromosome 10p M. Karkakaletsi, A. Hatzipouliou, C. Billi, F. Sahinidou, L. Florentin, S. Kitsiou, A. Anastasiou and V. Velissariou Mitera Hospital, Alphalab, Dept. of Medical Genetics, University of Athens A de novo derivative chromosome 15 with extra euchromatic material in the long arm was detected in CVS cultured cells in a pregnancy that was referred because of advanced maternal age and a previous history of a fetus with hydrops fetalis, hydrocephaly and arthrogryposis for which no chromosomal analysis was available. After genetic counseling the parents decided to proceed with amniocentesis at 17 weeks of gestation. The same der(15) chromosome was detected in all amniotic cells. MLPA analysis for the detection of microdeletions/microduplications of subtelomeric regions of all chromosomes revealed that the extra chromosomal material in 15q was derived from 10p, while no microdeletions or microduplications were detected in the long arm of chromosome 15. The results were confirmed with FISH and it was shown that the fetus had a de novo duplication of 10p. An ultrasound examination at 23 weeks revealed an increased nuchal fold and moderate hydronephrosis. The parents were counseled accordingly for the cytogenetic and the ultrosonographic findings and decided to terminate the pregnancy. The results of the autopsy and the histological examination of the fetus are expected. It is important in these cases to use the new methodologies for the identification of extra genetic
6th ECC: Abstracts material of unknown origin in order to counsel the parents and help them plan a new pregnancy.
1.9-P
A boy with 9p deletion as the result of paternal cryptic translocation t(9p;20q) A. Gutkowska, Maria Gajdulewicz, Aleksandra Marczak and Malgorzata Krajewska-Walasek The Children’s Memorial Health Institute In majority of patients with 9p- deletion the rearrangement occurs de novo. In the era of FISH it is likely that more such rearrangements will be found as a result of parental subtelomeric translocations. We report on a boy with many characteristic features of 9p- syndrome: trigonocephaly, short nose with wide nasal bridge, long philtrum, upward-slanting palpebral fissures, low set ears, cleft palate, short neck, hypospadias, omphalocele, bilateral inguinal hernias, agenesis of the corpus callosum and cardiac defect. He was mentally retarded, hypotonic and had seizures. The deletion of 9p was suggested by the clinicians. Subtelomeric FISH examination demonstrated 9pter deletion in our patient and in his father. Subsequently a Multiprobe-T test (Cytocell) revealed cryptic translocation t(9;20)(p24;q13) in the father which was not detectable with classic metaphase cytogenetic analysis. It resulted in an unbalanced rearrangement in the boy with deletion of 9pter and duplication of 20qter. The latter aberration obviously had little impact on the phenotype of the proband. Our case gives additional evidence that 9p- syndrome Y even when accompanied by another small aberration Y produces a phenotype that can suggest the diagnosis. Clinical features show Y as usually in such patients Y more symptoms of 9p- syndrome than those of 20q duplication.
1.10-P
Paternally inherited subtelomeric 8p deletion: unpredictability of mental development O. Rittinger, Gabriela Kronberger and Ingrid Vlasak Paracelsus Medical University Salzburg
27 Subtelomeric rearrangements are considered to be causative for a substantial number of mental disabilities. In contrast to more common conditions like monosomy 1p36 some other telomeric chromosomal disturbances have been reported only a few times so far are as they are only rarely, if ever, associated with a particular clinical phenotype. We report on a 5year old female patient, who was admitted to the pediatric clinic for delayed motor and speech development. Physical examination showed normal growth, only mild dysmorphic features such as less severe microcephaly, small rounded ears, broad mouth and small fingers with brachymesophalangy. She has a rather good receptive language, allowing immediate and appropriate answers to a request, exhibiting a pleasant and friendly behaviour. She was shown to have a normal karyotype. However, subtelomere screening by means of MLPA (MRC Holland) revealed a subtelomeric 8p deletion, which was confirmed by consecutive FISH studies (ToTel Vision, Vysis). Parental investigation by means of MLPA and FISH revealed the same deletion in the father, but was not found in the mother and the father_s parents. Although the father showed no obvious retarded behaviour, no microcephaly and tall stature, he differed from his 6 sibs in that he was the only one who needed special education and remained an unskilled worker, indicating the deletion to be of some clinical relevance. Considering singular reports on even cytogenetically detectable 8p deletions with normal development (Barber, JMG 2005), it seems that more precise analysis of the deleted region will be needed for unequivocal genotype-phenotype correlation.
1.11-P
Significance of gonosomal mosaicism (GM) in etiology of female reproduction impairment. Pilot study P. Capkova, A. Sobek, Jr., A. Sobek, sr., K. Adamova, A. Santava, B. Hladikova, A. Krskova and J. Santavy University Hospital of Palacky University Olomouc, Fertimed, Private Centre of Assisted Reproduction, Olomouc, IT Centre of Palacky University Olomouc Mosaicism of chromosome X aneusomy in peripheral blood lymphocytes represents the prevalent
6th ECC: Abstracts
28 chromosomal aberration in females treated for infertility. Our study performed in years 2001Y2006 revealed: the incidence of GM in infertile women and control group performed by cytogenetic analysis and FISH on cultured lymphocytes, the association of GM with age of patients and the role of the other single cell autosomal aneusomies detected in tested samples. Method: Cytogenetic analysis was performed in the group of females treated for infertility (n =1014) and the control group with at least two spontaneous conceptions, without miscarriage history (n = 52). FISH was performed in 34 and 44 cases respectively. Resuls: The number of mosaic cases (Q 45,X[2]; Q 47, XXX[1]; Q 45,X[1]/47,XXX[1])in infertile group was 86 (8,48%). Although the difference between compared groups was not significant (X2 =1,54; p9 0,05) the frequency of aberrant cells in a total number of counted metaphases was significantly higher in infertile (x j = 9,35%) versus control cohort (xj = 0,97%; p =0,000). Also I-FISH detected higher frequency of aberrant cells in infertile (xj =10,77%) than in the control group (xj = 3,55%; p= 0,000). Comparison of both methods within groups confirmed difference (p = 0,05; p = 0,000). Age/GM correlation was evaluated in 999 patients. Incidence of GM in the group of females with age Q 35 (n = 85) was 14 (16,47%) and in the group of females below 35 (n = 914) was 67 (7,33%;X2 = 8,71; p G0,05). Onecell autosomal aneusomy was observed in 13 of 86 cases with GM (15,12%) and in 3 of 928 females without GM (0,32%; X2 = 101,58; p G 0,05). Conclusion: Association of infertility with GM could not be proven by routine cytogenetics. The significant difference between control and infertility groups was revealed by FISH. Frequency of GM increased with age. Mitotic error involving autosomes occurred more frequently in females with GM than without it.
1.12-P
Idiopathic autism is frequently associated with low-grade chromosomal mosaicism S. Vorsanova, I. Iourov, I. Demidova, A. Beresheva, V. Kravetz, A. Kolotii, O. Kurinnaya, V. Voinova-Ulas, N. Gorbachevskaya and Y. Yurov Institute of Pediatrics and Children Surgery, Roszdrav, National Research Center of Mental Health, Russian Academy of Medical Sciences, I, I, I
About 5Y10% of autism cases are associated with chromosomal abnormalities and monogenic disorders, but the role of subtle genomic imbalances in autism have not been delineated. Here, we have tested a hypothesis suggesting autism to be associated with subtle genomic imbalances manifested as low-level chromosomal mosaicism. We surveyed the stochastic level of chromosomal alterations in children with and without autism by interphase multiprobe fluorescence in situ hybridization (mFISH). The rate of whole chromosome loss and gain (aneuploidy) involving arbitrarily selected autosomes (1, 9, 15, 16, 17, and 18) and sex chromosomes (X and Y) was assessed in peripheral white blood cells from 120 children with idiopathic autism and 60 unaffected children. Studying over 420,000 cells, we have determined the mean frequency of stochastic aneuploidy in the control and the autism group: (i) autosome loss j0.58% (95% CI 0.42Y0.75%) and 0.60% (95% CI 0.37Y0.83%), respectively, p=0.83; (ii) autosome gain j0.15% (95% CI 0.09Y0.21%) and 0.22% (95% CI 0.14Y0.30%), respectively, p=0.39; (iii) chromosome X gain j1.11% (95% CI 0.90Y1.31%) and 1.01% (95% CI 0.85Y1.17%), respectively, p=0.30. A frequency of mosaic aneuploidy above the background level was found in 19 (16%) of 116 children with idiopathic autism, while outlier values were not found in controls (p=0.0019). Low-level mosaic aneuploidy with a frequency above the background level occurred in 19 (16%) of the 116 children with idiopathic autism, while no chromosomal mosaics were found in controls (p=0.0019). These findings identify low-level aneuploidy as a new genetic factor predisposing to autism. Therefore, molecular cytogenetic investigation of lowgrade somatic mosaicism is warranted in children with unexplained autism for identification of the genetic causes or diagnostics. Supported by INTAS (03Y51Y 4060) and RGNF (060600639a, Russian Federation).
1.13-P
Interphase chromosome-specific multicolor banding (MCB): a new opportunity for molecular neurocytogenetics I. Iourov, T. Liehr, S. Vorsanova, I. Demidova and Y. Yurov National Research Center of Mental Health, Russian Medical Academy of Sciences, Moscow, Institute of
6th ECC: Abstracts Human Genetics and Anthropology, Jena, Germany, Institute of Pediatrics and Children Surgery, Roszdrav, Moscow Molecular neurocytogenetics is a new direction in current biomedecine that merges cytogenetics and neuroscience and aims to describe chromosome numbers, structure and behavior in the mammalian brain (Iourov et al. 2006. Int Rev Cytol 249: 143Y191). One of the most actual problems in the field refers to the impossibility of methaphase cytogenetics application on brain cells hindering, therefore, the analysis of whole chromosomes in their integrity. Here, we propose an approach to avoid this limitation of interphase cytogenetics termed interphase chromosome-specific MCB. It is based on the use of FISH with microdissection-derived chromosome-specific DNA probes. Through studying interphase nuclei of the human brain by MCB and FISH with chromosomeenumeration DNA probes we were able to show that interphase MCB not only allows to define positioning, integrity, and behavior simultaneously of whole chromosomes and their specific regions, but also provides for precision of intercellular genomic (chromosomal) variations manifesting as aneuploidy. It was noted that other FISH studies were not able to achieve such precision due to signal Bscission^ or Bconjunction.^ Thus, we have revealed the rate of mosaic aneuploidy in the human brain to vary between 0.2 and 0.5% for autosomes and to reach 2% for chromosome X in female samples. Increased level of aneuploidy in the diseased brain was documented by MCB in Alzheimer_s disease (gains and losses of chromosomes 21 and X) and in ataxia telangiectasia (chromosome 14 loss/gain). We conclude the use of interphase chromosome-specific MCB to be highly efficient for molecular neurocytogenetic studies. Supported by INTAS and AT Children project.
1.14-P
Identification of supernumerary marker chromosome derived from chromosome 19p J. Vranekovic´, B. Brajenovic´-Milic´ and M. Kapovic´ Medical Faculty
29 Supernumerary marker chromosomes represent a heterogeneous group of extra structually abnormal chromosomes which have different expression in the phenotype of an affected person. The proband, a 9-month-old male, was referred to the laboratory for cytogenetic study due to a history of mental retardation, developmental delay and dysmorphic features. Routine chromosomal analysis of the proband was performed on GTG-banded metaphases from cultures of PHA-stimulated peripheral blood lymphocytes. Cytogenetic analysis revealed mosaicism for a marker chromosome in 52% of the analysed cells. The probands parents had normal karyotype. Fluorescence in situ hybridization with centromere crosshybridizing probes D1/5/19Z showed strong signal on marker chromosome. The whole chromosome paint 19 showed the signal from the marker confirming its chromosome 19 origins. Subsequent FISH with pool YACs19p(839B1, 872G3, 728C8) and poolYACs 19q (767C4, 761C1, 786G6) indicated the marker chromosome to be derived from chromosome 19p arm. This is the first reported case of de novo extra structurally abnormal chromosome derived from short arm of chromosome 19. Abnormalities of the short arm chromosome 19 are uncommon so this case may achieve a better delineation of karyotype-phenotype corelations.
1.15-P
Prenatal diagnosis of complete trisomy 19q I. Babic´, B. Brajenovic´-Milic´, O. Petrovic´, E. Mustac´ and M. Kapovic´ Medical School, University of Rijeka, Clinical Hospital Center Rijeka OBJECTIVES: To present the first case of complete trisomy 19q, prenatally detected by ultrasound investigation. METHODS: Real-time high resolution ultrasound examination was performed at 19 weeks of gestation. After termination of the pregnancy, autopsy investigation was done. GTG banding, m-FISH analysis, and FISH analysis with a 19q subtelomeric specific probe were used for identification of the fetal karyotype.
6th ECC: Abstracts
30 RESULTS: Sonographic examination revealed enlarged cisterna magna, cerebellar hypoplasia and aplasia of the inferior part of the vermis, combined and bilateral kidney malformations, significant nuchal fold, absence of fetal nasal bones, and intracardial calcifications. Autopsy confirmed ultrasound findings, but also revealed situs viscerum inversus of the lungs. Fetal karyotype was defined as: 46,XY,der(21) t(19;21)(q11;p13)mat. CONCLUSION: Trisomy 19q has been reported as a recognizable but variable syndrome. The present case pointed out some new observations, including possible association with Dandy-Walker variant, and therefore raises questions about common clinical features of the mentioned syndrome. Our ultrasound and autopsy findings will certainly contribute to better knowledge of phenotype characterization of this rare chromosomal disorder.
1.16-P
Trisomy 22 and first trimester biochemical markers S. Christopoulou, M. Karkakaletsi, A. Hatzipouliou, J. Donoghue, E. Manisali, S. Sifakis and V. Velissariou Mitera Hospital, University of Crete Trisomy 22 is a rare chromosomal abnormality occurring with an incidence of 1 per 30000 to 50000 live born neonates. However, it is the second most common autosomal trisomy found among spontaneous abortions, which reflects the high intrauterine lethality associated with this condition. There have been relatively few reported cases of trisomy 22 diagnosed by ultrasound examination. Some common sonographic findings in the late first-, second- and third-trimester are: IUGR, hypoplastic femurs, nuchal thickening, cerebellar and cardiac defects, ambiguous genitalia and oligohydramnios. To date, little is known about the association of biochemical markers with this abnormality. In this study we present five cases of trisomy 22 detected prenatally in the first and second trimester and we examine the value of maternal serum levels of PAPP-A and free b-hCG. Maternal concentrations of PAPP-A are significantly
reduced in all cases, while the free b-hCG maternal serum levels are significantly increased in four of the five cases. This biochemical pattern is quite similar to that encountered in trisomy 21 pregnancies. Further studies are needed to clarify the value of these trophoblast antigens as markers in the first trimester screening of T22 pregnancies.
1.17-P
Hemiatrophy and mental retardation due to 46,X,dup(X)(q13.1q22.1) R. Wimmer, T. Ehresmann and O. Steinlein Institut fu¨r Humangenetik, LMU The impact of X-chromosomal abnormalities on the phenotype of female carriers is still unclear. Men with duplications in the long arm of the X chromosome are often severely affected but many female relatives with the same duplication do not show any abnormal phenotype, except for short stature. We report on a female patient that was first brought to pediatric counselling at the age of 3. At that time she showed microsomia (normocephalic in relation to height), micrognathia, hemihypogenesis of the left half of the body and delayed speech development. Oxygen deficiency during birth was discussed as a possible cause of the disorder. Later on, Silver-Russell syndrome or Turner syndrome were suspected and chromosomal analyses of the patient and her parents were performed at the age of 5 and 7 years. A female karyotype with a de novo derivative X chromosome was found, harbouring additional euchromatic material on the proximal long arm. Chromosomal banding techniques could not clarify its chromosomal origin then, but a duplication on the X was supposed. In blood lymphocytes, the pattern of X inactivation was not skewed. Now, at the age of 31, she shows left side hemiatrophy, short stature of 145cm, moderate mental retardation and speech disability. Whole chromosome painting confirmed the X origin of the additional material. We present a detailed cytogenetic and FISHanalysis of this derivative X chromosome and compare the results to similar cases with duplication on the long arm of the X and their respective phenotypes.
6th ECC: Abstracts
1.18-P
A case of de novo dup(12)(pterYp11) syndrome
31
K. Gerssen-Schoorl, C. van Ravenswaaij and B. Sikkema-Raddatz University Medical Center Groningen
Being reported as a rare structural chromosomal anomaly, the duplication of the short arm of chromosome 12 has an estimated incidence of 1/ 50.000 births. The cytogenetic forms may vary: homogeneous trisomy 12p, mosaic trisomy 12p and trisomy 12p associated with other chromosomal anomalies. The majority of the reports suggest as the main cause the malsegregation of a balanced parental translocation. We report a new case of homogeneous duplication of the short arm of chromosome 12, in a boy aged 5 investigated for mental retardation, speech delay and superficial resemblance to the Down syndrome phenotype. Like in the other trisomy 12p cases reported previously, we confirm that the trisomy 12p affects early developmental milestones as well as cognitive and neurodevelopmental functions, because our patient has an IQ of 45, mental age and psychomotor development of a 3 year old. He has demonstrated severe retardation especially in speech development, he understands but is only able to say a few words. The pattern of facial dysmorphy includes flat face with a small nose, depressed and broad bridge, epicanthic folds, full cheeks, anteverted nares, wide philtrum, thin upper and thick lower lip. We specify that the patient also presented hearing damage, VSD, cryptorchidism, and micropenis. Cytogenetic analysis of the patient revealed a karyotype 46,XY,dup(12)(pterYp11). The parents did not have a balanced translocation. If we compare our case with the other reported cases, indeed a specific pattern of congenital anomalies for the trisomy 12p can not be established.
Reciprocal translocations are a well known source of heritable chromosome imbalances in man. Abnormal offspring usually have 46 chromosomes, including only one of the translocation products. Less often, imbalances result from a numerically unequal meiotic disjunction of the translocated chromosomes and their normal homologues, called 3:1 disjunction and resulting in a tertiary trisomy or monosomy. We describe seven patients with an aneuploidy due to 3:1 disjunction in balanced translocation heterozygotes. Of the seven individuals five showed a trisomy with the following translocation products as supernumera r y c h r o m o so m e s : 4 7 , X Y , + d er ( 2 1 ) t ( 3 ; 2 1 ) (q13.2;q22.1), 47,XY, + der(22)t(8;22)(q24.1;q11.1), 47,XY, + der(22)t(11;22)(q23.3;q11.2), 47,XX,+ der (15)t(3;15)(q27;q13) and 47,XY, + der(9)t(6;9) (p25;q21.1). The two monosomies showed a 45,XX, der(15)t(14;15)(q11.2;p12) and a 45,XX,der (22)t(15;22)(q11.2;q13.3). Except for the t(11;22), tertiary trisomy and monosomy are uncommon and are suggested only to be viable when one of the derivatives is of small genetic content. This is true for all of our cases, except for the t(6;9) where the supernumerary chromosome 9 consists of a substantial part of chromosome 9 material (9pter-9q21.2) and the t(3;21) where the supernumerary chromosome 21 consists of almost the entire long arm of chromosome 3 (3q13.2-qter). In our two tertiary monosomies only small parts of chromosomes involved are missing. In most tertiary trisomies thus far described the acrocentric chromosomes or chromosomes 16 or 18 are involved. This is also true in our cases, except for the t(6;9). Furthermore, all our translocation products were of maternal origin. This is in accordance with the literature where only one case of paternal origin has been described. This easily can be explained by a better (post-meiotic) selection in spermatozoa than in oocytes.
1.19-P
1.20-P
Tertiary trisomy and monosomy in seven individuals
Trisomy 9 mosaicism in an infant with failure to thrive
A. M. F. van der Kevie-Kersemaekers,
E. Yuksel Konuk, Asli Sirmaci,
Valerica Belengeanu, Kinga Rozsnyai, Simona Farcas, Cristina Popa, Alina Belengeanu and Monica Stoian University of Medicine and Pharmacy
6th ECC: Abstracts
32
Filiz Simsek Orhon, Volkan Baltaci, Tanil Kendirli, Erdal Ince and Mustafa Tekin
t(X;14) in our patient might result in unbalanced gametes as a cause of recurrent miscarriages.
Ankara University School of Medicine Failure to thrive in infancy is a common problem that clinical geneticists face and is caused by a long list of diagnostic possibilities, including chromosomal abnormalities. In this report, we describe a Turkish girl referred for the diagnostic evaluation of genetic problems and found to be mosaic for trisomy 9. Trisomy 9 syndrome is a rare chromosomal aberration in live-born children with the majority of the cases being mosaics. The clinical characteristics of the syndrome include abnormalities of the face, skeletal, genitourinary, cardiovascular, gastrointestinal and central nervous systems where malformations are less severe in mosaic cases. We report on a new patient typical for mosaic trisomy 9 syndrome, and evaluated the parental origin of the extra chromosome with molecular markers. The analyses revealed that a nondisjunction occurred at maternal meiosis I, and the mosaicism in our case was a consequence of a subsequent loss of a maternal chromosome 9 during mitosis in the embryo.
1.21-P
De novo balanced (X;14) translocation in a patient with recurrent miscarriages F. Alpaslan Pinarli, Nurten Kara, ¨ kten and I˙dris Koc¸ak Gu¨lsen O Ondokuz Mayis University Medical Faculty, Dept. of Obstetrics and Gynecology We report a 23 year-old-patient in which an X;14 translocation has been identified during the investigation for recurrent miscarriages. She was a phenotypically normal female who had suffered two miscarriages in 3 years but no cytogenetic analyses had been performed in these abortuses. In karyotyping by standard G-banding techniques, she was found to be a carrier of balanced X-autosome translocation t(X;14) (q13;q32) in all her cells. The karyotyping of her mother, father and husband were all normal. Thereafter, she was admitted again with a risk of miscarriage in her third pregnancy but did not accept amniocentesis performed. We assume that balanced
1.22-P
A rare case of recurrent regular trisomy 21 G. Okten, Ferda Alpaslan Pinarli, S. Tural and I. Kocak Ondokuz Mayis Univesity Medical Faculty, Ondokuz Mayis Univesity Medical Faculty, Dept. of Obstetrics and Gynecology We report a 27 year-old- pregnant woman who was found to have a child with trisomy 21 in prenatal diagnosis. Her past medical history revealed three other pregnancies in which two of them regular trisomy 21 were found in cytogenetic analysis. She had also a healthy child from her first pregnancy. Periferal blood and tissue fibroblast cultures of the parents were performed using karyotyping by standard G-banding techniques. At least 100 cells were scored in each case to exclude low grade mosaicism. Periferal blood examination of the mother revealed 40% chromatide breakage in chromosome 3 and 50% double minute chromosomes. Low grade mosaicism for trisomy 21 (1/100) was confirmed in her tissue fibroblast culture. No abnormality was found in the father. Gonadal tissue mosaicim could not be investigated due to the unavailability of gonadal biopsy. Genetic predisposition to non-disjunction, chromatide breakage in chromosome 3 and double minute chromosomes or cryptic gonadal mosaicism could be suggested to explain the recurrences of trisomy 21 in this family.
1.23-P
Clinical, molecular and cytogenetics characterization of male patient with malformations and mental retardation T. Zolotukhina, N. Shilova, T. Tsvetkova, V. Galkina and V. Chernykh Research Centre for Medical Genetics of RAMS
6th ECC: Abstracts We are reporting the clinical, cytogenetic and molecular studies on a 4 year-old boy who was referred for karyotyping because of microcephaly (48 cm), growth and psychomotor retardation. Phenopype of proband included: short stature (79 cm), shot neck and low posterior hairline, broad forehead, hypertelorism, ptosis, short and upturned hose, short philtrum, cupid bow shaped mouth, dental caries, micrognatia, displastic prominent ears, brachydactylia, left-sided scoliosis. The external male genitals and abdominal ultrasonography were normal. Conventional cytogenetic analysis of patient using GTGbanding revealed 45,X,t(18;Y)(p11.1;p11.1) karyotype. The karyotypes of parents were normal. Molecular analysis was carried out on DNA extracted from peripheral leukocytes. PCR amplifications were performed to analyze SRY, AMG/AMGL, ZFY/ ZFX loci and thirteen following Y-specific STSs: sY84, sY86, sY615, sY127, sY134, sY142, sY1192, sY1197, sY254, sY255, sY1291, sY1206 and sY1125. PCR reactions were positive for analyzed loci excluding sY1192 marker localized in Yq11.23. It is typical for partial AZFc deletion known as Fb2/ b3 deletion_. Commonly, this Y chromosome microdeletion is structural Y polymorphism. FISH analysis with WCP18, WCPY DNA-probes (Vysis, Abbot) and DAPI contrstaining was performed to confirm this translocation. Derivate chromosome was WCP18 + , WCPY + . It was surprising to discover DAPI-positive material in terminal region of this chromosome. Additional FISH with WCPX and SRY DNA-probes confirmed the presence of chromosome X material and SRY-locus in telomere region of derivate chromosome. Thus the derivate chromosome was composed of chromosomes 18, X and Y. Probably this chromosome is a result of complex paternal meiotic mutation. Combined use of PCR and FISH with high-specificity DNA-probes increases the quality of cytogenetic diagnosis and allows one to base further recommendations for genetic counseling.
1.24-P
Catchment of the deletion Xp22.3 by FISH H. Pekova, N. Jencikova, V. Nedomova and D. Stejskal
33 Center of Human Genetics and Reproductive Medicine GENNET s.r.o. Assessment of unconjugated estriol (uE3) in maternal blood is the part of multi-marker antenatal screening in the second trimester. Low uE3 values are connected with fetal chromosomal aberrations, metabolic disorders and adverse pregnancy outcome. We carried out fluorescence in situ hybridization (FISH) assay of Steroid Sulphatase gene (STS) deletion simultaneously on amniocytes and mother`s peripheral blood cells if uE3 was under 0.2 multiple of median (0.18 % of all second trimester results). Between 2004Y2006 a total of 50 fetal/ maternal pairs were analyzed by STS deletion FISH assay. At 14 /50 (28%) cases low uE3 was caused by STS deletion. All deletions were inherited and maternally transmitted. Steroid sulphatase deficiency proven by gene deletion have clinical consequences: risk of complications in the third trimester and labor and X-linked recessive ichthyosis, cryptorchidism and asymptomatic corneal opacities postnatally.
1.25-P
Terminal trisomy 7p secondary to maternal 7p22;8p23 translocation I. Petkovica and I. Barisic University Children’s Hospital Zagreb Partial duplications of the short arm of chromosome 7 have been described in 60 cases. The size of duplicated 7p segment is variable and frequent breakpoints are in 7p15 and 7p21. Smaller terminal duplications are, however, rare and reported in three patients so far. Here we report a patient with partial trisomy 7p resulting from malsegregation of maternal balanced translocation. Our patient is the first child of healthy nonconsanguineous parents. Her younger brother, born after two spontaneous abortions, is normal. The proposita was first evaluated at the age of 6 months because of craniofacial dysmorphism. Clinical examination showed dolichocephaly, high large forehead, ocular hypertelorism, epicantic folds, narrow palpebral fissures, depressed nasal bridge, anteverted nares, low set and malformed ears, micrognatia, retrognatia, high arched palate, hypotonia, developmental delay and
6th ECC: Abstracts
34 ventriculomegaly. Cytogenetic analysis was performed on slides obtained by standard peripheral blood cultures and stained by GTG-, RBG- and CBG- banding methods. The analysis revealed normal karyotype. Subsequent screening of subtelomeric regions by FISH and multi-colour probe panel ToTelVysion (Vysis) revealed unbalanced rearrangement of short arms of chromosomes 7 and 8. The detected abnormality was verified by FISH using chromosome specific subtelomeric and whole chromosome painting probes (Vysis). Paternal karyotype was normal, while the mother and the brother have balance translocations with the breakpoints at 7p22 and 8p23. The infant_s karyotype was interpreted as 46,XX,der(8)t(7;8) (p22;p23)mat. The child has a duplication of 7p22Ypter, and a deletion of 8p23Ypter. This report contributes to the delineation of clinical features of duplication 7p22Ypter.
Further molecular cytogenetic studies showed that the derivative chromosome was composed of the whole short arms of both chromosomes 8 and 12 including the complete centromere regions, resulting in a mosaic trisomy 8pterY8q11.1 and trisomy 12pterY12q11.1 in the child, Karyotype 47,XY, + dic(8;12) (8pterY8q11.1::12q11.1Y12pter)[28]/46, XY[72]. Chromosome analyses of the parents were normal. We present the clinical findings of the patient at the age of 13 months as well as the laboratory findings, comparing our results with the available literature data.
1.26-P
I. Barisic and I. Petkovic
Case report: patient with psychomotoric delay, dysmorphic features and hearing impairment due to a de novo translocation 8p;12p resulting in the Karyotype 47,XY,+dic (8;12)((8pterY8q11.1::12q11.1Y12p
Childrens University Hospital Zagreb
C. Schell-Apacik, M. Wettwer, Martin Jakobeit, B. Ertl-Wagner, U. Heinrich, J. Mu¨ller-Navia and H. von Voss Institute of Social Pediatrics and Adolescent Medicine of the University of Munich, Institute of Clinical radiology of the University of Munich, Center for Human Genetics and Laboratory Medicine, Martinsried, Institute of Clinical Genetics, Mainz Dicentric chromosomes deriving from autosomes are not a frequent finding in literature, except Robertsonian translocations. We report on a patient with psychomotoric delay, hearing impairment requiring hearing aids, and dysmorphic features, e.g. macrocephaly, agenesis of the corpus callosum, high and prominent forehead, hypertelorism, depressed nasal root and nasal bridge, dysplastic ears, small submucous upper lip, cleft palate, uvula bifida, and zygodactyly of the 2nd and 3rd toes. Conventional chromosome analysis revealed an additional marker chromosome in more than 30% of the analysed cells.
1.27-P
Pure terminal 14q deletion case report
Y
Terminal deletions of the long arm of chromosome 14 are relatively rare. The loss of chromosomal segment may be due to translocations, ring chromosomes formation and pure deletions. Clinical presentation is highly influenced by the kind of structural rearrangement, additionally affected segments and size of deletion. More than 50 cases of ring chromosome 14 have been reported and common clinical features have been described. On the other hand, linear terminal deletions are rare and reported in seven cases so far. Precise identification of chromosomal aberration by FISH or molecular method was performed in only four out of seven reported patients. In this report we present additional case of de novo terminal 14q deletion. Our patient is 5-year old girl with microcephaly, dysmorphic features including high forehead with bitemporal narrowing, telecanthus, blepharophimosis, broad nasal bridge, hypoplastic nares, dysplastic ears, high arched palate, thin upper lip, small down-turned mouth and receding chin. She showed mild developmental delay, but detailed clinical and laboratory investigation did not show additional abnormalities. Cytogenetic analysis revealed normal karyotype while FISH subtelomere screening identified terminal deletion of 14q. The aberration was further verified by FISH with chromosome specific subtelomeric and whole chromosome painting probe. Both parents presented with
6th ECC: Abstracts normal karyotype. The clinical features observed in our patient correspond with that observed in so far reported patients, and further contribute to the definition of the phenotype associated with linear terminal deletion of chromosome 14.
1.28-P
Cytogenetic results of spontaneous abortions M. Martorell Riera, R. Batalle, M. Sola, R. Romero, M. Alegre, J. Sarquella, J. A. Gonza´lez-Huix, A. Rocas and X. Serrat Unitat de Reproduccio´ Humana i Diagno`stic Gene`tic. Clinica Girona, CTD This study presents the cytogenetic results of spontaneous abortions that we have analysed at the Clı´nica Girona in the last nine years. Between January 1998 and December 2006 we performed cytogenetic diagnosis on 230 abortion samples. Whenever possible, both short-term and long-term culture of chorionic villus samples were used. Very few studies have utilized different cultures of other embryonic tissues. We found 140 abnormal karyotypes (60.9%), of which 134 cases, were numerical abnormalities and only 6 were structural abnormalities. We observed 4 discrepancies (1.73%) between short and long-term culture. In conclusion, the results show that combining both techniques simultaneously significantly increases the reliability of results.
1.29-P
Interstitial deletion of distal 8p in a patient with velo-cardio-facial syndrome like phenotype Sarbjit K. Riyat, Catherine McCarthy, Elizabeth Wilson, Adayapalam Nandini and Andreas Zankl QHPS Cytogenetics Unit, RBWH, Brisbane, Australia, Queensland Clinical Genetics Service, RCH, Brisbane, Australia The human chromosome region 8p23 harbours unique genomic architecture, which is prone to
35 recurrent chromosomal rearrangements due to the presence of low copy repeats and common inversion polymorphisms. Deletions involving region 8p23.1 have been reported in more than 30 patients, of which 60% have a wide spectrum of congenital heart defects. We present a 15-year-old female patient, born with atrial septal defect and pulmonary stenosis. She has mild mental retardation, slight nasal speech, a small head circumference and subtle velo-cardiofacial syndrome (VCFS) like facial features. Previous investigations excluded microdeletion of 22q11.2. In view of her phenotype and previous investigations, a detailed karyotype and Fluorescent-In-Situ-Hybridisation (FISH) testing for NEBL gene on chromosome 10p were requested with the understanding that partial deletions of 10p have been reported in 22q11.2 non-deleted patients with VCFS like phenotype. High resolution cytogenetic analysis revealed an interstitial deletion of the short arm of chromosome 8, del(8)(p23.1p23.2). FISH studies using chromosome 8 specific subtelomere probes confirmed that the deletion was interstitial. Whole chromosome paint 8 excluded involvement of any other chromosome in the aberration. Parental karyotypes were normal. To date, only one case of terminal deletion of 8p23.1j 9 8pter in a child with features of VCFS has been reported. We postulate that even interstitial deletion of 8p23.1 may lead to similar features as observed in VCFS. The gene encoding GATA-4, a zinc finger transcription factor implicated in cardiac gene expression and development, localizes to this region. Haploinsufficiency of the GATA-4 locus may contribute to the pathogenesis of congenital heart defects and phenotype of patients with 8p23.1 deletion. Based on our case study, we suggest that in 22q11.2 and 10p nondeleted patients with classic VCFS like clinical features, a detailed investigation of 8p should be undertaken using high resolution banding complemented with FISH to exclude subtle deletions.
1.30-P
Chromosome heteromorphisms in infertile couples J. Rueda, J. M. Moreno, I. Ochando, L. Gil, J. J. Lo´pez-Ga´lvez, M. Lloret, A. Segura, C. Go´mez-Pastrana, R. Sa´nchez and M. Poveda
6th ECC: Abstracts
36 Universidad Miguel Herna´ndez, Hospital Clı´nica Vistahermosa
R. Koken, A. Bukulmez, G. N. Koken, B. Eser, H. Samli, T. Demir and M. Solak
Chromosome Heteromorphisms (CHs) are microscopically visible regions on chromosomes that are variable in size, morphology and staining properties among different individuals. Population studies have revealed significant differences in frequencies of some CHs in different ethnic groups. A number of studies have associated some CHs with infertility Our goal was to study the CHs by means of karyotypes on men and women, included in an In Vitro Fertilization program in Spain. Chromosomal analyses were performed using cultures of peripheral blood lymphocytes on 835 individuals, mainly couples, attending the Hospital_s Reproduction Unit during the last two years. All of them had a diagnosis of either reproductive failure or recurrent spontaneous abortion. Giemsa banding (GTG) was done in all the cases, and at least 20 metaphases were analysed. In addition, FISH study using probe mixture for chromosomes 13, 18, 21, X and Y were done in semen samples of a group of the men with CHs. Seminal parameters were also recorded. From all the cases (412 were females and 423 males) 12.21% had CHs, more in females (13.80%) than in males (10.64%). However the distribution of CHs by sex showed no differences. CHs affecting chromosome 9 heterochromatin were the most frequently seen: 64.71% 9qh+ and 6.86% pericentric inversion. The rest of the CHs were the following: 1qh + (2.94%), CHs in D group (7.84%), CV in Gs group (17.65%) and Yqh + (2.28% in men). Most of the men (87.3%) had seminal parameter altered. One third of the semen samples studied with FISH showed aneuploidy rates out of normal range. We conclude that CHs, particularly those affecting chromosome 9, are more frequent in infertile population than in control. Polymorphic heterochromatic regions could disturb the meiosis thus producing gametes with higher rates of aneuploidy. This possibility needs to be confirmed with further studies on gestation rates of CHs_s carrier couples.
Afyon Kocatepe University, Faculty of Medicine
1.31-P
Double aneuploidy: a case of trisomy 21 with XYY
1.32-P
46,XX karyotypes of abortion materials; due to pregnancy losses or maternal cell contamination? M. Yirmibes Karaoguz, E. Ferda Percin, Elif Pala, Aydan Biri, Derya Kan, Altug Koc, Umit Korucuoglu and M. Ali Ergun Gazi University Medical Faculty Dept. of Medical Genetics, Gazi University Medical Faculty Dept. of Obstetrics and Gynecology Convential cytogenetic analysis of abortion material is still a valuable tool as the presence of a cytogenetic abnormality ranging between 20.8Y56.5% in miscarriages explains the reason for the loss. There is no doubt of the result when the cytogenetic analysis reveal abnormal and 46,XY karyotypes. There is a big question about the accuracy of 46,XX karyotypes as the cytogenetic diagnosis of the long term tissue cultures may reflect the abortion material or maternal cell contamination. Despite the disadvantage of selective growth of maternal cells, the quality of the chromosomes which are derived from long term cultures are better than the direct preparation and/or short term tissue cultures. In this present study, in 39 long-term cultured abortion material derived from singleton gestation with cytogenetically confirmed karyotype 46,XX, the Y chromosome was analysed using PCR amplification of SRY component. Fourteen out of 39 abortions revealed Y-chromosome component. Ten out of 25 Y-chromosome component negative abortion materials and their related parents_ materials were analysed using high-polymorphic microsatellite DNA markers to evaluate the origin of XX chromosomes and seven cases were evaluated as maternal. The preliminary results of the study showed the necessity of using molecular techniques besides conventional cytogenetic ones in order to have accurate karyotypes of the abortion material.
6th ECC: Abstracts
1.33-P
Intrachromosomal partial triplication of chromosome 13 secondary to a paternal duplication with mild phenotipic effect I. Lopez, J. A. Bafalliu, M. Santos, C. Fuster, A. Puche-Mira and E. Guille´n-Navarro Centro de Bioquimica y Genetica Clinica, Unitat de Biologia CelIlular i Gene`tica Me`dica. Facultat de Medicina. Universitat Auto`noma de Barcelona. E-08193 Bellaterra. Barcelona, Seccio´n de Neuropediatrı´a. Servicio de Pediatria, Unidad de Gene´tica Me´dica y Dismofologı´a. Servicio de Pediatrı´a Intrachromosomal triplications are rare and can be mistaken for duplications. The majority of triplications reported are de novo, mostly involving chromosome 15q, and have a middle inverted repeat. We report on the clinical, cytogenetic, and molecular analysis of a patient with a novel triplication 13q21.1q21.33 secondary to a familial duplication 13q21.1q21.33 with mild phenotypic effect in three generations. The proband was an 8 year old boy referred because of language delay and mild mental retardation. His weight, height and OFC were above 97th centile. He had delayed tooth eruption and very mild dysmorphic features. Chromosome analysis (550 band stage) revealed extra material in 13q21. Family history was unremarkable except for adult-onset neurosensorial hearing loss in the father and paternal grandfather. Karyotypes on them and both brothers of the proband showed also an abnormal chromosome 13 but with less extra genetic material. FISH analysis with several BAC clones, showed a triplication in the proband between 204N9 and 184B18 (which mapped to 13q21.1 and 13q21.33 respectively) and a direct duplication for the same fragment (around 12 Mb) in the rest of family members with the abnormal chromosome 13. The three signals were equally spaced and did not suggest a middle inverted repeat. In summary, we describe the first intrachromosomal triplication 13q21.1q21.33 derived from a paternal duplication. Meiotic instability in the transmission of a duplication has not been previously observed. Phenotypic variability may be explained by chromosomal non-penetrance or dosage critical loci located in the triplicate/duplicate segment.
37 Acknowledgments: This work was supported by Ministerio de Ciencia y Tecnologı´a (SAF 2003Y03894) y Fondo de Investigaciones Sanitarias (G03/098).
1.34-P
Prenatal diagnosis of a fals-positive turner syndrome by interphase fluorescence in situ hybridization (fish). A case report N. Ruiz Xiville´, A. Valera, I. Granada, J. Grau, M. Xandri, E. Santafe´, T. Herrero, E. Trullen and F. Milla´, E. Feliu Institut Catala` d’Oncologia, Hospital Verge de la Cinta. Tortosa. Introduction: Alpha satellite DNA is present at centromeres and is organized as large arrays of 171 bp monomers repeated in tandem. The length of these arrays is variable and this can give variations in hybridization signal intensity of centromeric probes. We report a case of undetectable X chromosome alpha satellite signal, resulting in a prenatal diagnosis of a Turner syndrome by FISH. Case report: A 28-years-old woman was referred for amniocentesis at 19 week_s gestation due to an elevated maternal serum alpha-feto-protein level. No morphologic abnormalities were found in foetal echography. Interphase FISH analysis was performed on uncultured amniotic fluid cells using AneuVysion assay kit (Vysis) according to the manufacturer_s instructions. In 50 interphase cells analyzed, two signals were present for chromosomes 18, 13 and 21, but there was only one signal for X chromosome in each cell and no Y signal. Conventional cytogenetic study from cultured amniotic fluid revealed a normal karyotype 46,XX. Due to this contradiction, metaphases were hybridized with CEP X probe (Vysis). Only one of the two X chromosomes was hybridized. Peripheral blood from parents was cultured. Gbanding analysis revealed a normal karyotype in both progenitors. FISH analysis using CEP X and CEP Y probes showed two X hybridization signals in the mother but only one Y chromosome signal in the father. After genetic counselling, parents decided to continue the pregnancy and the baby was born with a normal phenotype.
6th ECC: Abstracts
38 Conclusions: The absence of hybridization in one of the two X chromosomes can be explained by an extremely small X chromosome alpha satellite array. The presence of the same X centromere variant in the father suggests that it does not produce an abnormal phenotype in the fetus. FISH is a rapid and useful technique for prenatal diagnosis but it must be used in conjunction with conventional cytogenetics for a reliable diagnosis. Grants: Fundacio´ de Recerca Biome`dica HUGTIP and FIJC-P-EF-03.
1.35-P
Rare chromosome 21 mosaicism associated with MCA/MR phenotype: new case report N. Rumyantseva, A. Polityko, V. Kulak Republican Medical Center Mosaic autosomal unbalance is a rare finding in genetic counselling practice. We presented a child with multiply congenital abnormalities, mental and growth retardation due to a rare mosaic abnormality of chromosome 21. Family history: parents are young healthy nonconsanguineous couple. G1 Y healthy girl (P1, at term, BW=3500); G2-miscarriage; G3 - proposita, male infant with MCA/MR phenotype. He was born at term (G3;P2; BW=2350; BL=46 cm; OFC=32 cm, all G 3centiles; Apgar score 3/6). Intrauterine growth retardation, multiple congenital malformations were presented at birth. At age 3 month he showed failure to thrive, neurologic dysfunction, mental retardation, craniofacial dysmorphisms. Sonography of brain: partial absence of corpus callosum, enlarged lateral ventricles. Follow up examination at age 1 year revealed severe mental delay, growth retardation (W = 6200; L = 69 cm;), microcephaly (OFC = 41 cm), peculiar facial appearance (deep-set eyes, hypertelorism, downslanting palpebral fissures, flat nasal bride, high palate), systolic murmur (additional chorde of left ventricle), inguinal hernias, hypospadias, cryptorchidism, retinal angiopathy. Cytogenetic studies (GTG-banding) of family: affected child presented mosaic karyotype abnormality composed of two aberrant cell lines: one line included ring chromosome 21, another presented monosomy 21. Karyotype: 46,XY,r(21)[45]/45,XX,21[7]. Parental karyotypes were normal. Chromosome 21 mosaicism manifested combination of structural
rearrangement and numerical changes of chromosome 21 is extremely rare form of mosaic autosomal imbalance. Clinical characterization is important for further delineation of phenotype. Pre-and postzygotic events as possible mechanisms of the mosaic karyotype abnormalities formation, clinical picture of our new patient with ring21/monosomy 21 mosaicism in comparison with literature data are discussed.
1.36-P
Holoprosencephaly and 2q37 deletion: a second case in a girl with Albright hereditary osteodystrophy-like phenotype I. El Kamel, S. Marlin, A. Aboura, M. P. Beaujard, C. Dubourg, J. P. Siffroi and M. F. Portnoı¨ H oˆ p i t a l S a i n t - A n t o i n e A P H P S e r v i c e d e Cytoge´ne´tique Paris, Hoˆpital Trousseau APHP Unite´ de Ge´ne´tique Paris, Hoˆpital Robert Debre´ APHP Service de Cytoge´ne´tique Paris, CHU De´partement de Ge´ne´tique Rennes Holoprosensephaly (HPE) is clinically and etiologically heterogeneous, and both environmental and genetic causes have been identified. Analysis of recurrent rearrangements involving chromosomal regions, in which deletions were associated, led to identification of HPE genes. Here we report on a newborn female who presented with HPE microform and a terminal de novo 2q37 deletion, identified by cytogenetic analysis with G-banding and confirmed by subsequent FISH analyses. She was born at 39 weeks of gestation as the first child to unrelated healthy young parents. At birth, she developed respiratory distress. Clinical findings included hypotonia, unilateral facial nerve palsy, a round face, hypotelorism, deep-set eyes, and thin upper lip. She had a single central incisor, nasal pyriform aperture stenosis, and corpus callosum partial agenesis. A brain MRI showed absence of the left olfactory bulb. Screening for mutations in the 4 major HPE genes (SHH, ZIC2, SIX3, TGIF) was negative. Four cases of HPE associated with monosomy 2qter have been previously reported, suggesting that a gene locus in the 2q37 region, designed HPE6, could be involved in HPE. Our case represents the fifth case of HPE
6th ECC: Abstracts associated with a partial monosomy of 2q37 and the second with an apparent isolated 2q37.1-qter deletion. Terminal deletions of the long arm of chromosome 2 (2q37) are associated with the Albright hereditary osteodystrophy-like brachymetaphalangism syndrome, which consists of mild-to-moderate mental retardation, short stature, characteristic facial dysmorphism, present in our patient, brachymesophalangism, and epilepsy. The minimal critical region responsible for this 2q deletion syndrome has been estimated to be about 3 Mb and comprises several genes. Further FISH analysis with BACs probes of the region is in progress to map the breakpoint and to narrow the assignment of the HPE6 gene.
39 using conventional peripheral blood culture methods. A 46,XX karyotype was detected in the female and a 46,XY,inv(5)(p15.3;q33.1)x2 karyotype in the male. The parents of the man were consanguineous, and his father was dead. Heterozygote inv(5)(p15.3;q33.1) was detected in his mother and two healthy brothers. So, we thought that the second chromosome 5 with pericentric inversion with the same break point must be inherited from his father. FISH analysis, by using 5p and 5q telomere-specific probes, confirmed the pericentric inversion of chromosome 5. In this case, the carrier who is homozygous for inv(5), with presumably the same breakpoints, is not likely to produce recombinant offspring. The risk of gametes with a partial monosomy or trisomy in his case is equal to that of healthy individuals.
1.37-P
Homozygous inv(5) in a family with recurrent fetal loses Abdulgani Tatar, Ahmet Yesilyurt, Tahsin Yakut, Sitki Oztas and Bunyamin Borekci Department of Medical Genetics, Medical Faculty, Ataturk University, Erzurum, Turkey, Department of Medical Genetics, Medical Faculty, Uludag University, Bursa, Turkey, Department of Obstetrics and Gynecology Inversions are important to cause the formation of the recombinant gametes, although they are not usually associated with a clinical problem. Inversions can affect spermatogenesis and lead to the production of unbalanced gametes through the formation of an inversion loop. Moreover, an inversion may affect the expression of the genes located out of the inversion site and cause clinical problems. Pericentric inversion of chromosome 5 is a very rare chromosomal rearrangement. A couple married for 5 years was referred to the genetic department with a complaint of recurrent fetal losses. They were consanguineous and had a history of two fetal losses. The first pregnancy resulted in stillbirth in the eighth month and the second pregnancy resulted in a spontaneous abortion in the fourth month. There was no history of fetal loss or infertility or dysmorphic offspring in the other family members. In both of the patients, the physical examination and biochemical, hematological and endocrinological tests were all normal. Cytogenetic analyses were performed
1.38-P
Characterization of two sSMC present in two unrelated patients L. Miguez Alvarez, M. Santos, T. Liehr and C. Fuster Fundacio´n Pu´blica Galega de Medicina Xeno´mica. Unidade de Diagnose Prenatal. Hospital Clı´nico Universitario. Santiago de Compostela. 15706, Spain, Unitat de Biologia CelIlular i Gene`tica Me`dica. Facultat de Medicina. Universitat Auto`noma de Barcelona, Institut fu¨r Humangenetik und Anthropologie. 07743 Jena, Germany. Small supernumerary marker chromosomes (sSMC) were recently defined as structurally abnormal chromosomes that cannot be identified or characterised unambiguously by conventional-banding cytogenetics alone, and are generally equal in size to or smaller than a chromosome 20 of the same metaphase spread. sSMC are generally unique and only in a few cases have two sSMC been described. We report the use of G-banding, high-resolution comparative genomic hybridisation (HR-CGH), multiplex-fluorescence in situ hybridisation (24 colours, M-FISH), centromerespecific multicolour-FISH (cenM-FISH) and specific subcentromeric multicolour-FISH (subcenM-FISH) techniques for the characterisation of two sSMC present in an unrelated woman and man. In the woman, the sSMC were detected during prenatal diagnosis in a foetus with trisomy 21, and in the
6th ECC: Abstracts
40 man they were detected due to his reproductive problems related to oligozoospermia. In both cases the sSMC showed a familial origin. In the woman, HR-CGH and M-FISH were not useful to delineate the origin of the marker chromosomes. Further analysis with cenM-FISH and subcenM-FISH mixtures for chromosomes 13 and 21 showed the sSMC were inv dup(13)(q11) or inv dup (21)(q11.1). In the man, two identical dicentric sSMC involving the 15q11.1 band are characterised by these molecular methods. These reports suggest that the presence of two sSMC in the patient could increase disturbances in meiosis, thus favouring non-disjunction of other chromosomes, especially chromosome 21, as what probably occurs in the woman. In the man, the marker chromosomes could induce the selection against the abnormal germinal cells during spermatogenesis, leading to oligozoospermia. However, additional population information would be needed to confirm it.
revealed heterozygous mutation in the MTHFR gene. Serum factor 2 protein C and activated protein C resistance levels were 143% (70Y120) and 1.25% (4.3Y6), respectively. We suggest that an unbalanced translocation during gamete formation and an associated thrombophilic status might be the cause of recurrent miscarriages in our case.
Acknowledgments: This work was supported by the Ministerio de Ciencia y Tecnologı´a (SAF 2003-03894), CIRIT (SGR05Y00495)
Here we report on a newborn male born at term with low-birth weight (SGA) with severe hypotonia and poor sucking. Decreased fetal movements were noted during the 3rd trimester of pregnancy. Chromosome analysis revealed normal male karyotype, with 2 identical marked chromosome 15P +S ++ . Parents’ karyotypes were 46XX 15P+ S ++ and 46XY, suggestive of an UPD mechanism, with partial isodisomy. The newborn’s FISH analysis (Q-Biogene probe), SNRPN region/ PML control, was normal. Molecular testing of polymorphic markers along chromosome 15 revealed a UPD of maternal contribution alleles at D15S128, D15S122, GATA50C03, D15S659, D15S652 and an absence of paternal contribution alleles. Our results showed heteroUPD from band q11.2 (D15S128) to band q21.1 (D15S659) and isoUPD at band q26.1 (D15S652). The cytogenetic results suggested isoUPD of the 15p arm, formed at the 2nd meiosis nondisjunction, and a double crossing over event in the 15q arm. The proximal breakpoint is located between the centromere and the polymorphic makers D15S128 at band q11.2, and the distal breakpoint located between D15S1507 at band q22.3 and D15S652 at band 26.1. To the best of our knowledge, this is the first report of detection of UPD using cytogenetic methods. Furthermore, these unique results are not concordant with those previously published, in which a mat heterodisomy was mostly observed. We suspect that due to these unique
and Generalitat de Catalunya (Grants 2002FI00281 and 2005BE00172) and the Evangelische Studienwerk e.V. Villigst.
1.39-P
Recurrent miscarriages in a patient with familial balanced t(1;3), inv(9) and thrombophilia S. Tural, G. Okten, N. Kara, F. Alpaslan Pinarli, I. Kocak and S. Gunes Ondokuz Mayis Univesity Medical Faculty We report a 23 year-old-woman with a history of three consecutive first trimester pregnancy losses. There were no systemic, endocrine, anatomic or environmental risk factors for miscarriage. She was phenotypically normal but karyotyping by standard G-banding techniques of peripheral blood cultures showed 46,XX t(1;3)(p26.1;p21), inv(9)(p11;q11). Cytogenetic analysis of the patient_s mother who has also a history of recurrent miscarriages revealed the same balanced translocation. Obstetrical work-up including ultrasound (USG) and hysterosalpingography (HSG) were normal. Thrombophilic factors
1.40-P
Y
Prader-Willi Syndrom (PWS) a result of matUPD15 diagnosed by cytogenetic method H. Bar-el, M. Ziv, A. Shalaata, V. Adir and Z. Borochowitz Bnai-Zion Medical Center
6th ECC: Abstracts findings, further clinical follow-up of this child may yield a better understanding of the genotype-phenotype correlation among PWS cases.
1.41-P
41
1.42-P
A case of spondyloepiphyseal dysplasia tarda with progressive arthropathy with delayed diagnosis E. Tug and E. Senocak
Chromosome 2 mosaicism with a complex unbalanced karyotype: a case report
Abant Izzet Baysal University Izzet Baysal Medical School
K. Huijsdens, M. C. van Maarle, E. G. de Boer, E. Pajkrt and A. C. Knegt
1.43-P
Academic Medical Center We report on a patient with a de novo deletion distal to chromosome 2(q36), combined with different mosaic aberrations of chromosome 2. At ultrasound, an enlarged fetal nuchal translucency (2,8 mm) was observed. Short term culture (STC) of chorionic villus cells at 12.3 weeks of pregnancy revealed two different cell types. Seven metaphases showed additional material on the long arm of chromosome 2, which was shown to be due to a duplication of chromosome 2 material combined with a terminal deletion of 2(q36). Three metaphases showed a cryptic deletion of 2(q36): mos 46,XX,add(2q). ish dup(2)(wcp2 + )del(2)(q36)(RGY172YI13Y) [7]/46, XX.ish del(2(q36)( RGY172YI13 Y)[3]. In the long term culture (LTC) three different cell lines were observed, with karyotype: mos 47,XX, del(2)(q36), + mar[3]/47,XX, + 2, del(2)(q36)[5], 46,XX,del(2) (q36)[6]. It was not possible to determine whether this was a true trisomy 2 mosaicism or a culture artefact. Thus, both in the STC and LTC mosaicism with a complex unbalanced karyotype was detected. Surprisingly, all aberrations involved chromosome 2. Subtelomere FISH showed no other subtelomere aberrations, besides that of chromosome 2qter. The mosaicism might be confined to the placental tissue, and therefore, amniocentesis was indicated, but not obtained. After birth, the del(2)(q36) de novo was confirmed in both the child_s blood and the placental tissue. We hypothesize whether the del(2)(q36) rendered chromosome 2 unstable, resulting in other chromosome 2 aberrations.
Uncommon mosaic autosomal trisomy in prenatal diagnosis: a report of 4 cases. B. Lee1, M. Lee1, Y. Lee1, M. Kim2, H. Ryu2 and S. Park1* 1
Lab of Medical genetics, Medical Research Institute, Cheil General Hospital & Women_s Healthcare Center, 2Department of Obstetrics and Gynecology, Cheil General Hospital & Women_s Healthcare Center Prenatally diagnosed fetuses with rare autosomal mosaicism, other than for chromosomes 13, 18, 21, and sex chromosomes, are likely to be associated with fetal demise. Careful consideration has to be given to genetic counseling in these cases. We report four cases of uncommon true mosaicism of trisomy 5, 16 and 20 diagnosed prenatally. Of the two cases of mosaic trisomy 20, case 1 showed higher mosaic ratio of trisomy 20 in the second amniocentesis, 62.1% than in the first amniocentesis, 36.6%. Case 2 showed a low rate, 5.25%, of mosaic trisomy 20 in cultured amniocytes with raised level of hCG (human chorionic gonadotropin), 2.483 MoM at 16.3 weeks of gestation but the second karyotype as normal. Case 3 of mosaic trisomy 5 was referred for amniocentesis due to high level of alpha fetoprotein (AFP, 5.11 MoM) and was found to have 10.5% of mosaicism. Case 4 of mosaic trisomy 16 had 13.6% of mosaic trisomy 16 in cultured amniocytes with clinical index of raised level of AFP (2.630 MoM), hCG (9.470 MoM). Sixty cells of fetal blood were examined at termination and all cells showed a
6th ECC: Abstracts
42 non-mosaic normal karyotype, 46,XX, whereas skin fibroblasts had 22.5% of trisomy 16 cells. At 24.6 weeks of gestation, autopsy specimens showed ventricular septal defect (VSD). Therefore, there should be a more variable approach using molecular and cytogenetic methods to study the true autosomal trisomy mosaicism in prenatal diagnosis.
been derived from the Y chromosome and consists of most of the p arm with a break near the centromere in the long arm at Yq11.21. The karyotype of the patient had arisen de novo as the father had a normal karyotype. In this study, we try to define the marker chromosome with cytogenetics, molecular cytogenetics and molecular genetics techniques. Finally, we discuss the relationship between fenotype and genotype in this case.
1.44-P
A case with ambiguous genitalia because of 45,x/46,x,+mar chromosome constitution A. Yesilyurt, Z. I. Ocak, A. Tatar and S. Oztas Ataturk University A two month old patient was referred to the department of medical genetics, because of ambiguous genitalia. The patient was the third child of a nonconsanguineous married couple. The mother and father of the patients were 38 and 45 years old, respectively. Family history was unremarkable, and the pregnancies and deliveries were uneventful. The two sibs, a brother and a sister, had normal features on physical examination. The patient has no growth and developmental delay or facial dysmorphism on physical examination. However, a micropenis (2.5 cm; G j2 SD), hypospadias, a bifid scrotum, an urogenital sinus in middle line between penis and scrotum were detected on examination of the urogenital system. The right testis was palpable within the inguinal canal and the left testis was in the scrotum. No abnormality was reported in abdominal ultrasonography (USG). The left and the right testes were reported as 13.5 9.5 5.8 mm and 11.8 9.5 5.8 mm on scrotal ultrasonography, respectively. The karyotype from periferal blood samples was found to be 45,X[45]/46,X, +mar[55] in 100 metaphases. FISH analysis was performed in order to investigate whether the marker chromosome harbored the SRY gene. The SRY signal was detected on the marker chromosome. Y chromosome microdeletions were investigated with primers of Y chromosome-specific sequence tagged sites (STSs) incluiding the SRY gene and AZF a, b, c and d loci. The SRY gene was detected but not AZF a, b, c and d loci. It is suggested that the marker chromosome has
1.45-P
Mosaicism and telomeric studies in ring chromosome 20 syndrome H. Hannechi, H. Elghezal, S. Mougou, W. Denguezli and A. Saad Farhat Hached University Teaching Hospital, Fattouma Bourguiba University Teaching Hospital Ring chromosome 20 syndrome is a rare disease characterized by refractory epilepsy, mild to moderate mental retardation, facial dysmorphism and particular electroencephalographic disorder with non convulsive status epilepticus. Here, we report a new case of r(20) syndrome. The patient was a 12 year old female. She was the first child of an inrelated couple devoid of medical history and she was born after uneventful pregnancy and delivery. First generalised tonic seizures were observed at 2 years and at 6 years of age, absence seizure recurred several times per day and generalized tonic seizures recurred 1 or 2 times a day. Out of 100 mitosis scored using banded karyotype, 75 presented a ring chromosome 20, 15 had 2 apparently normal chromosomes 20, 8 presented a double-sized ring chromosome 20 and 7 were 45,XX,-r(20). Among 500 nuclei and mitosis explored by FISH using centromeric probe of chromosome 20, we detect the presence of chromosome 20 monosomy in 7% and a duplicated ring chromosome 20 in 8% of studied cells. Metaphase FISH using telomere specific probes of chromosome 20 detected the presence of both subtelomeric sequences in ring chromosome 20. Clinical symptoms of r(20) syndrome are attributed to partial monosomy generated by ring chromosome and causing an haploinsufficiency of two epilepsy genes CHRNA4 and KCNQ2. However, this is the third
6th ECC: Abstracts described case of ring chromosome 20 who has the typical epilepsy disorder but no deletion of the subtelomeric regions. In this study and using FISH with centromeric chromosome 20 probe, we detect a low mosaicism with chromosome 20 monosomy and trisomy caused by the loss or the duplication of the ring chromosome in 15% of analysed metaphases. we speculate than that clinical features of ring chromosome 20 syndrome are caused by mosaic chromosome 20 monosomy or trisomy and not solely because of the deletion of CHRNA4 and KCNQ2 genes located in the subtelometic 20q region.
43 conclusion, the chromosome 2p15 site may harbor genes playing a role in spermatogenesis.
1.47-P
Prevalence of chromosome abnormalities in 707 cases of premature ovarian failure outside Turner phenotype R. Braham, H. Elghezal, B. Lakhal, S. Hidar, M. Chaieb, M. Zaouali, L. Chaieb and A. Saad Farhat Hached University Teaching Hospital
1.46-P
Two similar chromosomal translocations including 2p15 associated with non-obstructive azospermia M. Ikbal, A. Yesilyurt, A. Tatar, Z. I. Ocak, T. Alkan and S. Oztas Karadeniz Technical University, Ataturk University Two male patients were referred to the deparment of medical genetics because of azoospermia. We detected very similar chromosomal aberration in these cases. Both men were married and suffered from primary infertility. They had normal findings on pyschical examination. Biochemical, hematological and endocrinological tests were all normal. In order to investigate the etiology of azoospermia, a test for Y chromosome microdeletions for AZF loci was performed in both cases. But, no microdeletions in the AZF a, b, and c loci were detected. However, conventional chromosome analysis from peripheral blood samples revealed a 46,XY,t(2;14)(p15;qter) karyotype and a 46,XY,t(Y;2)(pter;p15) karyotype in patient 1 and patient 2, respectively. The translocation in patient 2 was de novo. However, we could not perform cytogenetics analysis in the parents of patient 1. So, we could not determine whether the translocation in patient 1 was de novo. In this study, we discuss the possible association between these translocations and azoospermia. As far as we know, this is the first report that has revealed a relationship between the breakpoints of chromosome 2 and azoospermia. In
Introduction: Premature ovarian failure (POF) is defined as cessation of ovarian function at the age of e 40 years, after a normal development. It is characterized by the occurrence of primary or secondary amenorrhoea with elevated gonadotrophin levels. Among genetic causes of POF, chromosome abnormalities are the most frequent. The aim of this study is to evaluate the prevalence of chromosome abnormalities in Tunisian women with POF. Materials and methods: We studied in 700 patients with POF recruited from the department of cytogenetics of Farhat Hached hospital between January 1988 and December 2006. Results: The mean age of our patients at the time of the study was 25 years (range, 14Y50 years). 401 patients had primary amenorrhoea (56,71%) and 306 secondary amenorrhoea (43,28%). 103 cytogenetic abnormalities (14,56%) were found in 56 patients with primary amenorrhoea (13,96%) and 45 patients with secondary amenorrhoea (14,7%). Numerical Xchromosome abnormalities associated with variable degrees of 45,X/46,XX and/or 47,XXX mosaicism were the most frequent abnormalities and were detected in 68 cases (66,01% of all anomalies). Partial X chromosome deletions were detected in 28 cases (27,18% of all anomalies): there were 6 i(Xq), 3 i(Xp), 6 Xp deletions, 7 Xq deletions and 6 ring chromosome X. Balanced X autosome translocations were detected in 4 cases. On the other hand, autosomal anomalies were detected in 3 cases: there were 2 cases of chromosome 12 inversion and 1 case of 14;21 Robertsonian translocation. Conclusion: Cytogenetic study of POF showed a high prevalence of chromosome anomalies both in
6th ECC: Abstracts
44 primary and secondary amenorrhoea. X chromosome anomalies were the most frequent aberrations, particularly numerical mosaicism. Some cases of POF may be attributable to low-level 45,X/46,XX mosaicism, which can be detected using FISH.
1.48-P
Maternal and paternal Robertsonian t(13;14) resulting in maternal UPD 14 in a child A. Schneider, G. Lefort, A. M. Chaze, A. Bazin, P. Sarda and J. Puechberty Hoˆpital Arnaud de Villeneuve, CHU Montpellier, Laboratoire Pasteur Cerba, Cergy Pontoise YA is the only child of consanguineous Moroccan parents with a history of two spontaneous abortions. He was born at term and was hypotrophic, with birthweight: 2 kg 300, length: 46 cm and OFC: 34 cm. The APGAR score was 6 and 10. THe course was satisfactory after transient oxygen therapy. The first few months were marked by feeding difficulties and axial hypotonia. Independent walking was achieved at 18 months and language delay noted at 2 years. When presented at our genetics consultation at the age of 9 the child presented no particular learning difficulties. He was excessively shy but without behavioural problems. Height and weight measurements showed troncular obesity with a weight of 48 kg (+ 5SD), height of 131.5 cm (j0.5SD) and OFC of 55 cm (+ 1.5SD). Body mass index was 29.3. Physical examination revealed hypogonadism with left side cryptorchidism and micropenis, and cubitus valgus and small hands with bilateral single transverse palmer creases and brachydactylia. Craniofacial dysmorphic findings included short philtrum, small mouth, large ears with large lobes, prominent metotopic suture, hypotrophic lower maxillary with abnormal tooth implantation. Assessment of lipid metabolism, thyroid function and glycohemoglobin test (5.5%) gave normal values. At 4 years blood testosterone was undetectable and pituitary gonadotropin (FSH, LH) values normal. The hCG stimulation test showed no increase in testosterone level (G1 ng/ml). Left testes biopsy revealed gonadal dysgenesis. Chromosome studies showed a balanced Robertsonian translocation
t(13;14) in the patient and his mother and father. Molecular studies reported maternal UPD14 for the markers studied. The IGF1 and the IGF-BP3 were low in relation to age and parents_ heights and suggestive of growth hormone deficiency. This led us to consider the possible benefits of growth hormone treatment for children with maternal UPD14 who have small stature and obesity as do patients with Prader Willi syndrome.
1.49-P
Cri du Chat mosaicism: an unusual case of partial deletion and partial deletion/duplication of the short arm of chromosome 5 A. Nucaro, D. Murru, R. Rossino, A. Faedda and L. Boccone CNR, Dipartimento Scienze Biomediche e Biotecnologie University Cagliari, Dipartimento Scienze Mediche Internistiche M. Aresu- University Cagliari The Cri du Chat Syndrome (CdCS) is one of the most common deletion syndromes, involving the short arm of chromosome 5, with an incidence of 1 in 50.000 live births. The following are the characteristic features of this syndrome: microcephaly, hypertelorism, round face, micrognatia, epicanthic folds, prominent nasal bridge, hypotonia and severe psychomotor retardation. Patients also show a high pitched cry similar to the mewing of a cat. Deletions and duplications of chromosome 5p have been described in the literature. Mosaicism represents only 3% of this cytogenetic aberration. Up to now, only cases of mosaic de novo 5p anomalies involving two or three rearranged cell lines with deletions and duplications have been described. Here, we report the first case of a patient affected by multiple congenital anomalies and a mosaicism, with two rearranged cell lines: one with a 5p deletion; the other with a 5p deletion/duplication.Our patient did not show the characteristic features described in patients with 5p duplications, but a phenotype compatible with Cri du Chat Syndrome. Our case is the first case that describes a mosaicism with deletion and deletion/ duplication of a portion of the short arm of chromosome 5.
6th ECC: Abstracts
1.50-P
Hormonal treatment used in assisted reproductive tecniques has slight cytogenetic effects on amniotic cells R. A. de la Chica, J. Giraldo, B. Mendez and C. Fuster Unitat de Biologia Cel.lular i Gene`tica Me`dica. Facultat de Medicina. Universitat Auto`noma de Barcelona, Unitat de Bioestadı´stica. Facultat de Medicina. Universitat Auto`noma de Barcelona, Centro de Patologia Celular y Diagno´stico Prenatal. Barcelona
The aim of present study is to determine whether hormonal treatment has a genotoxic effect on foetuses conceived after assisted reproductive techniques and to analyze whether any chromosomal regions are especially affected. This analysis was performed in amniocytes obtained by routine amniocentesis for prenatal diagnosis from 20 non-treated women (NT-group) and 20 women who had conceived by assisted reproductive techniques after IVF/ ICSI hormonal treatment (T-group). Chromosome alterations, expressed as chromosome lesions (gaps and breaks), and structural chromosome abnormalities, were analysed in chromosome spreads stained with Leishman. About 100 random metaphases uniformly stained were analysed in each case. Breakpoints implicated in chromosome alterations were identified by G-banding. To identify which chromosome bands could be considered especially affected by hormonal treatment, the fragile-site, multinomial method (Version 995) was used. Comparison of cytogenetic data from treated (T-group) and non-treated women (NT-group) showed statistically significant differences for the proportions of chromosome lesions (T: 12.9% [279/2156], NT: 8.7% [187/2128]). However, the proportions of structural chromosome abnormalities (T: 4.8% [29/607], NT: 2.8% [17/ 600]) was marginally influential. The 439 breakpoints (T:272; NT:167) involved in these chromosome alterations showed a non-random distribution in both groups, and that 1p22, 1q25, 3p14, 6q21 and 9q32 bands were more affected in the T-group than in the NT-group. Our findings suggest a slight association between the hormonal treatment used in assisted
45 reproductive technology protocols and chromosome alterations in amniocytes. Moreover, five specific chromosome bands (1p22, 1q25, 3p14, 6q21 and 9q32) affected by hormonal treatment were found.
1.51-P
Down syndrome as a result of a 3:1 segregation of t(5,21) in the mother A. Matulevicˇaiene˙, B. Aleksiu¯niene˙, N. Krasovskaja and V. Kucˇinskas Centre for Medical Genetics, Vilnius University Hospital, Department of Human and Medical Genetics, Vilnius University We present a newborn, third child of healthy non consanguineous parents with Down_s syndrome. The genealogy has been complicated: elder brother died after birth. Hydrocephaly was diagnosed, but autopsy and other clinical investigations were not performed. The boy_s mother was consulted during this pregnancy at the Center for Medical Genetics. Risk of congenital malformations for this foetus was calculated in relation to maternal age, gestation and obstetrical history. The recurrent risk for hydrocephaly was from 2Y3% for sporadic case to 50% for X-linked hydrocephaly. Trisomy 21 risk was 1:680 according to the mother_s age. Ultrasound scan was performed at 16th, 22nd and 32nd week of gestation, neither foetal structural malformations, nor minor defects or markers of chromosomal diseases were detected. Placenta and amniotic fluid volume appeared normal. Triple test was performed at 16th week of gestation. Biochemical risk for Trisomy 21 was 1:635, for Trisomy 18Y1:3401, for neural tube defectsY1:7589. A 3D scan was performed and the phenotype of foetus was normal. There were no indications for karyotyping the foetus. The Down syndrome was diagnosed from the phenotype of our patient after birth. There were no malformations of his cardiovascular and gastrointestinal systems. Chromosome analysis was performed from GTG banded metaphases. The resolution level was 400Y500 bands. Cytogenetic analysis of peripheral blood lymphocytes showed a karyotype: 47, XY, t(5; 21) (q10; q10), + 21. Cytogenetic investigation of the family showed that the mother and the elder sister are carriers of the balanced
6th ECC: Abstracts
46 reciprocal translocation 46, XX, t(5; 21) (q10; q10). Hence, the trisomy has occurred through a 3:1 disjunction of the balanced maternal rearrangement.
1.52-P
Molecular cytogenetic characterization of sex chromosome abnormalities in two cases with ambiguous genitalia
inv(7) is also associated with fetal wastage, and may be playing a role in the etiology of the miscarriages of the family. The detection of couples with chromosomal anomalies can undoubtedly help to prevent the birth of malformed infants. The distal breakpoint on chromosome 7 may contain a gene important for renal cell proliferation during fetal life. These findings can be used widely in clinical genetics and are an effective tool for reproductive guidance and genetic counseling.
A. Kamel, A. Mohamed, I. Mazen, N. Dessouki and H. Hussein National Research Centre (NRC), Faculty of Medicine, Cairo Univeristy
1.53-P
Inheritance of three progenies of pericentric inversion of chromosome 7 and congenital hydronephrosis in a newborn, diagnosed prenatally from fetal urine ¨ zcan, D. Tas¸temir, O. Demirhan, K. O C. Demir, E. Tunc¸, H. A. Solg˘un and A. I˙. Gu¨zel Faculty of Medicine Pericentric inversions occur frequently. A balanced carrier is healthy but at a high risk for having chromosomally unbalanced offspring leading to a high rate of repeated spontaneous abortions. Familial rearrangements involving chromosome 7 have been reported infrequently. Chromosomal analysis from fetal urine and peripheral blood lymphocytes was performed according to standard cytogenetic methods using the G-banding technique. We investigated an extended family in which a large pericentric inversion of chromosome 7 is segregating. One of the three progenies of inversion heterozygotes showed congenital hydronephrosis and had the karyotype 46,XY,inv(7)(p22q22), derived from his mother. The mother_s brother, grandfather, grandfather_s brother and his daughter were also carriers of the inversion. This case confirms the suggested location of a locus, important for governing renal cell proliferation during fetal life, on the short or the long arm of chromosome 7(7p22Yq22), and describes the further molecular characterization of these breakpoints. The
1.54-P
Roberts syndrome: a tunisian case L. Ben Jemaa, R. Mrad, M. Chaabouni, F. Maazoul, I. Chelly, L. Kraoua, N. Gandoura, A. Lebbar, J. M. Dupont and H. Chaabouni Charles Nicolle Hospital, Bizerte Hospital, Cochin Hospital Roberts syndrome (RS) was first described by Roberts in 1919. It_s a rare autosomal recessive disorder characterized by profound growth deficiency, hypomelia, and cranioflacial anomalies including microcephaly, cleft lip and palate, hypoplastic nasal alae, shallow orbits, micrognathia, frontal encephalocele and mild-to-severe mental deficiency. Cytogenetic study has shown chromosomal abnormalities involving heterochromatic regions around the centromeres and nucleolar organizers. The heterochromatin of the long arms of the Y chromosome is often widely separated in metaphases, which suggests a repulsion or a lack of attraction between the chromatids leading to a premature separation during prophase or metaphase. Roberts syndrome is caused by a mutation in the ESCO2 gene, the protein product of which is required for the establishment of sister chromatid cohesion during S phase. We describe a 22 days old Tunisian male born of consanguineous parents with growth deficiency, limb reduction abnormalities, with absence of radii and ulnae in the forearms, oligodactyly, absence of the tibia and fibulae in the shin, reduction in number of toes, syndactyly of the fourth and fifth toes, flexion contractures of knees and ankles. Moreover, he presents craniofacial abnormalities including: microcephaly, bilateral cleft lip, cleft palate, micrognathia, hypertelorism, catarct and low set ears
6th ECC: Abstracts with hypoplastic lobules Cytogenetic study shows:standard normal karyotype - C-banding shows a characteristic abnormality which consists of repulsion of the constitutive heterochromarin of almost all chromosomes - the heterochromatin of the long arms of the Y chromosome is often widely separated in metaphase spreads of our patient. Originally RS and the SC phocomelia syndrome were described as distinct entities; they are now considered to be a single disorder with significant clinical heterogeneity. Our patient has a severe phenotype and craniofacial abnormalities. This suggests Roberts sydrome. We plan to study the ESCO2 gene in our patient and his parents.
1.55-P
Down-Turner syndrome: a case report B. Aleksiu¯niene˙, L. Cimbalistiene˙, E. Zarakauskaite˙ and V. Kucˇinskas Centre for Medical Genetics, Vilnius University Hospital; Department of Human and Medical Genetics, Vilnius University, Department of Human and Medical Genetics, Vilnius University Co-occurrence of two numerical chromosomal abnormalities in the same individual (double aneuploidy) is a relatively rare chromosomal abnormality. Our patient is a seventeen year old girl, the only child of healthy non consanguineous parents. The genealogy of this family is complicated: proband_s cousin has symptoms of psychomotor retardation. Clinically, proband has the most of the phenotypic features of Down syndrome as well as some features of Turner syndrome. Characteristic findings included low posterior hairline, inner epicanthic folds, strabismus, upslanting palpebral fissures, depression of the bridge of the nose and anteverted nares, patulous lower lip, high and narrow palate, broad mouth with enlarged tongue, prominent ears, short fingers, wide distance between first and second toes and bilateral syndactyly of the second and third toes. The characteristic features for Turner syndrome, pterygium colli and short stature were evident, but menses were regular. The girl also had tetrology of Fallot, which was totally corrected by surgery. Cytogenetic analysis of peripheral blood lymphocytes revealed a mosaic karyotype 46,XX,der (21;21)(q10;q10)[23]/45,X[7]. Cytogenetic analysis was performed from GTG banded metaphases. The
47 resolution level was 400Y500 bands. Molecular testing demonstrated trisomy 21, possible mosaicism with dominant trisomy 21.
1.56-P
An azoospermic case with (16)(q22) fragile site T. Gulten, S. G. Temel, E. Evke, H. Cangul and T. Yakut Uludag University, Medical Faculty Chromosomal aberrations are one of the most frequent causes of male infertility. These aberrations may involve sex chromosomes, autosomal chromosomes, or both. The type of aberration may be numerical or structural. The reproductive performance of carriers with chromosomal aberrations may depend on the involved chromosomes, aberration types and the breakpoint sites which may be potential loci for infertility. The case we present is a 34 year old male counselled for genetic assesment because of primary infertility. His spermiogram showed azoospermia and his chromosomal analysis showed the mosaic karyotype: 46,XY,del(16)(q22)[43]/46,XY,fra(16)(q22)[3]/ 46,XY[4]. Although, chemokine-like factor super family member 1(CKLFSF1) gene which is supposed to play an important role in spermatogenesis or testicular development is located on 16q22, there are just two published cases of 16q22 breakpoint related with male infertility. We suggest that this case will contribute to previous data.
1.57-P
One case of mosaic trisomy 8 S. Savaci, S. Yuksel, E. Yesilada, Cengiz Yakinci, E. Kaygusuzoglu, G. Gulbay and G. Otlu Inonu University Trisomy 8 mosaicism is a rare chromosomal disorder with multisystemic abnormalities. Trisomy 8 is frequently seen as a mosaic form in the blood or in the skin, or both. A 12 year old female patient was admitted to our hospital because of mild mental
6th ECC: Abstracts
48 retardation and evident symptomes of trisomy 8. She had craniofacial abnormalities, including an elongated face, divergent strabismus, a broad bulbous nose, and an everted lower lip. We noted other clinical abnormalities such as long and narrow shoulders, rib deformities, camptodactyly, deep palmar and plantar furrows, as well as limited rotation of his hip joint. Cytogenetic studies were performed on PHA-stimulated peripheral blood (PB) leukocytes and fibroblasts cultured from a skin biopsy. Metaphases were analyzed by G(GTG) banding. Mosaic trisomy 8 was detected: 47,XX +8[96]/46,XX [12].
1.58-P
A fetus with a chromosome 16 long arm trisomy of maternal origin M. Herrero Moreno, E. Lloveras, T. Vendrell, L. Barranco, V. Cirigliano, T. Higueras and A. Plaja Departament de Citogene`tica. General Lab S.A. Laboratoris d_Ana`lisi. Barcelona. Spain, Unitat de Gene`tica. Hospital Materno-Infantil Vall d_Hebron. Barcelona. Spain, Departament de Biologia Molecular. General Lab S.A. Laboratoris d_Ana`lisi. Barcelona. Spain, Unitat de Medicina Fetal. Hospital Materno-Infantil Vall d_Hebron. Barcelona. Spain Trisomy 16 is the most frequent chromosomal abnormality at conception, associated with a high probability of fetal death. We present a case of a partial trisomy 16 in a pregnancy of 32 weeks of gestation. Clinical Case A thirty year-old healthy pregnant woman with a previous miscarriage of unknown chromosome constitution was referred. The sonographic findings at 32 weeks of gestation detected a single umbilical artery, a right ventricle with two exits, a bilateral choroid plexus cyst and a pelvic location of one kidney. Prenatal chromosome diagnosis was performed in amniotic fluid cells. The fetus showed a 46,XY,add(14)(p10) chromosome constitution. QF-PCR was not informative because of a maternal contamination. Maternal peripheral blood revealed a balanced reciprocal translocation between chromosomes 14 and 16; a 46,XX, t(14;16)(p10;q10) karyotype. The fetal chromosome constitution was identified as a whole chromosome
16 long arm trisomy of maternal origin. Partial monosomy of the short arm of chromosome 14 does not have clinical repercussions as demonstrated by Robertsonian translocations carriers. The paternal karyotype was 46,XY. The karyotyping of the maternal grandparents showed a normal chromosome constitution. Comments the present data prove the need of doing the parental karyotype when a chromosomal abnormality has been detected at prenatal diagnosis. Cardiac malformations are the most commonly seen abnormality in a fetus with mosaic trisomy 16 (62%). Our case suggests the involvement of factors located in the long arm of chromosome 16. The normal chromosome constitution of maternal grandparents led us to conclude that the patient_s translocation is Bde novo^. For genetic counseling, in the present case, we estimate the likelihood of chromosomally unbalanced newborns in future pregnancies at approximately 15%.
1.59-P
Hematological anomalies in Down syndrome Cristina Popa, Nicoleta Andreescu, Monica Stoian and Alina Belengeanu University of Medicine and Pharmacy The birth of a child having Down Syndrome raises issues concerning associated malformations such as congenital heart and digestive malformations as well as hematological anomalies. There is a possibility that the hematological anomalies appear during the first days of life, and it is an issue that is still not sufficiently investigated. Taking into account the above mentioned we present the experience of our Department during 2003Y2006. During this period, 43 out of 25437 newborns recorded were diagnosed with Down Syndrome. Newborn infants suspected of Down Syndrome were investigated using cytogenetic tests and the results confirmed the suspicion. In this study we considered the patients with homogenous trisomy 21, mosaic trisomy 21 and translocation trisomy 21. From the group of newborns with Down Syndrome, 4 neonates presented hematological anomalies, 2 of them with neutrophilia, 1 with transient myeloproliferative disorder and 1 newborn
6th ECC: Abstracts with mild thrombocytopenia at the complete blood count. We agree with the opinion from other studies that the care of neonates with Down syndrome should include awareness of their hematological anomalies since some of them will need proper treatment.
1.60-P
Cytogenetic and molecular analysis of azoospermic and severe oligozoospermic infertile males S. Gunes, R. Asci, N. Kara, F. Alparslan ¨ kten and H. Bagci Pinarli, G. O Ondokuz Mayis University, Medical Faculty, Department of Medical Biology and Genetics, Ondokuz Mayis University, Medical Faculty, Department of Urology Background: Various chromosomal abnormalities including deletions of Y chromosome can cause spermatogenic breakdown resulting in chromosomally derived infertility. This study was designed to identify the frequency of both cytogenetic and submicroscopic interstitial deletions in infertile males with azoospermia or oligozoospermia. Methods: Samples of venous blood were obtained from 75 infertile males with oligozoospermia and azoospermia and 20 fertile men. Karyotyping was performed on peripheral blood lymphocytes (PBL) according to standard methods and 20 G-banded metaphases were analyzed in each case. AZF deletions were detected by multiplex polymerase chain reaction (PCR) using several sequence-tagged site (STS) primer sets within Yq in order to determine Y chromosome microdeletions. The sequence tagged site primers tested in each case were sY84, sY86, sYdist1 (AZFa); sY127, and sY134 (AZFb); sY254 and sY255 (AZFc). The clinical, cytogenetic, endocrinologic and molecular findings of patients were analyzed. Results: Numerical and structural chromosomal abnormalities were detected in 75 infertile cases. The most prevalent sex chromosomal abnormalities were 47,XXY (8%), in six patients whereas a 47,XYY was found in one patient (1.3%). Two of 75 patients showed evidence of sex chromosomal mosaic karyo-
49 type (45,X[23]/46,X,delY[77] and 45,X[45]/ 46,X,delY[55]). Patients with mosaic karyotype had a deletion from sY127 to upto the terminal segment covering AZFbc region. Twenty fertile men and the fathers of two cases with Y chromosome deletions were normal. Conclusion: In the present study, sex chromosomal abnormalities were found in 9 (12%) infertile patients. The frequency of deletion was 2.7%. In conclusion, the occurrence (12%) of chromosomal anomalies among infertile men strongly suggests the need for genetic testing and counseling.
1.61-P
Low ratio mosaic marker chromosomes in prenatal diagnosis T. Yakut, T. Gulten, S. Sag, E. Evke, H. Cangul, S. G. Temel and M. Karkucak Uludag University, Medical Faculty Small supernumerary marker chromosomes (sSMC) are relatively rare in the general population and are problematic, especially for the estimate of a phenotypic effect at prenatal diagnosis. In general, phenotypic risk depends on the morphology, origin and the size of the SMC. Most of sSMC are related with maternal-age and, in many cases, are present in a mosaic form. Here, we present two prenatal cases who had low ratio mosaic marker chromosomes with serious ultrasonographic abnormalities. In the first case, sSMC was detected in two out of 80 metaphase nuclei (2,5%) and the fetus had cystic hygroma and extremity abnormalities which were detected by ultrasound. The pregnancy outcome was intra-uterine exitus at 20th gestational week. In the second case, sSMC was detected in three out of 60 metaphase nuclei (5%) and one of these three metaphases included two marker chromosomes. The fetus had choroid plexus cysts, single umblical artery and ventricular septal defect which were also detected by ultrasound. Both of two mothers were referred because of abnormal ultrasonographic findings. According to the two cases presented here, we suggest that every detected marker chromosome at prenatal diagnosis should be reported in order to
6th ECC: Abstracts
50 supply more data for evaluating a genotype-phenotype association for genetic counselling.
1.62-P
Prenatal diagnosis of a de novo reciprocal translocation in a fetus of twins after intracytoplasmic sperm injection E. Evke, T. Yakut, E. Ergul, T. Gulten, S. Sag, M. Karkucak and A. Sazci Uludag University, Medical Faculty, Kocaeli University, Medical Faculty
mental retardation (7.4% vs. 0.5%), thus emphasizing the importance of screening children in the former group for telomeric rearrangements. Depending on the techniques used, the rate of subtelomeric rearrangements ranges in the literature from 2% to 29%. We present here the results of 52 cases with MCA/ MR, tested for subtelomeric rearrangements by fluorescence in situ hybridisation (FISH), whose karyotypes were normal at the 550Y600 band level. Unbalanced subtelomeric rearrangements were detected in 5 of these cases. Among these abnormalities, 3 were de novo in origin and 2 were the product of familial translocations.
1.64-P
A case with non-mosaic de novo monosomy Xp and trisomy Xq21.2YXqter: paternal in origin 1.63-P
Subtelomeric rearrangements in children with multiple congenital anomalies and mental retardation B. Karaman, H. Kayserili, K. Yilmaz, ¨ ztu¨rk, Z. Demir, N. Kirmizi, H. O M. Apak-Yu¨ksel and S. Bas¸aran Istanbul University, Istanbul Medical Faculty It is well known, that chromosomal unbalanced abnormalities are a cause of multiple congenital anomalies and mental retardation (MCA/MR) in children. The most frequent chromosomal anomalies such as aneuploidies and major structural rearrangements can be diagnosed by routine cytogenetic techniques. However, more sophisticated techniques are required, when the karyotypes are found to be normal by GTG banding analyses in MCA/MR cases. Due to the importance of submicroscopic telomere deletions and/or rearrangements in the etiology of MCA/MR cases, testing for such abnormalities is becoming routine as a part of the diagnostic work-up of these patients. It has been reported that a high rate of chromosome abnormalities was detected among children with moderate to severe mental retardation, whereas a low rate was found in children with mild
K. Yilmaz, B. Karaman, A. Uzumcu, A. Kocbas, N. Kirmizi, Z. Demir, O. Uyguner, H. Kayserili and S. Basaran Istanbul University, Istanbul Medical Faculty Turner Syndrome (TS) is characterized by short stature, gonadal dysgenesis, facial dysmorphism, webbed neck, widely spaced nipples, renal and cardiovascular anomalies. TS can be identified in utero, at birth or before puberty because of the distinctive phenotype. The incidence of TS is reported to be 1:2500Y1:4000 in female live births. The most common chromosomal constitution is 45,X, which is found in about 50% of the cases, while mosaicism and structural anomalies of X and Y chromosome are observed in the rest. It is estimated that 1Y2% of conceptuses have monosomy X, and 99% of these cases end in spontaneous abortion or in utero exitus. In about 70% of cases, the X chromosome is found to be maternal in origin. We present here a case of a derivative X chromosome with TS phenotype. Chromosome analyses by GTG banding revealed a derivative chromosome X. Molecular cytogenetic studies showed a deletion of the whole p arm and duplication of q21.2Y qter of chromosome X. Molecular studies using 15 microsatellite markers pointed out that this de novo chromosomal mutation was paternal in origin.
6th ECC: Abstracts
1.65-P
A further case with pure de novo tandem duplication 12p N. Kirmizi, B. Karaman, H. Kayserili, K. Yilmaz and S. Basaran Istanbul University, Istanbul Medical Faculty Pure trisomy of 12p syndrome is a rare but a welldefined condition with facial features characterized by a round face with prominent cheeks, prominent forehead, broad nasal bridge, long philtrum, reverted lower lip, ear abnormalities, increased birth weight, severe psychomotor retardation and occasional postpartum asphyxia. Additional features of this chromosomal abnormality may include turricephaly, foot deformities, accessory nipples and less frequently, congenital heart defects and anal atresia. We report here a further case with a pure tandem duplicated 12p trisomy. The 14 months old female patient was referred to our department because of multiple congenital anomalies, such as microcephaly, psychosocial mental retardation, growth retardation, bilateral mild hearing loss, diaphragmatic hernia, heart defect. Chromosome analyses on peripheral blood lymphocytes revealed an extra segment on the p arm of chromosome 12. CBG banding showed 2 centromeres. Parental karyotypes were normal. Molecular cytogenetic studies by using wcp 12, centromeric and telomeric probes showed that the extra segment had originated from chromosome 12. The karyotype was 46,XX, 2p + .ish dic(12;12)(12pter Y12cen::12p12.3? Yqter)(wcp12 + , 496A11 + , D12Z3 ++). Phenotype- genotype correlation of pure trisomy of 12 p will be discussed within the frame of recent literature.
1.66-P
The spectrum of abnormalities in child with de grouchy syndrome type 2 S. Ibrulj, S. Heljic and N. Bilalovic School of Medicine, Pediatric Clinic of Clinical Centre of University of Sarajevo, Bosnia and Herzegovina, Department of Clinical Pathology and Cytology of Clinical Centre of University of Sarajevo, Bosnia and Herzegovina
51 De Grouchy syndrome type 2 is a result of deletion of the long arm of chromosome 18, with an estimated prevalence of about 1 in 40,000 live births. The phenotype of this syndrome is highly variable from case to case, depending on the type of deletion and location of the breakpoint. We report a case with a de novo terminal deletion of the18q, karyotype 46, XY, del(18) (q21.3-qter). The newborn was the first child from healthy parents: a 53-year old father and a 41Yyear old mother (the pregnancy had been uncomplicated). The child was male, with birth weight 3300 g, length 51 cm and head circumference 31 cm. We present the spectrum of abnormalities from birth to death (4 months and 7 days of age) of this child and also results of post-mortem examination.
1.67-P
A new case with microduplication 22q11.2 inherited from mosaic father H. Ozturk, B. Karaman, H. Kayserili, K. Yilmaz, M. Apak-Yuksel and S. Basaran Istanbul University, Istanbul Medical Faculty DiGeorge/velocardiofacial syndrome (DG/VCFS) is a common disorder resulting from microdeletion within the 22q11.2 band. Although both deletion and duplication are expected to occur in equal proportions as reciprocal events caused by low-copy repeats mediated rearrangements, very few microduplications have been identified so far. It is suggested that microduplications of this region are relatively common and probably have been underdiagnosed. Interphase fluorescence in situ hybridization (FISH) analysis could be helpful for the detection of microduplication, while routine chromosome analysis can miss this abnormality. We present here a case of microduplication 22q11.2, primarily diagnosed by interphase fluorescence in situ hybridization (FISH). Because of DGS phenotype of the index case, the chromosome analysis by GTG banding on 600-band level and FISH study by using D22S75 probe were done. The karyotype of the patient was normal, however it was remarkable that one of the signals obtained with D22S75 probe was found to be more intense. Thereupon the interphase nuclei were evaluated and three signals were observed for D22S75 probe. GTG banding and interphase FISH study, on peripheral blood lymphocytes of the parents
6th ECC: Abstracts
52 revealed normal results in the mother while the phenotypically normal father was mosaic for microduplication of 22q11.2. To our knowledge, there are 9 familial cases with this abnormality in the literature and mosaicism was reported only in single case. This case further supports the importance of interphase FISH study in cases with genomic disorders where no deletion was observed on chromosomes.
1.69-P
Partial trisomy 16 and genitourinary anomalies L. Martelli, W. R. S. Baratelo, J. A. Squire, C. C. Rebelo, L. A. F. Laureano, J. Huber and E. S. Ramos University of Sao Paulo, University of Toronto
1.68-P
Failure of ovarian development associated with del9p24 L. Telvi, C. Bouvatier, M. Minz and P. Bougneres Cytogenetics Laboratory, Department of Pediatric Endocrinology Monosomy of distal 9p is often associated with male to female sex reversal. It has been suggested that a sex-determining gene(s) escaping epigenetic imprinting resides in the 9p monosomic region common to sex-reversed patients, and that loss of the sexdetermining gene(s) results in a wide range of sex reversal. We have reported a case with failure of testicular development associated with a rearrangement of 9p24.1 proximal to SNF2 gene (Hum Genet, 1998, Ion et al.) Raymond et al. (1999) identified a sex determining gene with a novel DNA-binding domain (DM domain) DMRT1 mapped to 9p24.3 distal to D9S1779. In mammals, DMRT1 is expressed exclusively in the genital ridge before gonadal determination and shows a testis-dominant expression with gonadal sex development. Furthermore, Raymond et al. identified a second DM domain gene, DMRT2 expressed in adult testes, and mapped it to 9p24.3 distal toD9S1779. These findings argue that DMRT1 and DMRT2 represent excellent candidates for sex determining gene(s) on 9p. We report a female case monosomic for 9p24 segment, presenting normal external genitalia and incomplete development of ovaries, with a hypogonadotrophic hypogonadism. We suggest that the gene(s) mapped to 9p24 represent excellent candidates gene(s) not only involved in male gonadal development but also in female gonadal development.
Trisomy 16 is the most common autosomal trisomy in spontaneous abortions. The small number of live births reported are mosaic with multiple malformations. The proband was born to a 35 year-old G2P0 woman at 35 weeks gestation after an uncomplicated pregnancy. Prenatal ultrasound revealed intrauterine growth restriction. He was delivered by cesarean section due to fetal distress, weight 1270 g, head circumference 29 cm, Apgar scores 3 and 7. The physical examination showed macrocephaly, systolic murmur (3 + /6) without facial dysmorphic features, ambiguous genitalia described as reduced phallus, penoscrotal hypospadia, bifid scrotum, with one palpable gonad. The echocardiogram was compatible with Tetralogy of Fallot. The CT scan of the brain demonstrated bilateral ventricles dilatation and occipital extra dural hematoma. Abdominal ultrasound was normal and vesicoureteral reflux was diagnosed by cystography. Endocrynologic evaluation with full hormone pathways tests suggested bilateral functional testicles. Cytogenetic analysis of 100 metaphases by GTG banding showed 47,XY chromosomes with a marker chromosome in all cells. Parental chromosome analysis showed that the patient´s mother carried a 46,XX, t(15;16)(p11;p12) balanced translocation. Fluorescence in situ hybridization studies and spectral karyotype (SKY) confirmed the cytogenetic diagnosis 47,XY, + der(16) t(15;16)(p11;p12)mat. At 6 months of age the proband has failure to thrive with significant developmental delay. The identification and characterization of patients who have inherited chromosomal rearrangements may help to clarify the genomic origin and molecular consequences of partial trisomies. Our study demonstrates the efficiency of the molecular cytogenetic techniques in the analysis of marker chromosomes and expands the phenotypic presentation of chromosome 16 trisomy. Supported by CAPES/PROEX and FAEPA, HCFMRP.
6th ECC: Abstracts
1.70-P
A case with 46,dup(xp) associated with mental retardation and hypoplastic external genitalia C. Bellesme, L. Telvi, M. Minz, J. M. Dupont and P. Bougneres Department of Pediatric Endocrinology, Cytogenetics Laboratory An unusual familial case of a partial duplication of distal Xp is described. The proband, a 6 year-old boy, showed mental retardation, dysmorphic features, multiple congenital abnormalities and hypoplastic external genitalia. The karyotype showed a dir dup(X)(p21.3p22.32)(RHG)(RTBG) chromosome complement. The phenotypically normal mother showed the same X chromosome anomaly. FISH analysis with different probes indicated that the duplicated sequences are located between p21.3 and p22.32. In 1996, we described another subject with a duplication of distal Xp chromosome. The breakpoints were 22.11 and 22.32. However, the two phenotypes are quite different. The relationship and the differences between these two cases and the interest of this kind of duplication is discussed.
1.71-P
Prenatal diagnosis of a fetus with de novo reciprocal translocation t(1;12)(q21.3;p11.2) and trisomy 21 S. Sag, T. Yakut, T. Gulten and E. Evke Uludag University, Medical Faculty De novo balanced translocations observed in very low frequency in newborns can be cytogenetically detected at amniocentesis. Meiotic repair errors that can play a role in the continuous cell division may contribute to chromosomal rearrangements in gametogenesis throughout the reproductive process. Some studies suggest a positive correlation between germ cell fragile site breakpoints and sites of balanced chromosome de novo rearrangements in sperm. Although it is a controversial subject, an increased incidence of a chromosome aneuploidy in the fetus
53 can be the result of a possible interchromosomal effect (ICE), associated with the presence of constitutional rearrangements or the abnormal segregation of other chromosome pairs that cause an increase of aneuploidy in the gametes. In our case, a de novo reciprocal translocation t(1;12)(q21.3;p11.2) and trisomy 21 were detected after amniocentesis done because of increased risk of triple screening test. Cytogenetic analysis of peripheral blood lymphocyte culture of the parent did not show any chromosomal abnormalities. According to our case, we speculate that both possible mechanisms such as germ cell breakpoints and ICE could play role in the occurrence of de novo translocation and aneuploidy.
1.72-P
Mosaicism and skewed inactivation of X-chromosome: its possible correlation to recurrent spontaneous abortions M. Gutierrez-Serrano, D. Diego Alvarez, M. Rodriguez de Alba, R. Cardero-Merlo, F. Infantes, C. Ramos, J. Plaza-Arranz and I. Lorda-Sanchez Genetics Service - Fundacio´n Jime´nez Dı´az - Capio CIBERER, G, G, G, Obstetrics and Gynaecology Service - Fundacio´n Jime´nez Dı´az - Capio Recurrent spontaneous abortion (RSA) occurs in 2Y5% of couples wishing to have children. The causes of RSA are heterogeneous and remain unknown in many cases. X-chromosome mosaicism has been associated with abnormal reproductive outcomes, such as RSA, primary or secondary amenorrhea, infertility and premature ovarian failure. Recently, skewed X-chromosome inactivation has also been described as a frequent event in women suffering RSA, which would suggest the possible presence of X-linked mutations that may be lethal to hemizygous male embryos. In order to investigate whether both X-chromosome anomalies are related to RSA, we have studied 100 women who have experienced at least two miscarriages. Blood samples for cytogenetic and DNA studies were obtained and processed as usually. The X-chromosome mosaicism was studied on cultured lymphocytes by FISH with a
6th ECC: Abstracts
54 centromeric X-chromosome probe (DXZ1). Two hundred interphase nuclei were examined per patient. The X-chromosome inactivation status was assessed by a methylation-specific PCR assay performed on the AR gene (Xq11-q12), where methylation at this locus correlates with X-inactivation. The results of both studies were analysed according to maternal age, abortion rate and karyotype of the abortions in those cases in which a chromosomal analysis had been done.
1.73-P
A two generation evaluation of x;3 translocation. Case report and review of the literature M. Minz, L. Telvi, L. Lohmann, C. Nathan, S. Adjiman, C. Bouvatier and P. Clement Cytogenetics Laboratory, Hopital St Vincent de Paul, Paris, Clement Laboratory, LeBlanc Mesnil, Gynecologist, Paris, Department of Pediatric Endocrinology, Hopital St Vincent de Paul, Paris We report a two-generation transmission of a balanced X;3 translocation. The male proband showed a 46,Y,t(X;3)(q22;q11.2) chromosome complement inherited from his phenotypically normal mother. The pregnancy of the mother had occurred when she was 19 years old. After that she had only one spontaneous abortion. The male proband showed small testis, azoospermia and gonadal dysgenesis with elevated levels of FSH and LH and low levels of inhibin and testosterone. We compare this case to those reported in the literature to date.
1.74-P
Two cases of unusual aberrations of chromosome Nr. 4 D. Novotna, T. Marikova, M. Malikova, J. Jichova, M. Palanova, Z. Vlckova, E. Kocarek, M. Havlovicova, V. Harmas and Z. Zemanova Department of Biology and Medical Genetics, University Hospital Motol, Prague, Dept. of Medical Genetics, Masaryk´s Hospital, Usti nad Labem, Oncocytogenetics Centre, Institute of Biochemistry
and Laboratory Diagnostics, General University Hospital and 1st Faculty of Medicine Charles University, Prague 1) 46,XY,der(4)invdup(4)(p15.2p16.3) A 7-weeks old boy was referred by a neurologist for genetic examination for caudal regression syndrome. There were hypoplastic lower limbs, club feet, sacral agenesis, spina bifida. Facial dysmorphy was observed: broad nasal base, hypertelorism, large nose, gothic palate, low set ears. Hearing impairment, bilateral atrophy of both optic papillae and psychomotoric retardation were found. G-banded chromosomes revealed an inverted partial duplication of the short arm of chromosome 4p. The presence of extra material of chromosome 4 was confirmed by SKY and duplication of the Wolf-Hirschorn region and deletion of the subtelomeric region 4p were assessed by locus specific probes. 2) 46,XX,del(4)(q26q26) in a child due to 46,XY,ins(3;4)(p21.3;q26) in the father The girl was born at term to young healthy parents. During the pregnancy the mother underwent amniocentesis for positive triple test screening, with normal chromosomal result. In her 3rd month the baby was hospitalised at a pediatric clinic for feeding problems. The Clinical geneticist observed only mild stigmatisation and developmental retardation. Cytogenetic examination demonstrated a small interstitial deletion on 4q. In the father_s karyotype the deleted band appeared to be inserted into 3p. The aberration was confirmed by MFISH and Mband. Supported by grant of Health Ministry of Czech Republic Nr 00064203.
1.75-P
Terminal deletion of chromosome 18q in apatient with multiple congenital malformations including mental retardation V. Sˇliuzˇas, L. Cimbalistiene˙ and V. Kucˇinskas Vilnius University Deletion of chromosome 18q is one of the most common chromosome aberrations; the size of the deletion varies in many described cases. The phenotypes of the patients are also variable even with approximately the same deletion size. We are presenting a patient with a terminal deletion of of the long
6th ECC: Abstracts arm of chromosome 18. The proband, a girl, was investigated shortly after birth because of multiple congenital malformations including cleft palate, bilateral talipes, congenital dislocation of the hip, short fourth fingers, facial dysmorphism (epicanthic folds, narrow palpebral fissures). Subsequently chronic bilateral neuritis cochlearis with a partial hearing loss and mental retardation were diagnosed. Terminal deletion of chromosome 18 long arm was detected during conventional karyotyping of GTG banded chromosomes. The karyotypes of the parents were found to be normal whereas a brother had the karyotype 47,XXY. The deletion was specified by FISH, CGH and 1Mb resolution array-CGH. CGH confirmed a terminal deletion of chromosome 18, The final karyotype was 46,XX,del(18)(q21.32). Array CGH specified the deletion to be 19 Mb in length. The deletion was also confirmed by FISH with custom made FISH BAC clone probes on interphase nuclei. The most proximal deleted clone was RP11-26L3. Most of the chromosome breaks of reported cases of terminal deletion of chromosome 18q are located in region q21Yq22. Probably fetuses with larger deletion are not likely to survive. With the pattern of minor and major anomalies, the present patient fits well into the clinical pattern of the 18q- syndrome.
1.76-P
Severe clinical manifestations with inv(3) (p24p13)dn in a girl K. Karaer, A. Koc, M. A. Ergun and E. F. Percin Gazi University Faculty of Medicine, Department of Medical Genetic Inversion of the short arm of chromosome 3 is a rare event with severe clinical consequences. Here we report a 2 year old girl that was the second child of non-consanguineous Turkish parents. The patient,one of a twin born by cesarean section at 30 weeks, was referred to our clinic due to facial dysmorfic features and congenital anomalies. On physical exam; her weight was 11 kg (50thY75th centile), her height was 81 cm (50thY75th centile) and her head circumference was 45.5 cm (3thY10th centile). She had an asymetric face with bitemporal sparse hair, sparse eyebrows, long eyelashes, upslanting palpebral fissures, hyper-
55 telorism, dysplastic ears with uplifted ear lobules, full cheeks, asymetric nasal tip, high arched palate and retrognathia. She also had a narrow thorax, bilaterally pterygium over the elbows and knees, bilaterally pes equinovarus and bilateral coronal and lambdoid synostosis. Chromosome analysis of the patient’s peripheral blood lymphocytes by conventional GTG banding demonstrated an inversion on the short arm of chromosome 3 (46,XX,inv(3)(p24p13)dn). As the parental karyotyping revealed normal chromosomes, this chromosomal rearrangement was evaluated as denovo inversion of chromosome 3p. We discuss the relationship between the multiple anomalies in the patient and the chromosomal rearrangement.
1.77-P
Phenotype-genotype correlation in female gonadal dysgenesis I. R. Hussein, S. Temtamy, A. Kamal, I. Mazen, M. Mekkawy, N. Hassanein and S. Ismail National Research Centre, Alexandria University Objective: To study the spectrum of chromosomal anomalies as related to the phenotypic variability of patients with gonadal dysgenesis, - Detection of cryptic Y-chromosome mosaicism. Subjects & Methods: The study included 70 female patients presented with short stature, delayed puberty or primary amenorrhea. Patients were referred to the out patient genetics clinic, NRC, for diagnosis and genetic counseling.Their ages ranged between 15 days to 31 years (mean = 14.1 + 6 years). Complete clinical assessment, hormonal studies, ultrasonic evaluation was done for all cases. Presence of congenital anomalies was calculated as score of somatic features. Cytogenetic studies were done using GTG-banding technique, PCR amplification of SRY gene was done for detection of Y chromosome sequence. Results: Results of Karyotypes were: group I: 45,X (24 cases) 34%; gp.2: 46,X i (Xq)(7.1%); gp.3: mosaic 45,X/ 46, X i (Xq)(10%); gp.4: mosaic 45,X/ 46, XX 11.4%); gp.5: 45,X + marker, (10%); gp. 6&7: X-structural abnormality (14.3%).gp.8: 46, XY (4.3%);gp.9: 46, XX (8.6%). Mean somatic
6th ECC: Abstracts
56 features score was higher in group 1, 2, 3, 5 than other groups (pG0.001). Short stature was more observed in group 1, 2, 3, 4, 5 than other groups (PG0.001), while delayed puberty was the main feature in group 8 & 9. Skeletal anomalies were mainly observed in group 1, 2, 3, 5. Neck webbing and other soft tissue anomalies were mainly observed in 45, X group. Gonadal biopsy from 6 patients revealed gonadoblastoma in one case, others showed streak gonads. PCR amplification of SRY gene was positive in 8/35 patients, three had marker chromosome and 5 confirmed presence of Y chromosome. All cases with 45,X karyotpe showed negative results. Conclusion: Highest score of abnormal somatic features was observed in patients with 45, X cell line and iso Xq or marker chromosome. There was no cryptic Y mosaicism in peripheral blood of 45, X patients, however, the presence of Y chromosome sequence could not be excluded, especially in gonadal tissue.
patient. Surprising, we found a normal karyotype in both parents. Thus, we established that both translocation present in our patient occurred de novo, followed by 3:1 disjunction. Unfortunatelly, we cannot determine the parental origin of translocation. However, on cytogenetic data we estimate that the risk of parents to have another child with Down syndrome is about 1%.
1.79-P
Results of cytogenetic and molecular screening in patients with non-obstructive azoospermia: 7 years experience M. Yesil, C. Beyazyurek, B. Umay, A. Ozden, Y. Sabuncuoglu, H. Karadayi, Y. Saglam, S. Ozkan and S. Kahraman Istanbul Memorial Hospital
1.78-P
Two de novo chromosomal translocation t(1;2) and t (3;21) in a patient with Down syndrome Y presentation of case V. Gorduza, M. Gramescu, C. Rusu and M. Covic University of Medicine and Pharmacy Down syndrome (DS) is a chromosome aberration caused by an additional 21 chromosome. Cytogenetic studies indicate that Down syndrome can be caused in majority of cases by a homogenous free 21 trisomy, mosaicism 21 trisomy or 21 trisomy by Robertsonian translocation. Only few cases were produce by partial 21 trisomy or 21 trisomy by unbalanced reciprocal translocations. We describe a special case of DS. Our patient, presenting the entire clinical spectrum of DS, was investigated cytogenetically, and we discovered a special chromosomal formula: 47,XY,t(1;2)(p32;q37),-3,+der(3)rcp(3;21) (p11.1;q22.2),+der(21)rcp(3;21)(p11.1;q22.2). The presence of two apparently, balanced translocations, led to chromosomal analysis in both parents of our
Introduction: In approximately 50% of infertile couples the reason lies in the male partner. While the incidence of azoospermia is 1% in all men, the incidence goes up to 15% among infertile men. NonObstructive Azoospermic (NOA) patients require surgical attempts such as microscopic Testicular Sperm Extraction (micro-TESE) to recover sperm and have high probability of carrying numerical and structural chromosomal abnormalities among other infertile men. Materials & Methods: 1062 NOA patients who attended our clinic between 2000Y2006 were evaluated in this study. Patients were analyzed by both conventional cytogenetic and molecular methods. Karyotyping was performed by GTG banding and the screening of AZFa,b,c and SRY regions were performed by multiplex fluorescent polymerase chain reaction (mf-PCR). Results; The incidence of chromosomal abnormalities was found to be 18.2%. Among these abnormalities, gonosomal abnormalities especially Klinefelter syndrome (KFS) was the most prevalent abnormality (66% for pure and 4% for mosaic KFS). Less frequent gonosomal abnormalities included 46,X, idic(Yp), 46,XX males, 47,XYY and 45,X/ 46,XY mosaics. Translocations,inversions,marker chromosomes and ring chromosomes were found in
6th ECC: Abstracts 8%, 2.6%, 1% and 0.5% respectively. The incidence of Y microdeletions was found to be 11.6% of NOA patients. Deletions of AZFa, AZFb and AZFc were found in 2,3,49 patients, respectively. Deletions of AZFa,b and c regions were present in 20 patients, and 26 patients had AZFb and AZFc deletions. On the other hand, 2.6% of Y microdeletion cases carried also a chromosomal abnormality. In summary, the chance of finding an abnormality is as high as 25.5% in the NOA group. Conclusions: The high number of abnormalities found is not surprising since the centre mostly deals with patients with severe male infertility. However, these high rates of both chromosome abnormalities and Y microdeletions in men with NOA suggest the need for careful cytogenetic and molecular analysis before initiating an ART cycle.
1.80-P
Application of assisted reproductive techniques in patients with Klinefelter_s syndrome Y. Sabuncuoglu, M. Yesil, C. Beyazyurek, A. Ozden, Y. Saglam, S. Ozkan, B. Umay, H. Karadayi, H. Yelke and S. Kahraman Istanbul Memorial Hospital
Introduction: The incidence of Klinefelter_s syndrome (KFS) is 3% among infertile males and nearly 11% among azoospermic patients. These patients mostly require microscopic Testicular Sperm Extraction (micro-TESE) operation otherwise they are mosaics. This study includes retrospective analysis of Assisted Reproductive Techniques (ART) results of mosaic and non-mosaic KFS. Materials & Methods: Between the years 2000 and 2006, a total of 149 patients who were found to have either non-mosaic (pure) or mosaic KFS first were carefully examined by an andrologist and their karyotype analyses were performed by using GTGbanding techniques. 2 pure KFS patients had already been referred with abnormal karyotypes to our centre for ART cycles. According to cytogenetic analysis,
57 129 patients were pure and the remaining 15 were mosaic and 3 had isochromosome Xq (47,X,i(Xq)Y). Results: 80 out of 149 patients underwent 96 cycles. In 7 cases with mosaicism, patients gave ejaculate sperm for Intra Cytoplasmic Sperm Injection (ICSI). The remaining 73 patients underwent micro-TESE operation but 36 revealed total absence of sperm. 55 cycles reached embryo transfer with either frozen or fresh sperms recovered in microTESE. An average of 2.5 embryos was transferred to female partners. Totally, 22 pregnancies (40%) were achieved. However, none of the mosaic couples had a pregnancy. To date, 12 babies from single pregnancies, 8 babies from twin pregnancies, and 3 babies from triplet pregnancies were born. 9 were missed with one of them carrying Turner_s syndrome (45,X). In total, 23 healthy babies were born with normal karyotypes. Conclusion: ART techniques such as micro-TESE and ICSI are useful tools for KFS patients. If KFS patients have gonadal mosaicism in their gonads carrying normal cell lines as well as mosaic ones, have higher chances of getting sperm in micro-TESE operations. Data show that KFS patients can have high pregnancy rates compared to other infertile groups, and may have healthy babies with normal karyotypes.
1.81-P
Array-CGH analysis and clinical description of two patients with interstitial deletions of chromosome 4 A. Polstra, A. N. Mul, M. L. M. Berens, M. C. van Maarle, T. A. M. Van Os and J. M. Hoovers Amsterdam Medical Center Several deletions of chromosome 4p have been described in the literature. The most well known is the terminal deletion of the 4p16 region, resulting in Wolf-Hirschhorn syndrome (WHS). Interstitial deletions of chromosome 4p are more unusual and less frequently described. They are associated with
6th ECC: Abstracts
58 variable manifestations including mental retardation, unusual facial appearance, and minor limb abnormalities. Since variable breakpoints have been reported high resolution genome analysis is necessary for a reliable genotype-fenotype correlation. We therefore developed a BAC microarray for the short arm of chromosome 4 to further refine the breakpoints and the size of the deletion. Here we report on two cases with an interstitial deletion of chromosome 4p. The first patient is a 52-year old, mentally retarded woman with ptosis, a tall and thin habitus, a long face, large thin nose and a small high palate. The second patient is a 14-year old mentally retarded girl with ptosis, oblong face, high palate, and a pointy tongue with dark discolorations. The results of the microarray-CGH and FISH validation will be presented. These cases contribute further data to the phenotypes associated with 4p deletions.
D15Z1 and SNRPN probes showed the SMC to be dicentric with four copies of SNRPN. Thus the karyotype is interpreted as 47,XY,+mar.ish der(15) (D15Z1x2; SNRPNx4; D15S10x4)[41]/46,XY[9]. As far as we are aware this is the third patient reported to be hexasomic for the proximal 15q11q13 region. Ito hypomelanosis is sporadic and is not a syndrome but rather a non-specific expression of chromosomal mosaicism. One of the two previously described cases is also associated with a skin pigmentary dysplasia. The abnormal phenotype in patients carrying a large SMC (15) is highly variable; however, the phenotype associated with tetrasomy of the Prader-Willi/Angelman syndrome critical region (PWACR) is more severe than in patients with duplication. Parental origin and delimitation of quadriduplicated region are being defined in this patient.
1.82-P
Hexasomy of the Prader-Willi/ Angelman syndrome critical region in a patient with severe phenotype and Ito hypomelanosis M. Chaabouni, L. Kraoua, M. Lelorc’h, I. Chelly, L. Ben Jemaa, I. Ouertani, F. Maazoul, R. Mrad and H. Chaabouni Department of Congenital and Hereditary Disorders Charles Nicolle hospital Tunis; Human Genetics Laboratory Faculte´ de medicine Tunis, Service de cytoge´ne´tique, Hopital Necker-Enfants-Malades. Paris. France, Human Genetics Laboratory. Faculte´ de medicine. Tunis. Tunisia Supernumerary marker chromosome (SMC) 15 also referred to as inv dup(15), is the most common accounting for up to 50% of all SMCs. We report a 13-years old male patient presenting with mental retardation, epilepsy, behavioural problems, dysmorphism (long face, prominent upper lip, and short philtrum), scoliosis, hypospadias and hypomelanosis of Ito. Standard karyotype from peripheral blood lymphocytes identified a unique supernumerary marker chromosome in 83% of the cells. FISH using
1.83-P
Live births after recurrent miscarriage and parental karyotype N. Navali University of Medical Science Background: This study is a retrospective comparative study in a university hospital setting to compare the subsequent live birth rate in recurrently miscarrying women with and without parental balanced chromosomal aberrations. Materials and methods: This study is carried out on 102 patients with three to eight miscarriages: 11 patients with and 91 patients without chromosomal aberrations. Result(s): Of the 102 patients, 72 subsequently conceived, 8 (72.7%) with parental chromosomal aberrations and 64(70.3%) without aberrations. In patients with and without chromosomal aberrations, 4 out of 8 pregnancies (50%) and 51 out of 94 pregnancies (54.2%), respectively, resulted in live births. The difference is not statistically significant. The prevalence of aberrations was not related to the number of previous miscarriages. Inversions, translocations,
6th ECC: Abstracts and mosaicism were followed by a similar live birth rate. Conclusion(s): Patients with parental chromosomal rearrangements have a slightly lower live birth rate than patients without aberrations. Parental karyotyping may not be a good predictor of the outcome of subsequent pregnancies.
59 gnathia, low-set ears, fingers abnormalities and renal malformations. The development of pregnancy is characterized by severe intra-uterine growth retardation, progressive anamnios and late fetal death.
1.85-P 1.84-P
Familial T(12;21) followed through four generations
Second case of long-term development of fetal trisomy 10: ultrasound, clinical and cytogenetics findings
S. Oztas, Abdulgani Tatar, Ahmet Yesilyurt, Zeynep Ocak and Bunyamin Borekci
D. Sanlaville, P. Roth, C. Schluth, K. Birollaud, A. Buenerd, M. Till, R. Bouvier, P. Gaucherand and P. Edery Service de Cytoge´ne´tique Constitutionnelle, Hospices Civils de Lyon, France, Service de Gyne´cologieObste´ trique Hospices Civils de Lyon, France, Service de Foetopathologie, Hospices Civils de Lyon, Lyon, France We report on a fetus presenting at first trimester sonography with nuchal translucency, generalized edema, congenital heart defect, facial cleft and bilateral club-foot. CVS was performed and revealed homogeneous trisomy 10 on both direct and culture analyses. Despite a poor prognosis the parents wished to continue the pregnancy. The development of the pregnancy was characterized by progressive anamnios and severe intra-uterine growth retardation. Intrauterine fetal death occurred at 31 weeks_ gestation and a male fetus was delivered. Besides features present at sonography, external examination showed microcephaly, imperforate anus, kyphoscoliosis and high-set thumb. Fetal blood karyotype confirmed trisomy 10 on all cells examined. Homogeneous trisomy 10 is a very rare and always lethal aneuploidy. Only 3 cases have been reported to date, two at 12 weeks_ gestation and one at 34 week_s gestation. Present observation supports previous clinical findings and brings a second description of long-term development of trisomy 10 pregnancy. Trisomy 10 phenotype can be recognized as early as 12 week_s gestation by sonography on the basis of nuchal and generalized edema, congenital heart defect, facial cleft and clubfoot. Other features include micro-
Ataturk University, School of Medicine Translocation 12;21 detected in a woman with history of habitual abortion was investigated through four generations. T(12;21) is a rare chromosomal aberration, and in the reported cases, the chromosomal break points were different from each other. The reported cases had a history of fetal losses or a dysmorphic baby. A 7 year married couple was referred to the genetic department due to a history of 3 miscarriages at the first trimester. They had a 6 years old healthy son. In both patients, physical examination and hormonal, biochemical and hematological tests were also normal. Cytogenetic analyses performed by using conventional peripheral blood culture methods revealed a 46, XX, t(12;21)(p13;q13) karyotype in the female patient and translocation carriers through four generations. The man had a normal 46,XY karyotype. In the four generations, there were histories of fetal losses but no dysmorphic baby. Therefore, we suggested that partial trisomic or monosomic fetuses arising from the balanced translocation in parent might result in an abortion. However, four children of a couple in the second generation had died of unknown causes during the first year after birth.
1.86-P
Translocation (X;2) in a patient with premature ovarian failure Z. Ocak, Abdulgani Tatar, Ahmet Yesilyurt and Sitki Oztas Ataturk University, School of Medicine
6th ECC: Abstracts
60 Premature ovarian failure (POF) is a rare clinical condition with periods of 4Y6 months amenorrhea before the age of 40 and two or more of elevated FSH levels (Q40 IU/L) detected in one month. Its prevalence is about 1Y2% of women. Premature ovarian failure may have genetic, enzymatic, iatrogenic, autoimmune, or infectious etiology. A 35 years old woman was referred with a history of secondary amenorrhea. She had attained the menarche at the age of 11 years and had always had irregular periods. Physical examination was normal, and she had normal secondary sexual characteristics. An ultrasound scan of the pelvis showed a normal uterus and ovaries. Her plasma prolactin was 6,43 ng/mL, follicle stimulating hormone was 53 mIU/L, luteinising hormone was 42.2 mIU/L and oestradiol was 32 pg/mL. Cytogenetic analyses were performed by using conventional peripheral blood culture methods. A 46,X,t(X;2) (q21.2;pter) karyotype was detected in 30 metaphases. Chromosomal rearrangements including in Xq are frequently associated with premature ovarian failure. The Xq21 is a gene-poor region, and it was defined as a POF critical region. The cytogenetic and clinical findings in this patient are consistent with cases reported in the literature and support the relationship between this critical region and POF.
1.87-P
De novo inverted interstitial duplication 8q22.1Y Y q21.1 in a boy with moderate mental retardation, mild autistic and dysmorphic features C. Sarri, Yolanda Gyftodimou, Gerasimos Kolaitis, Maria Grigoriadou, Katerina Papanikolaou, Elena Paliokosta, John Tsiantis and Michael B. Petersen Institute of Child Health, Depart. of Child Psychiatry We describe a 13 1/2-year-old boy with de novo inverted interstitial duplication 8q22.1Yq21.1 associated with mild phenotypic abnormalities, moderate mental retardation and autistic features. Although partial trisomy for other segments of 8q, as well as mosaic trisomy 8, has
been described in numerous cases, interstitial duplication of 8q21Yq22 seems extremely rare.
1.88-P
Subtelomeric monosomy 6p and trisomy 22q13.3 in a dysmorphic and mentally retarded boy K. Kuuse, P. Tammur, R. Zordania ˜ unap and K. O Tartu University Hospital, Tallinn Childrens Hospital We report an 18-month-old boy who was referred to genetic counselling due to developmental delay, hypotonia and failure to thrive. He is the third child born to healthy unrelated parents at term with birth weight 3900 g (+1SD), length 55cm (+1.5SD) and head circumference 38 cm (+2SD). Muscular hypotonia and developmental delay was noticed at 3Y4 months of age. Clinical investigation at the age of 1 year: hypotonia, dysmorphic face, cardiac anomaly. Brain MRT investigation showed corpus callosum hypoplasia and remarkable white matter abnormality. Cytogenetic investigations: Standard karyotype was normal 46,XY, but FISH analysis with DiGeorge/ VCFS Region Probe (Cytocell,UK) showed three signals of 22q13.3 control probe, one of them located on 6p telomeric region. Subsequent FISH analysis with 6p subtelomere specific probe (Cytocell,UK) demonstrated the absence of 6ptel signal on the aberrant 6. chromosome. His mother has normal chromosomes, father has not been studied yet. Clinical evaluation at the age of 1.5 years revealed dysmorphic face, muscular hypotony and genital abnormality. His behavior is autistic, motor and speech development delayed. Ophthalmologically there were no remarkable changes at the moment. Subtelomeric 6p deletion syndrome is shown to have a distinct phenotype including ocular developmental anomalies and white matter abnormalities on MRI while the phenotype caused due to dup 22q13.3 is relatively mild and not so well defined. Further molecular studies are needed to ascertain the size of the deletion on 6p in this case.
6th ECC: Abstracts
1.89-P
Extremely skewed X-chromosome inactivation in a male patient with 46,XY,der(19)t(X;19) (q11.1Y11.2;P13.3)
61 These results have the potential to shed light on the spread of the X-inactivation signal to an autosomal chromosome, and supports the finding that genomic DNA sequence on human X chromosome influence the spread of the inactivation process. Supported by grants from TUBITAK-SBAG 3334, ICGEB-CRP/ TUR04-01.
S. Balci, E. Uz, O. Engiz, T. Liehr and T. Ozcelik Hacettepe University, Ihsan Dogramaci Children_s Hospital, Department of Medical Genetics, Ankara, Turkey, Bilkent University, Faculty of Science, Department of Molecular Biology and Genetics, Ankara, Turkey, Institute of Human Genetics and Anthropology, Jena, Germany X-chromosome inactivation (XCI) is an epigenetic regulation on gene expression. Molecular studies of X;autosome translocations in humans have contributed significantly to our understanding of the mechanisms involved in XCI, and also to identify X-linked diseases. Here we report a male patient with 46,XY,der(19)t(X;19)(q11.1Y11.2;P13.3) karyotype and extremely skewed XCI. He was diagnosed with bilateral periventricular nodular heterotopia, severe learning disability and epilepsy, and Klinefelter syndrome was clinically suspected. A detailed description is reported elsewhere (Balci et al. 2007 Dev Med Child Neurol 49: 219Y224). Genomic DNA isolated from peripheral blood was obtained from the patient, his 46,XX sister, and his 46,XX,t(X;19) (q11.1Y11.2;p13.3) mother. To determine X-inactivation status, androgen receptor locus was analyzed by methylation sensitive HpaII digestion followed by PCR. Complete skewing of X-inactivation was observed in both the patient and the mother, whereas a random pattern was apparent in the sister. Interestingly, the androgen receptor allele representing the inactive X was maternally inherited in the patient, but it was different from the inactive allele in the mother. Fluorescence in situ hybridization (FISH) assay revealed that the der(19) included the XIST region. These results have been interpreted as a selection process following random X-inactivation, which ultimately results in a Bloss of mosaicism^ event with respect to X-linked gene expression in both the mother and the patient. The normal X-chromosome appears silent in the mother as expected, and the der(19) which contains almost the entire long arm of the X chromosome appears silent in the patients.
1.90-P
Dicentric chromosome 22 causing partial trisomy of 22q10Yq13 in a child with Cat Eye syndrome phenotype Z. Demir, B. Karaman, H. Kayserili, M. Apak-Yuksel and S. Basaran Istanbul University, Istanbul Medical Faculty Cat eye syndrome (CES), which is usually associated with a supernumerary bisatellited marker chromosome containing material of 22q11.2, which causes tetrasomy of this region in the genome, may have variable phenotypic expression. A few cases of interstitial duplication of 22q11.2 have been also reported to cause CES phenotype. We report here a mother with no apparent phenotypic features and her 5 years old son with a CES phenotype with partial duplication of 22q11Yq13?. Chromosome analysis of the son was carried out because of facial dysmorphism and congenital multiple anomalies. Primary clinical diagnosis of him pointed out Cat eye syndrome due to typical findings like microphtalmia, preauricular pits, choroid coloboma, microcornea, micrognathia, bilateral cryptorchidism, bilateral hydroureteronephrosis, floppy mitral valve. Chromosome analysis of the patient on peripheral blood lymphocytes by using GTG banding revealed an extra segment on the short arm of the chromosome 22. CBG banding showed 2 centromeric regions and in between negative stained segment. Satellites were located on the p terminal region according to the NOR staining. Parental investigation showed normal karyotype in the father while indicating the Bsame^ aberrant chromosome 22 in the mother. Detailed clinical interview with the mother informed that she had a surgical operation due to vesicoureteral reflux, at the age of 19. FISH study by using wcp 22 showed
6th ECC: Abstracts
62 that this extra segment originated from chromosome 22. DGS probe (D22S75) was used to identify the breakpoints on chromosome 22. The signal for q11.2 was seen on the extra segment of chromosome 22 additionally to the normal signal. To our knowledge, 6 cases with partial or full phenotype of CES associated with an interstitial duplication of 22q11.2 have been reported. Our case is interesting because of major features of CES and the presence of a dicentric structure of the derivative chromosome 22, which has not been reported before.
1.91-P
Deletion of 8p: a case of a child with multiple congenital anomalies M. E. Ay, O. I˙zci Ay, F. Soylemez and M. E. Erdal Mersin University, Faculty of Medicine Deletions of the proximal part of 8p (8p11 to 8p21) are typically associated with congenital spherocytosis, which is most the common of hereditary hemolytic anemias. Genes for ankyrin and glutathione reductase (GSR) were localized to chromosome bands 8p11 and 8p21, respectively. Also associated with the deletion of the short arm of chromosome 8 are postnatal growth retardation, microcephaly, subnormal mentality, epicanthal folds, malformed ears, brevicollis, widely spread nipples, heart defects, and other abnormalities. Individals with 8p- are reported to share a distinctive pattern of clinical features. This has led several authors to propose a distinct 8p deletion syndrome phenotype.(Dobyns et al. 1985, Qstergaard and Tommerup 1989, Pecile et al. 1990, Claeys et al. 1997) We describe a 8 monthold boy with multiple congenital anomalies (microcephaly, cleft lip and palate, clinodactyly, micropenis etc.) with spherocytic anemia. Analysis of conventional G-banded metaphase chromosomes from short term lymphocyte cultures of the patient showed a small interstitial deletion on the short arm of chromosome 8: 46.XY,del(p11p21) Both parents had normal karyotypes. Prior reports of 8p deletions have shown mostly to be de novo mutations. In the future, Fluorescence in situ hybridisation will be performed with whole chromosome 8 painting probe for the chromosome mapping of break points.
1.92-P
Result of 4680 cytogenetic studies: a retrospective study in karyotype abnormalities A. Ozden, M. Yesil, Y. Sabuncuoglu, C. Beyazyurek, S. Isin, A. Gur, B. Umay, H. Karadayi, S. Kahraman and Y. Saglam Istanbul Memorial Hospital Introduction: As a genetic center serving mostly for infertile couples, the results have significance for assisted reproduction. Here, we present our results of prenatal and postnatal samples. Materials & Methods: Results of 4680 cytogenetic studies performed in a period of 7 years were included in this study. Karyotyping was performed by using conventional cytogenetic methods such as GTG and C-banding. Investgations on amniotic fluid, CVS and abortion material were carried out on longterm cultures. 3660 samples for peripheral blood (PB), 714 samples for prenatal diagnosis (PND) and 268 miscarriage materials were studied. Analysis of 714 cases for PND, 598 cases from amniotic fluid, 64 cases from CVS and 52 cases from cord blood were performed. Results: Chromosomal aberrations were found in 421 of 3660 cases (11,5%) in PB studies. 238 patients (6,5%) have gonosomal and 183(5%) patients have autosomal abnormalities. The frequency of gonosomal abnormalities for Klinefelter_s Syndrome, 46,XX males, 46,XY female and cases with mosaic sex chromosome abnormalities were 54.2%(129), 7.5%(18), 1 and 33.2%(79), respectively. The number of structural abnormalities for Reciprocal and Robertsonian translocations (RecT, RobT), double translocations, insertional translocations, and inversions were 75(41%), 31(17%), 6(32.8%), 3(1.6%), 54(29.5%), respectively. 44 chromosomal aberrations were found in 714 cases after PND. 26 out of 44(%3,6) have numerical and 18(%2,5) have structural abnormalities. Trisomy 21 was the most frequent numerical abnormality and RecTs were the most frequent structural abnormality. 92 out of 268(%34,3) miscarriage materials carried chromosomal abnormalities. The most frequent abnormality was trisomy 16(%15,2) and two cases had double trisomies.
6th ECC: Abstracts Conclusion: Cytogenetic study is still the only fully informative method able to detect all chromosomal abnormalities. The high number of abnormalities found is not surprising as our centre mostly carries out investigations in reproductive genetics.
1.93-P
A male case with double aneuploidy (48,xxy,+21) E. Akbas¸, F. So¨ylemez, K. Savas¸og˘lu, O. Halliog˘lu and S. Balcı Mersin University
1.94-P
Prenatal identification of a small supernumerary marker chromosome by molecular cytogenetics J. B. Melo, E. Matoso, N. Lavoura, C. Pais, F. Ramos, N. Kosyakova, K. Mrasek, T. Liehr and I. M. Carreira Servic¸o de Citogene´tica, Instituto de Biologia Me´dica, Faculdade de Medicina, Universidade de Coimbra, Portugal, Institut fu¨r Humangenetik und Anthropologie, Jena, Germany Small supernumerary marker chromosomes (sSMC) are defined as structurally abnormal chromosomes that cannot be identified or characterized unambiguously by conventional banding cytogenetics alone, and are generally equal in size or smaller than a chromosome 20 of the same metaphase spread. sSMC are reported in 0.043% of newborn infants, 0.433% of mentally retarded patients, 0.171% of subfertile people and 0.077% of prenatal cases. In general, the risk for an abnormal phenotype in prenatally ascertained de novo cases with sSMC is given as õ13%. This has been refined to 7% (for sSMC derived from chromosome 13, 14, 21 or 22) and 28% (for all non-acrocentric autosomes). sSMC derived from chromosome 16 are rare and, so far, it is not yet clear which regions of chromosome 16 are critical and have clinical consequences. We report a
63 prenatal case of a sSMC detected after amniocentesis due to advance maternal age with no ultrasound anomalies. The sSMC was derived from chromosome 16 as demonstrated by centromere-specific fluorescence in situ hybridization (FISH). The origin of the marker was confirmed by reverse FISH, after microdissection. By application of a subcentromerespecific probe set (subcenM-FISH) for chromosome 16 and a BAC clone for region 16q12.2, the presence of a de novo mosaic partial trisomy due to a karyotype 47,XX,+mar(16)(::p11.1Y::q12.2) was demonstrated in 24% of analysed cells. Autopsy revealed a foetus with slight alterations, like discrete hypotelorism and an extra supra-renal. The phenotypical consequences of a de novo marker chromosome encountered at prenatal diagnosis remain difficult to assess because of the unknown genetic content. Molecular cytogenetics techniques are a very valuable tool for the accurate identification of the genetic origin and content of marker chromosomes, contributing to a more informed prenatal counselling. Supported in parts by Dr Robert Pfleger Stiftung.
1.95-P
Isodicentric Y and Y marker chromosomes in a female with up to 8 cell lines I. M. Carreira, J. B. Melo, B. Marques, A. Mirante, L. Simo˜es, M. Pires, C. Mendes and E. Matoso Servic¸o de Citogene´tica, Instituto de Biologia Me´dica, Faculdade de Medicina da Universidade de Coimbra, Portugal, Centro de Gene´tica Humana, Instituto Nacional de Sau´de Dr Ricardo Jorge, Lisboa, Unidade de Endocrinologia, Hospital Pedia´trico, Centro Hospitalar de Coimbra Among structural abnormalities affecting the Y chromosome, dicentric chromosomes are the most common. The possible phenotypes of these patients span the entire range from female, with or without manifestations of Turner syndrome, to fertile male. The dicentric Y chromosome (dicY), usually shows instability, and may be lost during division in some cells and tissues, resulting in the development of a 45,X cell line. Thus the majority of dicY chromosomes
6th ECC: Abstracts
64 are usually accompanied by sex chromosome mosaicism. We report a prenatal diagnosis, referred because of advanced maternal age, that revealed a mosaic with 4 cell lines mos 47,XY,+mar[5]/ 46,X,+mar[25]/45,X[13]/46,XY[1]. Fluorescence in situ hybridization (FISH), revealed that the marker chromosome was derived from the Yp proximal region der(Y)(DYZ3+,Y10+), and the presence of an isodicentric Y with two complete short arms and two symmetric incomplete portions of the long arm, only the heterochromatic region was deleted, so the Y chromosome is a idic(Y)(q11.23)(pDP230++, SRY++,Y10++,DYZ3++,49f++). An apparently normal female was born and in the neonatal period, the peripheral blood cytogenetic analysis revealed 4 additional cell lines, with variation in the number of the marker chromosomes. An abdominal ultrasound showed apparently normal uterus and ovaries. At the age of eight years she had a normal growth development and elevated FSH value indicative of ovarian failure. Although the SRY gene was shown to be present in 2 copies on the Y chromosome, probably due to mosaicism, the patient has a normal female phenotype. Detailed molecular-cytogenetic characterization of patients and a clinical follow-up are very useful in defining the phenotypic range of this chromosomal abnormality.
1.96-P
Three clinical pictures of Pallister Killian syndrome M. Pinto, A. Jardim, E. Matoso, A. Mascarenhas, P. Paiva, J. Ferra˜o, Equipa de DPN, Equipa de DPN, J. Sa´ and I. M. Carreira Servic¸o de Citogene´tica, Instituto de Biologia Me´dica, Faculdade de Medicina, Universidade de Coimbra, Portugal, Maternidade Daniel de Matos, Hospitais da Universidade de Coimbra, Portugal, Maternidade Bissaya Barreto, Centro Hospitalar de Coimbra, Portugal, Servic¸o de Gene´tica, Hospital Pedia´trico, Centro Hospitalar de Coimbra, Portugal Pallister Killian syndrome (PKS) is a rare congenital syndrome caused by mosaicism for tetrasomy of 12p and is clinically characterized by distinct craniofacial
features and neurological manifestations. We report two PKS cases in prenatal diagnosis and a 3rd case with a mosaicism for a structural aberration that includes the PKS critical region redefined to 12pterY12p13.31. Case 1 was referred because of ultrasonografic findings, non-specific for PKS. The karyotype was: mos 47,XY,i(12)(p10)[17]/46,XY [17]. In case 2 amniocentesis was performed because of advanced maternal age (AMA) but ultrasonografic abnormalities more commonly associated with PKS were later described. The karyotype was: mos 47,XX,i(12)(p10)[13]/46,XY[7]. Prenatal diagnosis of case 3 was performed because of AMA and the karyotype was: mos46,XY,add(12)(p13.3).ishder (12)(12psubtel+++)[13]/46,XY,add(12)(p13.3). ishder(12)(12psubtel++)[23]/46,XY[19]. Ultrasound evaluation of this fetus was normal. After birth 100 blood metaphases were studied and the cell line with partial 12p tetrasomy was absent. PKS is characterized by a tissue limited mosaicism. The main ultrasound indicators are hydramnios, congenital diaphragmatic hernia and micromelia. Case 1 had minor features and hygroma, not typically found, but in contrast case 2 presented with diaphragmatic hernia. Case 3, although not a typical PKS because of the mosaicism for partial trisomy 12p as well as partial tetrasomy 12p, has dysmorphisms that are consistent with a PKS phenotype. The reason why the cell line with 12p tetrasomy is absent in lymphocytes may be related to somatic selection against these cells in vivo in the blood. The absence (case 3) and the presence of non-specific minor anomalies (case 1) constitute the main causes of diagnostic failure. The prognosis for a fetus with PKS is difficult to predict due to mosaicism, although this syndrome is generally associated with a severe phenotype.
1.97-P
A girl with a mosaic ring chromosome 18 M. Ergun, A. Koc, D. Kan, K. Karaer, K. Gucuyener and E. F. Percin Gazi University Faculty of Medicine Department of Medical Genetic, Gazi University Faculty of Medicine Department of Pediatric Neurology About 70 cases with r (18) have been reported to date and most of them were female. As the formation of
6th ECC: Abstracts
65
ring chromosome 18 involves the breakage of the chromosome at both ends of the p and q arms, phenotypic features of patients with r(18) share the features of the 18q- syndrome, whereas a minority of them appear to resemble the 18p- syndrome or a combination of these two syndromes. Inherent instability of ring chromosomes may cause loss of the ring, double sized rings or multiple copies of the ring. Double sized/dicentric rings derived from chromosome 18 have been reported in two cases but without the additional chromosome abnormalities. Patients with ring 18 chromosome usually are characterized with microcephaly, mental retardation, short stature, obesity, micropenis, cryptorchidism, hypertelorism, epicanthic folds, micrognathia and small hands. We present a 6,5 years old Turkish girl with 46,XX,r(18)/46,XX,dicr(18)/45,XX,-18 karyotype. Karyotypic features of this case will contribute to genotype-phenotype correlation studies of chromosome 18 related disorders.
cele and congenital heart anomalies are defined in cases with 1q42 deletion, also 2q32 deletion is related to PDA. There may be an important gene or genes related to these disorders in the mentioned regions and this report may contribute to identifying the molecular pathology that leads to omphalocele-congenital heart defect in non-syndromic cases.
1.98-P
National Research Centre, Hanan H. Afify
A neonate with omphalocele and patent ductus arteriosus with a 46,XX,t(1;2)(q42;q32) karyotype
We report on 4890 Egyptian patients referred for suspected chromosomal abnormalities. Females represented 53%, consanguinity was positive in 57% of cases. Referrals were grouped into 20 different categories, of which genetic counseling represented the highest percentage (19%), followed by short stature (12.4%). Abortion and intra uterine fetal death, congenital abnormalities/mental retardation, delayed milestones were nearly equal 10%. Ambiguous genitalia 4%, primary amenorrhea 3, 1%, while other categories represented smaller percentage. Chromosomal aberrations were identified in 22.7% of cases. The most common autosomal abnormality was Down syndrome (51%), sex chromosome abnormalities was 22%. Deletion was 6.8%, inversion other than chromosome 9 was 6%, translocation was 5.2%, chromosome breakage 3%, markers was 2.7%, duplication 2% and ring was 1.3. Fluorescence in situ hybridization helped in the accurate cytogenetic analysis specially in diagnosis of microdeletion syndromes and in identification of the structurally abnormal of X and Y chromosomes and in the identification of marker chromosomes and sites of breakage in cases of translocations. Cases of idiopathic mental retardation were under investigations using telomere specific probes for all the chromosomes.
A. Kaymak, A. Koc, O. Erkal, M. A. Ergun and E. F. Percin Gazi University Faculty of Medicine, Department of Medical Genetics Omphalocele is found in 20% of infants who have a congenital heart defect. Fifty percent of these infants have recognisable syndromes. Omphalocele-congenital cardiac heart defect association may be the result of a common molecular pathology in non-syndromic cases. We present a neonate with 46,XX,t(1;2) (q42;q32) karyotype who is the product of an in vitro fertilized twin pregnancy of non Y consanguineous parents. On physical examination, her weight was 2475 gr (3Y10th centile), her height was 44 cm(10Y25th centile) and her head circumference was 31,5 cm (25Y50th centile). She had metopic ridge, narrow forehead, plagiocephaly, thin lips, micrognathia, down turned corners of mouth, high palate, omphalocele and patent ductus arteriosus. Omphalo-
1.99-P
Chromosomal abnormalities in a referred population for suspected chromosomal aberrations: a report of 4890 case A. Mohamed, Alaa K. Kamel, Nivin A. Helmy, Hassan A. Housein, Saida Hammad, Hesham Faik, Marwa I. Shehab, Assad El Gerzawy and Maha Eed
6th ECC: Abstracts
66
1.100-P
A CVS chimera: short- and long-term cultures Esther Cuatrecsasas, Carles Garrido, Laura Vila, Vicenc¸ Catala`, Teresa Escabias, Ana ramos, Maite Farre´ and Agustı´ Sere´s-Santamarı´a Prenatal Genetics, Eugin A chimeric individual is one who has cells from two different lineages. The difference between mosaicism and chimera is that chimera comes from two different embryos and mosaic is formed by one embryo. In twin gestations, it_s possible that one of them dies and the other continues in the uterus during the whole gestation with Bthe brother^ like a parchment. A 43-year-old woman was referred for a cytogenetic study at 12 weeks_ gestation. A double CVS culture (short- and long-term) was done, and a discrepant result was obtained. The short-term culture result was 47,XX,+13 and the long-term culture result was 46,XY in all metaphases. A fluorescent in situ hybridization done because of the discrepancy confirmed the cytogenetic results. When the parents received the short-term culture result they decided to terminate the pregnancy in spite of our information. An obstetric history review reported that the gestation was due to an IVF treatment. Ultrasonography exploration at 6 weeks_ gestation showed a twin gestation, but at 12 weeks_ gestation one twin could not be seen, it died and was reabsorbed. Because the long-term culture result was 46,XY, maternal cell contamination was excluded. The presence of two cell lines in one sample with two different sexual chromosomes, confirms the fact that the event was a chimerism, not mosaicism. The obstetric history explains that the cytogenetic discrepancy was due to a vanishing twin. There is a high risk of monochorionic dyzigotic gestations associated with assisted reproduction techniques, which could be the origin of vanishing twin and also chimeras. This case report is another case that reaffirms the necessity of performing short- and long-term cultures in every CVS sample. We think it is very important for the cytogenetic laboratory to know the obstetric history, because it could be helpful for cytogenetic results. This is because assisted reproduction techni-
ques present a high risk of monochorionic dyzigotic gestations which could be the origin of vanishing twin and so chimeras.
1.101-P
Kleine-Levin hibernation syndrome associated with an unusual (1;21) translocation B. Tuysuz, L. Telvi, O. Kaya, N. Mutevelli and H. Kaynak Department of Medical Genetics, Cerrahpasa Medical Faculty, Istanbul, Cytogenetics Laboratory, Hopital St Vincent de Paul, Paris, Department of Child Psychiatry, Istanbul Medical Faculty, Istanbul, Department of Neurology, Cerrahpasa Medical Faculty, Istanbul, Turkey Kleine-Levin syndrome is a rare disorder that usually affects males and is characterized by episodic hypersomnia, increased feeding and aberrant behavioral psychiatric disturbances. Familial cases have been reported but inheritance pattern have not been known. The patient described is an 13 year-old boy, presented recurrent sleepiness and hyperphagia. He showed a sleeping and increesed eating periods for 7Y10 days followed by an awakeness period. Chromosome analysis from blood lymphocyte revealed a de novo t(1;21). We suggest that Kleine-Levin syndrome associated genes can be localized at the breakpoints on the chromosomes 1 and 21.
1.102-P
Mosaicism of a de-novo unbalanced translocation 1/14 in a fetus with early developmental abnormalities D. Hansmann, Ulrike Gamerdinger, Thomas Eggermann, Gesa Schwanitz, Gisela Kno¨pfle, Ulrich Gembruch and Manfred Hansmann Institute of Prenatal Medicine and Genetics, Meckenheim-Bonn, Germany, Institute of Pathology, University Medical Center of Giessen and Marburg, Germany, Institute of Human Genetics, RWTH Aachen, Germany, Institute of Human Genetics,
6th ECC: Abstracts University of Bonn, Germany, Department of Pathology, University of Bonn, Germany, Department of Obstetrics and Prenatal Medicine, University Hospital-Bonn, Germany, Prenatal Medicine and Genetics, Bonn, Germany Pure duplications 1q are rarely seen. We report for the first time the prenatal diagnosis of duplication 1p11 to 1qter as a mosaic. In the second translocation-chromosome (14) the breakpoint was localized in the constitutive heterochromatin of the short arm [karyotype: mos46,XY,der(14)t(1;14)(p11;p11.2)/ 46,XY]. The aberration was analysed by GTG and QFQ banding and the breakpoints were then confirmed by FISH and STR typing. The conceptus was first investigated in 11+3 w.o.g. as the fetus showed ultrasound abnormalities such as increased nuchal translucency of 8 mm, omphalocele, anophthalmia, bilateral cleft palate, in 14+5 w.o.g. asymmetrical growth restriction, ascites and left-sided pleural effusion in addition. The pregnancy was terminated in 17 w.o.g. because of an infaust prognosis. Biopsies of seven different somatic tissues were analysed by karyotyping after cell culture and interphase FISH of direct cell preparations to determine a cell line selection in-vivo and in-vitro. The cytogenetic diagnoses showed an unequal distribution of the aberration. The pathologic anatomic findings revealed a characteristic pattern of malformations and dysmorphic features.
1.103-P
X;Y translocations and POF S. Lissoni, N. Villa, S. Redaelli, A. Bentivegna, F. Crosti, E. Sala and L. Dalpra`
67 idiopathic POF with a karyotype 46,X,der(X) t(X;Y)(q27;q12). She inherited the rearrangement from her mother who had a diagnosis of early menopause at age of 42. The second case is a young woman that developed left ovary choriocarcinoma at age of 10. Menses began at age of 13 but she presented immediately a secondary amenorrhea with high level of gonadotropin. The cytogenetic analysis revealed the presence of an altered karyotype: 46,X,der(Y)t(X;Y)(q11.1;q11.223)dn. The laparoscopic resection of the right ovary was done at age of 16. The histological analysis of the ovary revealed the presence of a fibrous parenchyma and the complete absence of follicles. Each patient was analysed with the aim of precisely identifying the breakpoint using FISH with specific BAC probes. The analysis was completed with a molecular genetic approach: the Y chromosome breakpoint was characterized also using PCR detection of STS (sequencetagged sites) specific for the identified interval. The genomic clones containing the breakpoint regions of chromosome X and Y were screened to evaluated the genetic content and the presence of genes correlated with the disease in the regions neighbouring the breakpoints.
1.104-P
Cytogenetic evaluation of miscarriages in ART patients S. Isin, M. Yesil, Y. Saglam, A. Gur, Y. Sabuncuoglu, A. Ozden, C. Beyazyurek, H. Karagozoglu, A. Guney and S. Kahraman Istanbul Memorial Hospital, Genetics Center
University of Milan-Bicocca, Medical Genetics Lab. Premature ovarian failure (POF) is a secondary hypergonadotropic amenorrhea occurring before age of 40 and affecting 1Y3% of females. POF condition could be associated with X chromosome rearrangements in 5Y6% of cases. We concentrate our attention on two unbalanced translocations between X and Y chromosomes identified in POF women. The first case is a 33 years old woman without signs of Turner syndrome, who presented secondary amenorrhea from age of 27. She had a diagnosis of
Introduction: Nearly 60% of all first trimester spontaneous miscarriages are due to chromosomal abnormalities. The most frequent are numerical abnormalities (94%), followed by structural abnormalities (5%) and less frequently mosaicism (1%). In the case of parental carriership of a balanced translocation, the risk of repeated pregnancy loss gets even higher. Couples with repeated miscarriages present a significant part of patients who benefit from preimplantation genetic diagnosis and assisted reproductive techniques.
6th ECC: Abstracts
68 Materials and methods: First trimester abortion products (n = 306) were collected in a period of six years between 2001 and 2006. Chorionic villus tissue was separated from maternal tissue and processed for further conventional cytogenetic analysis. Results: Abortion material from 268 cases was successfully karyotyped and revealed that 91 (33,9%) had abnormal results; of which 93,5% the aberrations were numerical and 6,5% were structural. Autosomal trisomies were the most frequent abnormality observed in this cohort (63,5%). The frequency of trisomies of chromosomes 16, 22 and 15 were 25,9%, 18,5% and 12,9% respectively. Monosomy X was the second most prevalent abnormality (20%) in the numerical abnormality group. The frequency of polyploidy was 13%; also there were three double trisomies (3,5%) in the numerical abnormality group. Structural abnormalities included Robertsonian and reciprocal translocations, inversions, isochromosomes and marker chromosomes. Conclusion: Results have clinical impact on probe panels used for preimplantation genetic diagnosis for couples with recurrent implantation failures and repeated pregnancy loss. The fact that trisomies of chromosomes 15, 16, 22 were seen more frequently in our study rather than chromosomes 13, 18, 21 points to the need for checking chromosome 15 before transferring embryos.
1.105-P
Recurrence of trisomy 13 T. Cankaya, A. B. Yigiter, E. Bora, Z. N. Kavak, B. Tuysuz and N. Basaran Marmara University Faculty of Medicine, Marmara University Faculty of Medicine Dept of Obstetrics and Gynecology, Dokuz Eylu¨l University Faculty of Medicine Divisions of Genetics, Istanbul University Cerrahpasa Faculty of Medicine Dept of Medical Genetics, GENMER Center for Genetic Diseases & Prenatal Diagnosis Chromosome aneuploidy is one of the major causes of pregnancy wastage and birth defects. In order of frequency, three autosomal trisomies are viable in regular state: trisomy 21, 18, and 13. The recurrence
risk of trisomy 21 is about 1Y2%, and the risk of trisomy 18 appears to be much lower than that of trisomy 21. Although the risk of recurrence of trisomies is affected by maternal age and germline mosaicism, there is no information about trisomy 13 recurrence in the literature. This case report describes a 32 year old woman G3P1. At 12 weeks of gestation chorionic villus sampling (CVS) was performed since she had previously had a newborn with trisomy 13. The cytogenetic result of CVS was 47,XY, + 13. The karyotypes of mother and father were checked for mosaic situations and were both normal. According to the microsatellite analysis of the extra chromosome 13, it was found to be inherited from the mother. This case will probably be the first report of pregnancies with recurrence of regular type trisomy 13 in the literature.
1.106-P
Supernumerary X chromosomes in female with failure of reproduction M. Craina, Gheorghe Furau, Nicoleta Andreescu, Mariana Veliscu and Valerica Belengeanu University of Medicine and Farmacy of Timisoara, University of Medicine of Arad, Bega, Obstetrics and Gynecology Clinics of Timisoara The reason for this research work was to access the incidence as well as the cytogenetic aspects of chromosome X aneuploidy, poly X type, in reproduction failure. It is known that hyperdiploid numerical aberrations of the X in mosaic state are associated with reproduction failure as well as premature ovarian failure. The aim of this study was to find out what is the incidence of these anomalies in 230 couples investigated for reproduction failure. Chromosomal analysis was done from peripheral lymphocytes using the standard method and GTG banding, while for other couples, we also used FISH technique. Results: two patients had a karyotype 46,XX/47,XXX with proportions of the normal cell line 70%, aneuploid line 30%, for one case, with the euploide line 80% and aneuploid 20%,
6th ECC: Abstracts respectively for the second case. In another patient, the karyotype was 46,XX(50%)/48, XXXX(30%)/49, XXXXX(20%). In the fourth case, the karyotype was 46,XX(70%)/47,XXX(20%)/48,XXX, + marker (10%). We conclude that there is no correlation between mosaic cellular lines in blood cells and the degree to which the reproductive performance is reduced. Patients with X chromosome mosaicism have a reproductive performance highly variable and difficult to define. The incidence of the mosaic hyperploidy X was estimated at 1.62% in this series as compared 2.9% in other reports.
1.107-P
Familial reciprocal translocation t(1;5)(q23;p12), three cases in two generations Cristina Gug, Ionel Cioata, Anca Cretu and Ioana Tuduce Dept. Medical Genetics, University of Medicine and Pharmacy BVictor Babes^, Timisoara, Dept. Obstetryc Gynecology, University of Medic, Dept. Biology, West University, Timisoara A young healthy Romanian couple with a history of two first semester abortions was investigated. The wife had a normal karyotype, but the husband was found to be carrier of a balanced reciprocal translocation t(1;5)(q23;p12). Family history revealed that the husband_s mother had had three abortions of her own in the past, suggesting familial translocation. The cytogenetic investigation was extended to other members of the husband_s family. Both the brother and the father were found to be carriers of the same translocation. The consequences of this structural chromosomal rearrangements are discussed. The pathogenesis of trisomy 1q, 5p and monosomy 1q, 5p resulting from the meiotic segregation of the parental balanced translocation will be presented. When the couple_s next pregnancy stopped in development, cytogenetic analysis was conducted on the lost embryo, but the result was a normal 46,XX karyotype. This situation suggests that,
69 besides the translocation, other factors should be taken into account in the etiology of reproductive failure.
1.108-P
Rare familial paracentric inversion of chromosome 9: prenatal and postnatal characterization of aberrations by FISH multicolor banding A. Polityko, O. Khurs, N. Rumyantseva, K. Mrasek and T. Liehr Republican Medical Center BMother and Child^, Institute of Human Genetics and Anthropology, Jena, Germany, I We present a case of the occurrence of a paracentric inversion of a sizeable part of 9q in a mother and her fetus. Case report: The conventional prenatal cytogenetic analysis using GTG-banding was performed because of advanced maternal age. Parents were healthy non-consanguineous couple. The abnormal chromosome 9 was found prenatally, in which only 9pter- 99q13 could be characterized by the routine analysis as non-rearranged part. Subsequently the karyotypes of both of parents were studied. Apparently similar aberration was discovered in maternal karyotype: 46,XX,der(9). Methods and results: FISH analysis of mother_s chromosomes using wcp#9 probe (Vysis) demonstrated intrachromosomal aberration. High resolution multicolor banding method using probe set (Liehr et al. 2002 Int J Mol Med 9: 335Y339) for chromosome 9 revealed the following results in mother and her fetus: ish inv(9)(q13õ21.1q33õ34.1). Final step of fluorescence in situ hybridisation using probe LSI ABL 9q34 (Vysis) confirmed that the subterminal segments were present on the rearranged chromosome and were not involved in the inversion of 9q in both of karyotypes studied. Conclusions: The data of molecular cytogenetic analysis of the balanced chromosomal rearrangement were effectively used in prenatal diagnostics and genetic counseling of that family and consanguineous relatives.
6th ECC: Abstracts
70
1.109-P
Partial monosomy of distal 6q E. Utine, Y. Alanay, D. Aktas¸, K. Bodurog˘lu, M. Alikasifoglu and E. Tunc¸bilek Hacettepe University Interstitial deletions in chromosome 6q have been rarely described previously. We describe a female patient with del(6)(q22.21q23.3), which occurred as a result of a complex balanced translocation in her mother. The patient was 10-months old and was referred on detection of patent ductus arteriosus, patent foramen ovale, esophageal atresia and dysmorphic facial features. At birth she was small for gestational age and was operated for esophageal atresia. Postoperatively she had frequent aspiration pneumonia episodes and respiratory difficulty. There were cerebral ventriculomegaly and vertebral posterior fusion defect. On referral she measured below third percentile and she had apparent hypertelorism, downslanting palpebral fissures, strabismus, iris coloboma of the right eye, posteriorly rotated ears, down-turned corners of the mouth and micrognathia. Peripheral blood karyotype revealed 46,XX,ish del(6)(q22. 21q23.3). Paternal karyotype was normal. The mother, who was phenotypically normal, had a karyotype as follows: 46,XX,ish der(5)(5pterY 9 5q13.1õ13.2:: 6q22.1Y 96q23.3::8p11.2Y9 8pter), del(6)(q22.21q23 .3)der(8)(5qterY9 5q13.1õ 13.2::8p11.2Y 98qter). Deletions of 6q produce three distinct phenotypes. Deletions involving 6q15Y 96q25 cause intrauterine growth retardation, facial dysmorphisms and limb malformations, while esophageal atresia and iris coloboma were not reported previously in these patients.
Mental retardation is a common disorder defined as a failure to develop a sufficient cognitive and adaptive level, affecting 1Y3% of the general population; however the genetic causes of this disease are largely unknown. Chromosomal abnormalities are important causes of mental retardation. Depending on patient selection methods and techniques used, chromosomal abnormalities can be detected in 4Y28% of mentally retarded patients. Furthermore, subtelomeric rearrangements have been found to account for 5Y7.4% of moderately or severely mentally retarded patients. This study was performed in order to investigate subtelomeric microdeletions in mentally retarded patients with unknown origin. Subtelomeric microdeletions were detected in four patients. In two of them, unbalanced translocations were observed. Furthermore, in four patients, only one abnormality was derived from the mother while the others were de novo. Although clinical selection criteria for testing patients with subtelomeric chromosome screening are still not clear, we recommend screening for subtelomeric rearrangements in all children with idiopathic MR, combined with dysmorphic features and a normal karyotype where all other possible causes have been excluded according to the patients_ clinical features. This refers also to cases with borderline intelligence, mild dysmorphic features.
1.111-P
Two patients with distal partial trisomy 1q D. Aktas¸, E. Utine, Y. Alanay, S¸. Gu¨c¸er, E. Tunc¸bilek, K. Mrasek and T. Liehr
1.110-P
Hacettepe University, Universitatsklinikum Jena
The detection of subtelomeric chromosomal rearrangements in 100 patients with idiopathic mental retardation: Hacettepe University Experience
We report on two cases with partial trisomy 1q syndrome. One case was a midtrimester fetus with multiple malformations that was prenatally diagnosed with a de novo distal partial trisomy 1q with duplication of 1q31q44. Prenatal ultrasound at 24th gestational week demonstrated the presence of cleft lip and palate, increased biparietal diameter and decreased abdominal circumference. Cytogenetic analysis (GTG banding) and subsequent FISH using whole chromosome paint 1 and multicolor banding
T. C ¸ elik, E. Utine, Y. Alanay, D. Aktas¸, K. Bodurog˘lu, M. Alikas¸ifog˘lu and E. Tunc¸bilek Hacettepe University
6th ECC: Abstracts
71
(MCB) demonstrated an aberrant karyotype 46,XY.ish dup(1)(q31q43õ44). The second case was a newborn male infant with multiple congenital malformations. He had a similar aberration as a result of unbalanced transmission of the aberrant chromosome 18 from his mother who had a balanced translocation between chromosomes 1 and 18. The present cases and a review of the literature suggest that partial trisomy of the long arm of chromosome 1 is a distinct clinical entity.
1.113-P
1.112-P
We report here a case of a girl of five months old with CHARGE association: congenital heart defect, bilateral iris coloboma, gastroesophageal reflux, low set ears, genital hypoplasia, and submucosal cleft palate. The proband_s karyotype was found as 46,XX,dup(4)(q27q31.3) de novo in all metaphases examined. This duplication was confirmed by the FISH technique using the whole chromosome painting probe for chromosome 4. Because the clinical findings of CHARGE syndrome overlap with those of Di-George and Velo-cardio-facial syndromes, the deletion of 22q11.2, which is the critical region of the these syndromes, was excluded using DiGeorge/ VCFS TUPLE1 and N25 (D22S75) region probes. The clinical findings of our case were compared with that of only one previously reported case of duplication dup(4)(q27q31.3). Our case is the first of interstitial duplication of 4q and CHARGE association in the literature. In conclusion, de novo duplication dup(4)(q27q31.3) is a rare chromosomal abnormality and further molecular genetic investigations are needed to specify its relation to the syndromes.
Analysis of constitutional chromosome aberrations and selected heteromorphisms in an ICSIcollective U. Paetzold and K. van der Ven University of Bonn, Germany, Department of Obstetrics and Gynecology, University Hospital-Bonn, Germany
Chromosome investigations were performed in 905 couples and 50 single probands (n = 1860) before ICSI treatment and a matching selected control group (n = 800). Karyotype analysis was processed according to standard lymphocyte culture. We documented constitutional chromosome aberrations and low grade mosaicism. The frequency of fragile sites of the autosomes and their interchromosomal distribution were determined for both groups. This was followed by investigations of the polymorphic regions, 9p12, 9q12, and 22p13. In this study, different clinical parameters were correlated with the specific cytogenetic parameters in every couple/ patient. Those were semen parameters (sperm concentration, motility and morphology) in the male partners and basic gonadotrophin levels, parameters of ovarian hyperstimulation in the female partners. Additionally, we monitored fertilisation rates in IVF/ ICSI, implantation rates as well as the rates of ongoing clinical pregnancies, miscarriage rates and the baby-take home rate.
De novo duplication dup(4)(q27q31.3) in a patient with charge association Z. Cetin, E. Mihci, S. Berker-Karauzum, I. Keser, S. Tacoy and G. Luleci Akdeniz University Faculty of Medicine, Department of Medical Biology and Genetics, Antalya, Turkey, Akdeniz University, Faculty of Medicine, Department of Pediatric Genetics, Antalya, Turkey.
1.114-P
Incidence of 15q11q13 deletions in spermatozoa from Prader-Willi syndrome fathers ` . Molina, E. Anton, F. Vidal and J. Blanco O Unitat de Biologia CelIlular
6th ECC: Abstracts
72 Deletions of 15q11q13 region account for 70Y80% of Prader-Willi Syndrome (PWS). In these cases, recurrence risk has been established at less than 1%. Nevertheless it has been suggested that the particular genomic architecture, characterized by the presence of Low Copy Repeats (LCRs) flanking this region, could predispose to Non Homologous Allelic Recombination (NHAR) during meiosis. The aim of this study was to evaluate the incidence of del 15q11q13 in sperm nuclei from fathers of PWS, and discuss their implications in the assessment of the recurrence risk of the syndrome. Semen samples from 16 fathers of PWS children and 6 controls were processed for triple-colour FISH as standardized in our laboratory. Normal and deleted sperm were discriminated using a customized combination of probes: LSI 15q11q13, CEP 15 and CEP 6. Analysis was done blindly in relation to the origin of the syndrome. Around 10000 spermatozoa were scored for every single father and controls. Statistical differences were observed in the frequency of deletions between PWS fathers (0.6% T 0.251) and controls (0.3% T0.08) (p =0.039). Individual comparisons showed a significant increased frequency of deletions in 9 individuals (p G0.01; ranging from 0.46% to 2.34%). In five out of nine cases, PWS was originated by deletion, in three of them by UPD and in the remaining one the origin was unknown. Results indicate a moderately increased risk of recurrence for PWS in some cases. However, except in one case (PW10: 2.34%) figures are within the level of risk established from epidemiological studies (less than 1%). Random distributions of aetiologies among the Brisky^ patients suggest that the frequency of deletions observed is a sign of instability of the 15q11q13 region that could predispose to other rearrangements such as inversions or gene conversion. Acknowledgements to Asociacio´n Madrilen˜a para el Sı´ndrome de Prader-Willi and Associacio´ Catalana Sı´ndrome de Prader-Willi.
1.115-P
Familial chromosomal translocation in 3 generations Simona Farcas, Valerica Belengeanu, Dorina Stoicanescu, Mariana Veliscu, Ioan Munteanu and Eli Ormerod
University of Medicine and Pharmacy of Timisoara, Clinical Hospital Bega of Timisoara, Ulleval University Hospital, Oslo
1.116-P
Y
Pericentric inversion of chromosome 9 five years experience E. Braha, M. Volosciuc, V. Gorduza, M. Gramescu, C. Rusu and M. Covic University of Medicine and Pharmacy
1.117-P
Interstitial Xq deletions in female carriers: cytogenetic, molecular and phenotypic characterization L. Comadran, I. Madrigal, E. Gabau, L. Rodriguez-Revenga, M. C. Dominguez, M. Mata, N. Baena, M. Mila` and M. Guitart Corporacio´ Sanita`ria Parc Taulı´ , Biochemistry and Molecular Genetics Department, Hospital Clı´nic. Barcelona. Spain. CIBERER (U726) We report two different cases with interstitial Xq deletions: a 6 year-old girl affected by dysmorphic features suggestive of fragile X syndrome but with a severe mental retardation who presented a de novo interstitial microdeletion; 46,XX del(X)(q27q27). The second is a familial case with two female monozygotic twins presenting neonatal hypotonia, mild dysmorphic features and a motor delay. One of the twins has a more severe phenotype. The mother has the same facial characteristics and presents premature ovarian failure, but no neonatal hypotonia or motor delay in infancy. An interstitial deletion was diagnosed in the twins, which was transmitted from their mother; 46,XX, del (X)(q21q23). In the first case molecular FMR1 analysis by PCR and Southern blotting showed only one normal allele with no FMR1 gene expansions and an apparently normal pattern. Six STS markers analysed mapped the deletion breakpoints between DXS1073 and
6th ECC: Abstracts DXS1047 encompassing Xq27 and the proximal Xq28. A full-coverage X-chromosome array-CGH with 91600 genomic BAC clones (resolution 100kb) allowed confirmation of a deletion of approximately 10Mb. A preferential inactivation of the normal X-chromosome was found by analyzing androgen receptor locus. In the second case, MLPA (PO106) for 14 known genes related to X-linked mental retardation detected a deletion containing FACL4, DCX and PAK3 genes, and breakpoints were identified in Xq21 and Xq23. A preferential inactivation of the X chromosome carrying the deletion was identified in the twins and the mother. These cases emphasize the importance of X-inactivation. Severe mental retardation in the first case could be explained by the loss of mental retardation genes, FMR1, SOX3 and FMR2 included in the deleted segment in the X chromosome that remains active. However, in the familial case no mental retardation in the female carriers might be attributed to the favourable X inactivation.
1.118-P
Cytogenetic analysis of early non-viable pregnancies after assisted reproduction treatment M. Martı´nez, C .Me´ndez, J. Ferro, M. Nicola´s, L. Ferna´ndez and J. Landeras Clı´nica IVI - Murcia, Instituto Valenciano de Infertilidad - Valencia The analysis of miscarriage material is important for establishing the aetiology of abortion in infertile couples.The aim of this study was to report on the karyotype observed in the abortus after ART. Materials and Methods: Prospective chromosomal analysis in a cohort of 589 spontaneous miscarriages; 385 which occurred following the application of ART was compared with 124 spontaneous non viable pregnancies used as control group in the same period of time. Tissues were collected using selective chorionic and embryo biopsies by hystero-embryoscope before the curettage in 68.7% of cases (350 of 509). In the remaining 31.2% (159 out of 509) of the cases a chorionic villus sample was obtained after conventional curettage. The material collected was
73 analyzed using standard G-banding techniques. The frequency and distribution of chromosomal abnormalities were evaluated by groups. Results: In this study the karyotype success rate was 86.3% (509 of 590 samples). Overall cytogenetic results revealed that 51.1% (260 of 510) of the miscarriages showed an abnormal karyotype. The frequency was 54% in the case of spontaneous gestation, 66.6% using artificial insemination, 47.0% when the treatment was In Vitro Fertilisation (IVF), 47.1% when the treatment was Intracytoplasmatic Sperm Injection (ICSI) and 58.9% with a combination of IVF/ICSI. The lowest prevalences were found in pregnancy losses after an oocyte donation (37.3%) and after a preimplantational genetic diagnosis (41.8%), values that were statistically different from the other groups (p G 0.05). Conclusion: The analysis performed on the ART groups showed that the type of abnormality and distribution were similar between different groups, except for polyploidy that decreased using ICSI, possibly due to double sperm fertilisation being avoided in this treatment. Monosomy X increased with statistically significant differences in the miscarriages of patients undergoing an ICSI treatment as compared to miscarriages in spontaneous gestations (p G0.05).
1.119-P
Prader-Willi syndrome: phenotypic and behavioural variability, including autistic features, among carriers of differently sized deletions L. Ballarati, F. Malvestiti, M. T. Bonati, C. Valtorta, P. Finelli, G. Grugni, D. Giardino and L. Larizza Lab. Citogenetica Medica e Genetica Molecolare, IRCCS Istituto Auxologico Italiano, Milano, Dip. Biologia e Genetica per le Scienze Mediche, Universita` di Milano, Div. Auxologia, IRCCS Istituto Auxologico Italiano, Piancavallo, Genetica Medica, Dip. Di Medicina, Chirurgia e Odontoiatria, Universita_ di Milano, Italia Prader-Willi syndrome (PWS) is a complex multisystemic disorder clinically characterized by hypotonia
6th ECC: Abstracts
74 and feeding difficulties in the neonatal period, failure to thrive in the postnatal period, hyperphagia in early childhood resulting in obesity, hypogonadism, mild-moderate mental retardation and behavioural difficulties. PWS results from the absence of expression of imprinted genes (paternally expressed), located on chromosome 15q11Y13. Most cases (70%) are due to paternal deletion of this region; the remaining cases result from maternal uniparental disomy (UPD) of chromosome 15 (25%), imprinting defects and rarely translocations involving 15q11Y13 (3Y5%). Besides the major diagnostic features, patients seem to show phenotypic and behavioural differences according to the molecular pathogenetic mechanism. Compared with deleted patients, UPD cases are less severely affected, with fewer facial features, lower frequency of seizures, higher verbal IQ, less tendency to self-injurious behaviours, but higher tendency to develop autism spectrum disorders. Most chromosomal deletions are mediated by NAHR (Non Allelic Homologous Recombination) between complex low copy repeats scattered within 15q11Y13. According to the block used as substrate, two main deletion classes are distinguished: large type I (TI), spanning from proximal breakpoint 1 (BP1) to distal breakpoint 3 (BP3), and smaller type II (TII), flanked by BP2 and BP3. Patients carrying the TI deletion exhibit more severe phenotype, including greater obsessive-compulsive behaviour and more impairment of visual perception, than those with the TII. We characterized the deletion_s size in 23 PWS patients by means of FISH techniques. Common deletions were found in 21 patients: among these, 7 carry the TPI and 14 the TPII deletion, respectively. The remaining two cases we found to have two different smaller deletions, sized about 4 Mb and 500 Kb, yet unreported. Correlations between the extent of the deletions and endophenotypes, in particular that represented by autistic behaviour, are addressed.
1.120-P
Xq interstitial duplication in an adult male with Prader-Willi syndrome M. Silva, F. Boieiro, C. Alves, B. Marques, L. Sima˜o, G. Duarte, J. Furtado, J. Martins and H. Correia
Instituto Nacional de Saude Dr Ricardo Jorge, Lisboa, Portugal, Consulta de Endocrinologia, Hospital de Santa Maria, Lisboa, Portugal, I Duplications of the long arm of the X chromosome, transmitted maternally, are very rare. In females where a normal and a duplicated Xq are present, there_s usually a preferential inactivation of the abnormal X, in the majority of cells, resulting in a normal phenotype. Males with X duplications have variable phenotypes and a few cases with PraderWilli syndrome (PWS) were reported. The majority of these latter reports refer to infant patients and adult descriptions of PWS and Xq duplications are very rare. We report on a 43-year-old male referred for clinical signs suggestive of Prader-Willi syndrome (PWS). High-resolution cytogenetic analysis performed on peripheral blood lymphocyte GTG banded chromosomes revealed a 46,Y,dup(X) (q27q28) karyotype and his mother presented with the same duplication of Xq27Yq28, her karyotype being 46,X,dup(X)(q27q28). FISH analysis with whole chromosome painting probe for the X chromosome showed that there was no involvement of other chromosomes on the abnormal X chromosome. CGH analysis confirmed the (X)(q2728) duplication. FISH studies with probes for the Prader-Willi/ Angelman syndromes critical region revealed a normal signal pattern thus discarding a microdeletion of 15q11Yq13 as a causative basis for the patient_s PWS phenotype. Molecular analysis of the methylation pattern of the SNRPN gene excluded uniparental disomy of chromosome 15. This case emphasizes the importance of chromosomal studies in addition to molecular analysis on patients even when a condition diagnosable by molecular methods is strongly suspected.
1.121-P
Chromosome heteromorphisms: an impact on infertility F. Sahin, Z. Yilmaz, O. O. Yuregir, T. Bulakbasi, O. Ozer and H. B. Zeyneloglu Baskent University Faculty of Medicine Department of Medical Genetics, Ankara, Turkey, Baskent University Faculty of Medicine Department of Obstetrics and Gynecology, Ankara, Turkey
6th ECC: Abstracts Cytogenetic heteromorphisms, also known as polymorphisms or normal variants, can be described as heritable variations at specific chromosomal regions, different from general population, but with no hitherto proven impact on phenotype. To estimate the impact of heteromorphisms on infertility, we compared the presence of polymorphisms in the karyotypes of two patient groups. The polymorphisms consisted of paracentric heterochromatin of chromosomes 1, 9, 16; distal heterochromatin of the Y chromosome and increase in length of the short arm satellites and stalks of the acrocentric D and G group chromosomes (13, 14, 15, 21, 22). The first group of patients consisted of all the infertile couples (no of individuals =276) attending the assisted reproduction techniques (ART) center of our university, over a period of 2 years (2005Y2007). 18 patients (6.52%) were found to have some kind of chromosome heteromorphisms. As the second group, all amniocentesis samples karyotyped during the same time period (n = 1130) were selected. This group was considered to be a sample of the fertile population, as the fetus being karyotyped is the result of a spontaneous pregnancy and reflects its parents as a fertile couple. 20 patients had polymorphisms (%1.85) and all were confirmed to be inherited, by karyotyping the parents. None of them were pregnancies achieved by ART, so their reasons of referral were standart indications for prenatal diagnosis, such as abnormal serum screening levels. The difference between the two groups was statistically significant (p G 0,0001). These results are consistent with other similar studies that suggest the yet undefined relationship between chromosome heteromorphisms and infertility is actually significant. The assumption that these parts of the genome is functional, by means of controlling replication and silencing gene expression, requires further epigenetic studies.
1.122-P
Phenotypic comparison of two patients with x chromosome abnormalities: dupxp vs dupxq
75 University Faculty of Medicine Department of Obstetrics and Gynecology, Ankara, Turkey, Baskent University Faculty of Medicine Department of Pediatrics, Ankara, Turkey, Baskent University Faculty of Medicine Department of Pediatrics, Ankara, Turkey Structural abnormalities of chromosome X could lead to several different phenotypes, depending on the regions they involve. We report the phenotypic findings of two patients referred to our clinic in 2004 and 2006, both with duplications found on the X chromosome. The first patient was 18 years old and had menstrual irregularity. She had a low hairline and cubitus valgus on physical examination and suffered dyslexia. Chromosome analysis showed 46,X,dup(X)(p11.3p21) karyotype. Parents were also karyotyped and the same abnormality was found in the mother, who had premature menopause. Females with Xp duplications are predicted to be normal due to preferential inactivation of the duplicated X chromosome. In this case, the dysmorphic features in the patient and menstrual abnormalities in both the patient and her mother may be due to random Xinactivation, manifesting differently in each individual. The second case was a 1-year-old patient with multiple congenital anomalies severe mental-motor retardation, and intractable epilepsy who was conceived with assisted reproduction techniques. The karyotype was found to be 46,X,dup(X)(q13q25), but the parents were normal, so the abnormality was considered to be de novo. While all males with duplication Xq exhibit findings such as short stature, mental retardation, facial dysmorphism, females with Xq duplications are often phenotypically normal except short stature. A number of female patients with variable abnormal phenotype who also have multiple congenital anomalies including growth retardation and gonadal dysgenesis, have been reported in the literature.
1.123-P
O. Ozer, Z. Yilmaz, E. Simsek, M. Derbent, S. Guner and F. I. Sahin
Mucinous cystadenoma in a female patient with 45,x/46,xy karyotype
Baskent University Faculty of Medicine Department of Medical Genetics, Ankara, Turkey, Baskent
T. Bulakbasi, F. I. Sahin, O. Ozer, S. Erkanli, F. Bolat and Z. Yilmaz
6th ECC: Abstracts
76 Baskent University Faculty of Medicine Department of Medical Genetics, Ankara, Turkey, Baskent University Faculty of Medicine Department of Obstetrics and Gynecology, Ankara, Turkey, Baskent University Faculty of Medicine Department of Pathology, Ankara, Turkey The mosaic karyotype of 45,X/46,XY has a wide phenotypic spectrum and there are substantial differences between prenatally and postnatally diagnosed cases. The phenotype varies between normal male to classical Turner Syndrome. There is a high risk of gonadal tumour development in the dysgenetic gonads of patients with sex chromosome mosaicism. We report a 24 year old patient with pelvic mass and secondary amenorrhea referred to our laboratory for karyotyping. Peripheral blood chromosome analysis showed a mosaic karyotype of 45,X[17]/46,XY[83]. The tumour originated from the right ovary and the left ovary was found to be a streak gonad. The uterus was intact. Pathologic examination of the tumour revealed mucinous cystadenoma. Physical examination of the patient showed signs of Turner Syndrome, as short stature (145 cm), short neck and asymmetric shoulders. Mental state was normal. Y chromosome microdeletion screening involving SRY and ZFY genes was performed and no deletion was found. The patient was informed about the condition during the genetic counseling session.
1.124-P
A novel atypical 22q11.2 deletion in a patient with digeorge/velocardiofacial spectrum S. I. Nogueira, A. M. Hacker, F. T. S. Bellucco, L. D. Kulikowski, M. C. Cernach, Beverly S. Emanuel and M. I. Melaragno Universidade Federal de Sa˜o Paulo and Faculdade de Medicina do ABC, Children’s Hospital of Philadelphia, University of Pennsylvania and Children’s Hospital of Philadelphia Deletions of chromosome 22q11.2 are associated with a broad spectrum of clinical phenotypes, including the DiGeorge (DGS) and velocardiofacial
syndromes (VCFS). The most frequent feature is a conotruncal heart defect, often associated with facial dysmorphisms, cleft palate, parathyroid gland and thymus hypoplasia/aplasia, and learning disability. Most deletions (84Y90%) comprise õ3 Mb, known as the typically deleted region (TDR), which may contain about 30 genes. Smaller deletions, encompassing 1.5 Mb, are found in about 7Y14% of the cases. An atypical or unique deletion has also been described in a few cases. We report on a patient with 22q11.2 deletion syndrome who presented, at 9 years and 7 months, facial anomalies, cup-shaped ears, preauricular pits, tapered digits, feeding difficulty, failure-to-thrive, nasal regurgitation, severe hypernasality, velopharyngeal insufficiency, language impairment, learning disability, mild conductive hearing loss and mild mental retardation. No structural heart abnormality was found on echocardiogram. FISH analyses showed a proximal breakpoint located between cosmids c46a9 and c87h3, and a distal breakpoint in the low copy repeat B (LCR-B), between cosmids c68a1 and c87f9. This deletion differs from the known recurrent or atypical deletions reported previously, since one breakpoint is in LCR B and the other is mapped within no known LCR. This deletion occurring at no known LCR could be mediated by smaller duplicated blocks or by another mechanism yet to be uncovered. Literature data on atypical deletions show that the breakpoint may contain highly repetitive elements such as Alu, which can also be implicated in chromosome rearrangements. Atypical deletions, as the one presented in this report, can contribute to explain other deletionoriginating mechanisms and the genotype/phenotype correlation. Supported by CNPq, CAPES (Brazil); NIH and Charles E.H. Upham endowed chair (BSE).
1.125-P
De novo pericentric inversion of chromosome 1 and male infertility Balasar, Zamani Ays¸e Gu¨l and Acar Hasan Selcuk University Meram Medical Faculty Konya Infertility is a common problem affecting approximately 10Y15% of all couples. In half of the cases it is attributed to reduced sperm quality. A 10 fold increased incidence of structural chromosome abnormalities has been found in infertile male compared to
6th ECC: Abstracts the normal population. Five regions breakpoints on chromosome 1(1p32, 1p22, 1q12, 1q21, 1q24) were indicated to be related to infertility. Here, we report a 54-year old infertile man who had severe azospermia. He was found to be heterozygous for de novo pericentric inversion of chromosome 1; 46,XY, inv(1), (pterYp22::q32Yp22::q32Yqter). AZF deletions were not detected. FISH analysis for SRY region with locus specific probe (SRY/X) (Vysis) was positive . The clinical and cytogenetical data were compared with the previously reported cases.
77 patients group and control group-1 was seen. No deletion was determined in the control group-2 (0/13). The prevalance of 22q11.2 deletion in the patients_ and control-1 group is higher than the control-2 group. There was no deletion in the parents (0/10) of 5 patients with 22q11.2 deletion. In this study, with the similar and high prevalance of 22q11.2 deletion in the patient and control-1 group, Bdysmorphic clinical features are also important as CTHD in the diagnosis of 22q11.2 deletion syndromes^ is emphasized.
1.127-P 1.126-P
The prevalance of 22q11.2 deletion in children with congenital heart disease and dismorphic features Kaya, Tufan C ¸ ankaya, Elif Yilmaz, ¨ ztunc¸ and Beyhan Tu¨ysu¨z Funda O Istanbul University, Ege University Conotruncal heart defects (CTHD) that represent 10Y15% of congenital heart defects are the cardiac outflow tract defects. The prevalence of 22q11.2 deletion in patients with conotruncal heart defect is 12.8Y30%. This rate is 12Y17% in patients with only CTHD while it increased to 30% in patients with CTHD and dysmorphic findings. The aim of this study is to determine the incidence of 22q11.2 deletion in patients with CTHD and dysmorphic findings, to research if there is a significant difference between this group, the patients with not have CTHD but have dysmorphic findings (control group-1) and patients with CTHD but not have dysmorphic findings (control group-2).In the present study for defining 22q11.2 deletions; FISH analyses were performed by using one of the locus specific probe (DiGeorge/VCFS TUPLE 1 probe) to the group of patients (23 patients group, 10 patients in control group-1 and 13 patients in control group-2) that can not be defined 22q11.2 deletion with Giemsa-trypsin banding method and karyotyping. The prevelance of 22q11.2 deletion in patients with CTHD and dysmorphic findings is 26%(6/23), and the group of patients with not have CTHD but have dysmorphic findings (control group-1) is 30%(3/10). In our results, no significant difference between the
Gonadal dysgenesis in a phenotypic girl with derY,t(X;Y)(p11.4;q11.21) responsible for DAX1 gene duplication Pichon, Hans, Van Herreweghe, Heinrichs and Sznajer Hoˆpital Erasme-ULB, Hoˆpital Erasme-ULB, Clinique Universitaire St Pierre, HUDERF-ULB, HUDERF & Hoˆpital Erasme-ULB We report a first child born from healthy unrelated Caucasian parents. After uneventfull pregnancy and delivery, a phenotypic girl was born showing facial dysmorphism with narrow palpebral fissures, frontal bossing, thick hair, depressed nasal bridge and gingival cyst. Chromosome analysis from lymphocyte cultures revealed 46,X,der(Y) karyotype. Specific FISH analysis of the Y derivative chromosome showed the presence of the Yp arm including the SRY gene, the Y centromere and a long arm made up of the distal part of Xp. High resolution metaphase CGH confirmed the partial Xp duplication and Yq deletion. Sex reversal has been described in individuals with functional Xp disomy containing two active copies of the Xp21 FDosage Sensitive Sex reversal_ locus in the presence of an intact SRY gene. Using a FISH probe containing the DAX1 Xp21 sex reversal gene, we identified the presence of two copies of this locus: one on the normal X chromosome and one on the Y derivative chromosome. The propositus displayed normal female external genitals but extensive investigation showed an abnormal vaginal cavity and two primitive intra-abdominal gonads presenting testis differentiation. Surprisingly, two copies of the steroid sulfatase (STS) Xp22.31 gene were detected
6th ECC: Abstracts
78 on the Y derivative chromosome: one in the X fragment as expected and one at the presumed (Y;X) junction. Analysis of Y paternal chromosome showed normal structure excepting unexpected presence of the STS gene next to the centromer in Yq. The presence of X material in the Y paternal chromosome is probably responsible for the rearrangement observed in our propositus. This patient underlined the phenotype associated with sex reversal due to DAX1 duplication.
of chromosome 5. Family 2: Cytogenetic analysis performed in a couple due to recurrent fetal loss revealed interstitial 9p+ in the female partner. This region was not stained on CBG banding, and on FISH analysis, with the use of the wcp 9 probe, it was painted uniformly with increased signal density. The same abnormality was detected in the father of the index case. To our knowledge, euchromatic variation involving the 5p13.1Y13.3 region has not been reported before. We emphasize that euchromatic variation/polymorphism can be encountered in daily clinical practice.
1.128-P
Two cases with euchromatic variation in 5P and 9Q Ozturk Sukru, Bayrak Aysegul, Cefle Kivanc, DumanNilgun,PehlivanDavut,KaramanBirsen, Basaran Seher and Palanduz Sukru *Istanbul University, Istanbul Medical Faculty, Department of Internal Medicine, Division of Medical Genetics, Istanbul, Sehremini, Fatih, Turkey, I Chromosomoal polymorphisms/variations are chromosomal alterations involving heterochromatic regions that can be observed on conventional cytogenetic analysis. They essentially have no effect on the phenotype. Heterochromatic regions which stain positiviley on C banding are composed of inactive DNA (constitutive chromatin); they are located in pericentromeric areas (1q, 9q, 16q and Yqh). Heterochromatic variations are considerably frequent in all populations. On the other hand, chromosomal alterations involving euchromatic regions with no effect on the phenotype have been reported infrequently. Such alterations, referred to as Beuchromatic variations^, can be observed as duplications or deletions. In this case report, we present cytogenetic findings in two families, which, to our knowledge, have not been reported before: duplications of 5p13.1Y13.3 and 9p11Y13. Family 1: We found 5p + on conventional cytogenetic analysis in two siblings with mental retardation and different dysmorphic features. Parental karyotype analysis revealed the same abnormality in the father. On CBG banding, this region was not stained and FISH analysis with wcp5 probe showed uniform painting
1.129-P
Molecular analysis of four pericentric Y chromosome inversions Il_ina, V. Chernykh, T. Tsvetkova, I. Mandron, E. Zaklyazminskaya and A. Polyakov Research Centre for Medical Genetics of RAMS The Y chromosome inversions are common chromosome abnormalities. We have examined four individuals with pericentric Y chromosome inversions. One patient was infertile man. Other three patients were: newborn male (proband), father and grandfather referred to chromosome analysis because of Down syndrome phenotype in proband. No genital abnormalities were mentioned in examined men. Chromosome analysis had been carried out on PHA-stimulated peripheral blood lymphocytes by standard techniques using GTG- and CBG- staining. Molecular study has been performed to analyze Y chromosome microdeletions. Genomic DNA had been extracted from peripherical leukocytes using standard method. Parents_ origin of aneuploidy had been determined by analysis of four following polimorphic markers: D21S11, D21S1888, D21S1890, and D21S1895. Y microdeletion analysis have been performed using multiplex PCR amplifications of SRY, AMG/AMGL, ZFY/ZFX loci and 21 Y-specific STSs. The karyotype of the infertile man was assessed as 46,X,inv(Y)(p11.2;q11.22). The karyotype of the newborn male was 47,X,inv(Y) (p11.2q11.23), +21 and that of his father and grandfather was 46,X,inv(Y)(p11.2;q11.23). The extra
6th ECC: Abstracts chromosome 21 has maternal origin determined by molecular analysis. No Y chromosome microdeletions were found in the infertile man. PCR amplifications have shown an absence of sY1192 marker in the proband and his father and grandfather. It is typical for b2/b3 deletion, partial deletion within AZFc region. It is remarkable that deleted sY1192 locus lies within IR1 localization where Yq breakpoint of Y chromosome inversion is situated. Possibly partial AZFc deletions in newborn male, his father and grandfather may be due to pericentric inversion in the ancestoral Y chromosome. The transmission of this rearranged Y chromosome through three generations demonstrated that at least some partial AZFc deletions even in association with inv(Y) polymorphism do not impair the male fertility.
79 translucency. With the ANEUVYSION probes, three signals from chromosome 13 were identified (13q14). G banding karyotype showed three acrocentric chromosomes compatible with chromosome 13. Re-examination of the metaphases of the previous prenatal test showed that the derivative chromosome was the same in both amniotic fluids. Metaphases from the mother’s blood culture were examined, confirming the implication of a third chromosome in the rearrangement. So, the mother’s karyotype was established as: 46,XX,t(11;21;13) (11pter Y 11q14::21q21 Y 21qter;13pter Y 13q14: :11q14 Y 11qter;21pter Y 21q21::13q14 Y 13qter). The fetal karyotypes were: 47;XX/XY, + der(21) t(11;21;13) (q14;q21;q14). At meiosis in the CCR heterozygote, a multivalent is probably formed by chromosomes 11, 21 and 13. In this case, we assumed a 4:2 segregation.
1.130-P
Prenatal diagnosis of a 4:2 alternate segregation as a result of a maternal translocation involving chromosomes 11, 21 and 13
1.131-P
Garcı´a-Barcina, Barren˜a, Onaindia, Echevarria, Garcı´a, Tapia, Go´mez, Garijo and Valverde
Doria, V. Lima, S. Fernandes, C. Madureira, L. Moreira, M. J. Pinho, S. Pereira, M. Sousa and A. Barros
Hospital de Basurto
Genetic Department - Faculty of Medecine of Porto, Institute of Biomedical Sciences Abel Salazar, University of Porto
A Complex chromosomal rearrangement (CCR) ocurring in phenotypically normal persons is rare and is assumed to be truly balanced. The carrier of a CCR has a risk for an abnormal conception due to either malsegregation of the derivative chromosomes or the generation of a recombinant chromosome. We report a case of a couple with a history of recurrent miscarriages. Karyotyping was performed and a balanced reciprocal traslocation between chromosomes 11 and 21 (46,XX, t(11;21)(q13,q11) was detected in the woman. They have a child with a cytogenetically normal karyotype and prenatal diagnosis in an other pregnancy showed an extra derivative chromosome formed as a result of a segregation 3:1 of the mother’s translocation. We analyzed the third amniocentesis of this couple and performed FISH because of an enlarged nuchal
Prevalence of sex chromosome abnormalities in 13630 karyotyped portuguese patients
Chromosome abnormalities are common in humans. Sex chromosome aneuploidies are the most common, with a frequency of 1 in 500 live births. The aim of this study was to determine the prevalence of sex chromosome abnormalities present in 13630 portuguese patients referred for karyotype analysis. Sex chromosome abnormalities were detected in 271 (1.99%) patients: 215 (79.3%) presented aneuploidies, 24 (8.9%) structural abnormalities of the X chromosome, 23 (8.5%) structural abnormalities involving the Y chromosome and 9 (3.3%) with sex reversal. Two groups were established: 9448 patients with infertility only (group 1) and 4182 patients referred for a cytogenetic study due to a suspicion of a chromosomal disorder (group 2). In group 1 213
6th ECC; Abstracts
80 (2.25%) sex chromosome abnormalities were found and 58 (1.39%) in group 2. Aneuploidies were the most frequent abnormalities observed in both groups. Klinefelter Syndrome (47,XXY) was responsible for 50.2% of the chromosomal aberrations observed in group 1 and Turner Syndrome (45,X) prevailed in group 2 (17.2%). These findings support the idea that cytogenetic analysis is crucial for the genetic counselling, not only for couples entering an Assisted Reproduction Programme, but also for the thorough investigation of patients with a low-level gonosomal mosaicisms and their correlation with the reproductive outcome.
1.132-P
Prevalence of structural autosomal abnormalities in 10248 infertile portuguese patients Lima, S. Doria, S. Fernandes, C. Madureira, C. Almeida, F. Lemos, F. Reis, S. Pereira, M. Sousa and A. Barros Genetic Department - Faculty of Medecine of Porto, Institute of Biomedical Sciences Abel Salazar, University of Porto Infertility is a health problem, defined by a failure to conceive after at least one year of unprotected intercourse and affects about 15% of couples in reproductive age. Cytogenetic analysis was performed in 10248 Portuguese patients referred for infertility or repeated miscarriage. The aim of this study was to evaluate the prevalence of structural autosomal abnormalities in these patients. Chromosome analysis was performed in 15 to 30 metaphases from peripheral blood lymphocyte cultures using G-banding in all patients. Additional cytogenetic characterization studies were performed (AgNor, DA-DAPI and FISH) if a chromosomal aberration was present. Structural autosomal abnormalities were found in 122 (1,19%) patients, 76 men (0,74%) and 46 women (0,45%). Sperm concentration information was obtained from 27 male patients (35,5%), 55,6% of which were oligozoospermics (n=15). The most frequent structural autosomal anomalies were recip-
rocal translocations (58,2,%), followed by Robertsonian translocations (24,6%), inversions (9,0%) and other structural aberrations (8,2%). In conclusion, the cytogenetic studies should be performed routinely in infertile couples before entering an Assisted Reproductive Techniques, followed by genetic counselling and eventually preimplantation genetic diagnosis and/or prenatal diagnosis if abnormalities were found.
1.133-P
45,X maleness resulted from mosaic X;Y translocation/insertion Chukhrova, V. Chernykh, V. Antonenko, S. Vyatkina, N. Shilova, T. Zolotukhina, L. Kurilo and A. Polyakov Research Centre for Medical Genetics of RAMS, Institute of Obstetrics and Gynecology of RAMS The translocations between X and Y chromosomes are rare cytogenetic findings. Commonly, the translocations involving sex chromosomes lead to anomalies of gonadal development and/or infertility. We report a new case of an 45,X male that resulted from an abnormal X-Y recombination. The proband was 1.5-month infant male with prominent congenital progressive hydrocephaly, ichthyosis, severe motor retardation and external genitalia with no sexual ambiguity. The chromosome examination was carried out on peripheral blood lymphocytes using GTG-, C- and QFH-staining. FISH analyses were performed on lymphocyte metaphase spreads and interphase nuclei using standard protocols with the following DNA probes: DXZ1, DYZ3, Yqh, WCPY, WCPX, PCPX, LSI SRY, and LSI Xp21. Molecular investigation was carried out on DNA extracted from peripheral leukocytes. Breakpoint analysis was performed using multiplex PCR amplifications of SRY, AMG/AMGL, ZFY/ZFX loci and fifteen Y-specific STSs. X chromosome hemizygosity was evaluated by analysis of CAG-repeats in exon 1 of AR gene, and six X chromosome markers (DXS1062, DXS1192, STR44, STR45, STR49 and STR50). Cytogenetic analysis of the proband showed a mosaic
6th ECC; Abstracts karyotype, 45,der(X)t(X;Y)(p22.3;p11.3)ins (X;Y)(p22.3;q12q12)[41]/45,X[9]. In situ hybridization demonstrated the presence of the derivative X including Y-chromosome material (Yp11.3 and the heterochromatic region of Yq) in band Xp22 in 82% of the metaphases and did not detect any numerical gonosomal mosaicism. Molecular analysis revealed Yp material including SRY locus and confirmed an X-chromosome hemizygosity. Evidently insertion of Y-chromosome material in Xp22.3 has impaired the STS gene, and, possibly, some of the neighboring genes.
1.134-P
Interstitial duplication 16q Hansson, C. A. L. Ruivenkamp, A. Gijsbers, J. G. Dauwerse, M. M. L. van Diepen, E. Kasljevic and S. G. Kant
81 parents had a normal karyotype. Genotype Y phenotype correlations are important for genetic counselling in cases of partial aneuploidies.
1.135-P
Molecular cytogenetic analysis of 6 patients with 2q37 monosomy and review of the reported cases: an attempt at defining the key features and the critical deletion regions G. De Canal, M. T. Bonati, L. Ballarati, P. Finelli, C. Valtorta, M. Zollino, M. Zollino, L. Larizza and Giardino Daniela IRCCS-Istituto Auxologico Italiano, Ospedale G. Rummo, Benevento, Universita` Cattolica di Roma, Universita` degli Studi di Milano, IRCCS-Istituto Auxologico Italiano
Leiden University Medical Center
Interstitial duplications in the long arm of chromosome 16 are rarely encountered. We report a nine month old girl who was referred for karyotyping at the age of four months because of rightsided hearing loss and dysmorphic features. She showed exotropia, amblyopia, mild frontal bossing and earpits on both sides. Her anterior fontanel was very small. The palmar creases were abnormal and on one hand a very small postaxial polydactyly was found. A cardiac murmur was heard due to a small muscular VSD. She showed frequent overstretching but also a head lag. At the age of 9 months her psychomotor development was clearly delayed. She had also developed a mild scoliosis. Conventional chromosome analysis (GTG-banding) revealed an interstitial duplication in the long arm of chromosome 16. With a 250 K SNP array (Affymetrix) the size of the duplication was estimated to be õ25.9 Mb, the region between q11.2 and q22.2 being duplicated. Fluorescence in situ hybridization with two probes in band q12.1 and two probes in band q22.1 showed that the duplication was inverted. The karyotype was defined as 46,XY,dup(16)(q22.2q11.2). Both
Terminal deletion of 2q37 region have been associated with the recognizable pattern of clinical features related to Albright Hereditary Osteodystrophy (AHO)-like syndrome, also known as brachydactylymental retardation syndrome (MIM600430). To date, about 100 patients with 2qter deletion or monosomy resulting from an unbalanced translocation have been reported. In the majority of cases, the breakpoint of the rearrangement has been determined by means of conventional cytogenetics or subtelomeric FISH studies. Only recently detailed analyses using FISH with multiple clones and microsatellite markers have been performed, making it possible to establish the extension of the deleted interval and to address karyotype-phenotype correlations. Significant variability in phenotypic expression has been observed, with mental retardation and facial dysmorphisms present in almost all the patients, brachymetaphalangism in about 50%, congenital heart defects in 20%. Urogenital anomalies, epilepsy, eczema, autistic behaviour have been repeatedly reported in patients with 2q37 monosomy. In most patients, the karyotype-phenotype correlations is complicated by the frequent association with trisomy for other chromosomes, due to the malsegregation of
6th ECC; Abstracts
82 a parental balanced translocation. Here we present 6 patients with the clinical features of brachydactylymental retardation syndrome and 2qter rearrangements, accurately characterized by FISH. A pure 2qter deletion was detected in 3 subjects, with the breakpoint located respectively at 9,1 Mb, 7,8 Mb and 5,4 Mb from the telomere. In 3 cases an unbalanced translocation leading to 2qter monosomy and associated 6qtel, 8qtel and 16qtel was diagnosed, with the 2q breakpoint at 7,8 Mb, 5,1 Mb and 3,4 Mb from the telomere. We compare these patients to the about a hundred previously reported cases, in an attempt at defining the AHO-like syndrome key phenotypes, the critical deletion region and candidate genes there mapped.
performed in cultured and uncultured amniocytes. Results and it_s interpretation will be presented.
1.136-P
Translocation between chromosome 2 and 5 has been reported in two cases up to now. In first case, t(2;5) resulted in a trisomy 5p in a patient with dysmorphic features. In the second case, t(2;5) was reported in a patient with dysmorphic features and autism. A 9 year-old male patient was referred to the genetic department with complaints of micropenis and learning disability. The patient was the first child of a consanguineous marriage couple and had a healthy sister. Physical examination was normal except for micropenis. He had a history of delayed speech starting at age. Otolaryngological examination including hearing tests showed normal results. The levels of total testosterone and free testosterone were G20 ng/dl and 0.1 ng/dl, respectively. After stimulation test, total testosterone level increased to 368 ng/dl and free testosterone to 1.9 ng/dl. The other hormonal, biochemical and hematological tests were normal. Cytogenetic analyses performed by using conventional peripheral blood culture methods revealed a 46,XY, t(2;5) (q31Yqter;q13Yqter) karyotype. FISH analyses, using 5p telomere-specific probe and whole probe for chromosome 2, confirmed the t(2;5). Family screening showed that the same translocation was present in the father of the patient. His mother and sister had normal 46,XX karyotype. Physical examination of the father did not show a micropenis. The breakpoints in the present case are different from the two cases reported formerly, first case; t(2;5)(q36;p11) and the second case; t(2;5) (q31.1;q23.2). In the two cases, the cause of the
A complex case at prenatal diagnosis Pinto Leite, M. Souto, B. Carvalho, B. Marques, F. Carvalho and E. Ribeiro Centro Hospitalar de Vila Real-Peso da Re´gua, INSA, Faculdade de Medicina da Universidade do Porto Ultrasonography allows the early detection of fetal development. Although ultrasound scan at 10Y14 weeks of gestation is a routine analyse to detect congenital anomalies, there are still several situations where a late diagnostic has been done. We report a case of a young pregnant woman with an abnormal ultrasound scan at 21 weeks of gestation, revealing a fetus with ecographic anomalies, including complex cardiopathy, cleft lip and sexual ambiguity. It_s a first pregnancy of a young, health, non-consanguineous couple with a normal familial history. Due to ecographic anomalies amniocentesis was performed and FISH in uncultured amniocytes revealed trisomy 18 that was confirmed by MLPA technique. The couple elected termination of pregnancy. Unfortunately it was not possible to achieve skin, cord blood and placenta samples. Surprisingly, the cytogenetic analysis revealed trisomy 3, in all metaphases of two different cultures. FISH, alfa-satellite probes for chromosome 3 and 18 and QF-PCR with 10 STRs for chromosomes 13, 18, 21, X and Y were
1.137-P
Familial t(2;5) in a patient with micropenis Tatar, Zeynep Ocak, Abdulgani Tatar, Ahmet Yesilyurt, Hakan Doneray, Tahsin Yakut and Sitki Oztas Ataturk University, School of Medicine, Uludag University, School of Medicine, Department of Medical Genetics
6th ECC; Abstracts
83
clinical conditions were the extra chromosomal aberrations, trisomy 5p in the first case and deletion in chromosome 6 in the second case. Although the father of our patient had the same translocation as his son, he did not have a micropenis. So, we suggest that our patient may have another submicroscopic chromosomal pathology, or that there is a variation in gene expression, or that the relation between abnormal phenotype and karyotype might be coincidental.
1.138-P
Complex chromosomal aberration in a boy with hypotonia, speech delay, mental retardation and sialorrhea 1
1
Eftychia Dimitriadou, Iliana Lalou, Iliada Nakou,2 Meropi Tzoufi,2 Theodora Mantziou,1 Voula Christopoulou,3 Voula Velissariou3 and Maria Syrrou1 1
Genetics Unit, Laboratory of General Biology, Medical School, University of Ioannina, Ioannina, Greece; 2Division of Pediatrics, Medical School, University of Ioannina, Ioannina, Greece; 3 Cytogenetics Laboratory, Department of Genetics and Molecular Biology, Mitera Hospital, Athens, Greece Complex Chromosomal Rearrangements (CCRs) involve translocations among three or even more chromosomes. We report here a de novo CCR involving three chromosomes, i.e. 2, 5 and 7 with more than four breakpoints in a 3.5 year old boy with hypotonia, speech delay, mental retardation and sialorrhea. Conventional cytogenetic analysis (GTGbanding) revealed a CCR involving chromosomes 2, 5 and 7. Fluorescent in situ hybridization (FISH) was performed for a more accurate assessment of the aberration, using four probes: whole chromosome painting probes for chromosomes 2 (FITC-labeled, Cytocell), 5 (fluorescein-labeled, Q-biogene) and 7 (Texas Red-labeled, Cytocell) and the specific for the critical region of cri-du-chat syndrome probe (cri-duchat (5p15.2) / 5p15.31 (D5S89)) (Qbiogene). All probes confirmed the existence of the aberration. Array-CGH analysis is in progress in order to determine if there has been loss or gain of genetic
material. Keywords: complex chromosomal rearrangement (CCR), mental retardation.
1.139-P
Spontaneous fetal losses in a family with t(1;8): an evidence of Malsegregation Alkan, Abdulgani Tatar, Ahmet Yesilyurt, Zeynep Ocak, Bunyamin Borekci and Sitki Oztas Ataturk University, School of Medicine Translocation between chromosomes 1 and 8 was reported in two families up to now. In first family, spontaneous abortion rate was higher in translocation carrier couples than couples with a normal karyotype, and the rate of offspring with translocation in the carrier families was higher than expected. In second family, the patients with t(1;8) were also diagnosed with Gilles de la Tourette syndrome. A 15 years married couple, a 36 year old female and a 40 year old male, was referred to the genetics department because of a history of 8 miscarriages in the first trimester. The family history of the man was unremarkable but the mother of the female patient had 4 miscarriages. In both patients, physical examination and hormone, biochemical and hematological tests were also normal. Cytogenetic analysis performed by using conventional peripheral blood culture methods revealed a 46,XX,t(1;8)(q25;p21) karyotype in the female patient and a 46,XY normal karyotype in the male patient. Although couples with translocation carrier have a chance to produce normal (or balanced translocation carrying) gametes at a range of 1:2, there are some reports in which partial monosomic or trisomic gametes had been seen in a range of higher than expected. This condition may result from individual variations, or trisomy or monosomy of the chromosomes without translocation in pregnancy because of advanced maternal age. In our case, all 8 pregnancies had ended in first trimester miscarriage. Therefore, we thought that the cause of the abortions could be the unbalanced inheritance of the translocation, and this situation was an evidence of malsegregation.
6th ECC; Abstracts
84 1.140-P
Pseudo hermaphrodism in an Iranian family with Mental Retardation Ghasemi Firouzabadi, Dr. K. Kahrizi, Dr. H. Najmabadi, Ms. F. Mojtahedi, Mr. Y. Heshmati, Mr. M. Fakhri, Mr. R. Vazifehmand and Dr. F. Behjati Genetic Research Center, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran We report a large consanguineous family from southern Iran affected with both hermaphrodism and mental retardation (MR). Parents were first cousins and had eight children, one boy and seven girls. Three of the girls were mentally retarded. Two of the MR patients and one of the normal girls had coarse masculine features. Their karyotype was 46, XY. All these three patients had high testosterone level. Parents and their sibs had normal karyotypes. Mental retardation seems to be of autosomal recessive nature while pseudohermaphrodism is an independent entity. The full genetic and clinical implications of the above findings will be presented. 1.141-P
Apparently balanced translocation in a man with oligoasthenozoospermia Lalou Iliana, Dimitriadou Eftychia, Tsoumani-Chroni Andromahi, Contostanou Sophia, Sofikitis Nikolaos and Syrrou Maria University of Ioannina Chromosomal abnormalities are more common in infertile men than in the newborn population and the incidence of chromosome abnormalities is especially high in men with oligozoospermia. The probability of finding a reciprocal translocation in a male with oligozoospermia is 0.7%, about 2.8 times higher than in the newborn population (0.25%). Here, we present a 40-year-old man with an apparently balanced chromosomal translocation and secondary infertility. Semen analysis in two samples showed severe oligozoospermia (G1106 sperm/ml) and astheno-
zoospermia (G50% motile sperm). Sperm morphology could not be evaluated due to low sperm concentration. After hormonal analysis, FSH was found elevated (17.6 mIU/ml) and total and free testosterone diminished (159 ng/100 ml and 9.6 pg/ ml, respectively). The proband_s G-banded karyotype revealed a balanced translocation between chromosomes 2 and 18, karyotype 46, XY, t(2;18) (q14;q21) and FISH analysis confirmed this finding. His only son (age 5 years old) was found to carry the same translocation. 1.142-P
Chromosomal abnormalities presented with seizures Volkan-Salanci, Gulen Eda Utine, Yasemin Alanay, Dilek Aktas, Koray Boduroglu, Mehmet Alikasifoglu and Ergul Tuncbilek Hacettepe University Clinical Genetics Unit Many chromosomal aberrations present with clinical features with seizures as well as mental retardation. Seizure types vary including infantile spasms, partial seizures, generalized tonic clonic seizures or absance spells. Most of these occur due to a haploinsufficiency of genes that are responsible from neural development or function. Chromosomal abnormalities lead to the discovery and mapping of these susceptibility genes, therefore identify the knowledge of genetic basis of the epilepsies. In this poster presentation the authors would like to discuss two cases of rare chromosomal aberrations presented with seizures. Both patients had deletions at the long arm of chromosome 18: del(18)(q12.1-9q12.3), and del(18)(q21.2-9qter). Both patients had common features of neonatal onset seizures, hypertelorism, cleft palate and hypotonicity. Genes mapping from 18q21 to qter include myelin basic protein. The patients carrying this chromosomal abnormality usually have partial seizures mainly occurring in the early years of life. Other common features are mental retardation, hypotonie and MRI display abnormalities at the white matter as presented in our case. The authors aimed to discuss the possible candidate genes related to seizures in the presented cases with the review of the literature.
6th ECC; Abstracts 1.143-P
A de novo complex chromosome rearrangement with the breakpoints 8q24.13, Rosti, Birsen Karaman, Hu¨lya Kayserili, Nuray Kirmizi and Seher Basaran Istanbul University, Istanbul Medical Faculty
We report here a case with dysmorphic features, polysyndactyly and psychomotor mental retardation, who has an apparently balanced de novo translocation between chromosomes 8 and 13 as well as a de novo insertion within the chromosome 2 itself. The index was referred to our department due to polysyndactyly and psychomotor retardation. Physical examination of the index at the age of two years revealed corrected polysyndactyly, between 3rd and 4th finger complicated with mesoaxial polydactly of both hands, psychomotor mental retardation, microcephaly, down slanted palpebral fissures, prominent eyelashes, smooth philtrum, low-set ears, bilateral hockey creases, camptodactyly of 2nd and 3rd fingers of the left hand, duplication of the 3rd finger of the right hand. Chromosome analysis was performed on the basis of dysmorphic features and psychomotor retardation. Chromosome analysis of the index on peripheral blood lymphocytes by using GTG banding revealed an apparently balanced translocation between chromosomes 8 and 13 with the breakpoints of 8q24.13 and 13q21.1 as well as a rearrangement involving chromosome 2. Parental karyotypes were normal. According to the GTG banding pattern, an insertion within chromosome 2 was suspected. FISH study of the index case by using wcp 8, 13, 2 and probes for telomeric regions of chromosome 2 demonstrated a balanced translocation between chromosomes 8 and 13 as well as a fully painted chromosome 2 with intact telomeric caps. Further FISH study by using arm specific probes for chromosome 2 supported this observation. However, the breakpoints for the insertion could not be determined definitely. The karyotype was interpreted as 46,XY,t(8;13)(q24.13;q21.2), ins(2) (p16.2q33.2q22.2?) The case warrants to be reported since it displays two de novo rearrangements with 5 breakpoints. The correlation between the possible
85 disrupted genes within the given breakpoints and the phenotype of the case will be discussed. 1.144-P
Pericentric inversion of chromosome 8 and paracentric inversion of the long of arm of chromosome 11 in the male partner of a couple presenting with recurrent miscarriage Cefle Kivanc, Erkal Haluk, Karaman Birsen, Ozturk Sukru, Basaran Seher and Palandiz Sukru Istanbul University Istanbul Medical Faculty, Department of Internal Medicine, Division of Medical Genetics Recurrent miscarriage (RM), defined as at least two or three pregnancy losses, affects 5% of couples. Among the many etiological factors, the most notable are fetal aneuploidy, balanced chromosomal rearrangements, structural abnormalities of the uterus, infection, endocrine and immune abnormalities and thrombofilic disorders. We describe a very rare co-presence of pericentric inversion of chromosome 8 and paracentric inversion of the long arm of chromosome 11 in the male partner of a couple presenting with RM. A couple had been referred to our laboratory for cytogenetic analysis due to two fetal losses. Cytogenetic analysis with high resolution banding (HRB) revealed two inversions involving two different chromosomes: pericentric inversion of chromosome 8 and paracentric inversion of the long arm of chromosome 11 in the male partner; hence the karyotype was 46, XY, inv (8)(p21q22), inv(11)(q14.2q25). Molecular cytogenetic studies using whole chromosome painting probes for chromosome 8 and 11 showed that both derivative chromosomes were fully painted, excluding the presence of any material from any other chromosome. So, the cytogenetic findings of HRB was confirmed. The karyotype of the female partner was normal. In about 5Y8% of couples with two or more losses, one partner carries a balanced chromosomal rearrangement, most frequently reciprocal and robertsonian translocations. However, inversions are identified only in %0.3 of recurrent aborters. To our
6th ECC; Abstracts
86 knowledge, the co-presence of two independent inversions in two different chromosomes has not been reported so far. Genetic counseling is complicated in such cases due to the lack of published data. Segregation analysis of the present case showed that 25% of the conceptions might result in a viable product with a normal karyotype or carry balanced inv (8) and/or balanced inv (11). This case shows the importance of careful cytogenetic evaluation in RM with respect to appropriate genetic counseling. 1.145-P
The increase of nors expression in Buccal Mucosa cells of Down_s syndrome (trisomy 21) infants Secil Ilhan Yilmaz and Halil Demirtas Department of Medical Biology, Medical Faculty, Erciyes University, Kayseri, Turkey The extra chromosome 21 of the regular trisomy 21 or Down syndrome (DS) patients contains an average of 40 extra copies of rRNA genes and the regulation of the activity of these genes appears to be impaired in lymphocytes (cells from mesodermal origin) of DS infants. The objective of this study was to compare the nucleolus organizer regions (NORs) expression patterns between DS patients and controls in a tissue sharing the same embryonic (ectodermic) origin with the brain. For this purpose, buccal mucosa cells were used. Since the AgNOR staining is an indicator of the active rRNA genes, comparison of the image analysis values of the AgNOR area in buccal mucosa cells of DS patients (N=22, 0Y8 years old, average age: 21.50 T 23.17 months) and controls (N=22, 0Y8 years old, average age: 22.32 T 23.40 months) provided a plausible conclusion about the regulation/deregulation of the rRNA genes in these cells of DS babies/ infants. The proportion of the nucleolus organizer regions area to the total nuclear area (NORa/TNa) was calculated using an in-house computer program. Fifty buccal mucosa cells were analysed for each individual to determine the average NORa/TNa value per individual. In contrast to healthy controls, NORa/TNa proportion value of buccal mucosa cells from DS patients found significantly higher than that of the controls: 4.08 T 1.16% and 2.13 T 0.55% respectively (pG0.001, 2- tailed independent sample
t-test). This 92% increase is far higher than the expected value (õ13% increase of the normal value) due to the extra rRNA genes on the chromosome 21. DS babies/ infants exhibit very higher NORs expression increase in their buccal mucosa cells compared to controls which may give us a clue about the explanation of the DS phenotype due to the wasted energy while producing unnecessary rRNA transcript and AgNOR proteins beginning in utero during embryogenesis. It has also been discussed if the NORa/TNa value from buccal mucosa cells of DS babies/infants may be used as a rapid pre-diagnostic procedure for DS children. 1.146-P
Breakpoints distribution in reciprocal translocations and inversions detected at prenatal diagnosis N. Clusellas and A. de Lara Hospital Clı´nic de BarcelonaCytogenetic prenatal studies are an interesting material to estimate rates of mutant and inherited structural rearrangements in human population and to study the frequency of chromosomes involved and the distribution of the breakpoints. With the purpose of compiling as much as possible amount of structural chromosome abnormalities, we developed a collaborative database in the web site BAsociacio´n Espan˜ola de Diagno´stico Prenatal^. After two years, database contains data from eight centres and information about 400 structural chromosome abnormalities found among 53,706 prenatal cytogenetic studies. Here, we analyzed the chromosome involved and the distribution of the breakpoints in 139 reciprocal translocations and 100 inversions collected in the Spanish register. In reciprocal translocations, all the chromosomes are involved and the distribution of the breakpoints seems to be influenced by chromosome size. However, there is and excess of breakpoints on chromosomes 5, 7, 14 and 17 and a lack of breakpoints on chromosome 2, 8 and 19. In inversions, the distribution of breakpoints observed differs from the expected according the chromosome length. There is an excess on chromosome 2, 10, 12 and Y, some of them correspond to the common inversions. There is a lack of breakpoints in many chromosomes, especially on chromosomes 9, 15, 19,
6th ECC; Abstracts 20 and 22 without any breakpoint. The distributions of the breakpoints along chromosomes are frequently observed in the median position, but they tend to be more distal in unbalanced foetus than in prenatal diagnosis of families with spontaneous abortions. Breakpoints are more frequently encountered in Gnegative bands (78%) than in G-positive bands. We also analysed other factors, as gene density, presence of segmental duplications that may contribute to formation of structural rearrangements. 1.147-P
87 Table 1. Primary infertility
Secondary infertility
46,XY,t(10;12)(q11.2;q13.1)
46,XX,t(1;19)(p10;q10) 46,XX,t(4;6)(q21.2;q21)
46,XX,inv(9)(p11q12) 46,XY,inv(9)(p11q12) 46,XX,inv(10)(p12q21)
46,XX,inv(8)(p21.2q21.3) 46,XX,inv(9)(p11q12) 46,XY,inv(9)(p11q12)
mos 45,X[3]/47,XX,+mar[2]/ mos 45,X[2]/47,XX,+mar[2]/ 48,XXX,+mar[1]/46,XX[94] 47,XX,+mar[3]/46,XX[97]
46,XX,[96] mos mos 45,X[2]/47,XX,+21[2]/ 47,XXX[1]/46,XX[95]
Cytogenetic analysis in 257 patients with reproductive problems N. G. Gorovenko, O. G. Ievseienkova, L. I. Brishevac, D. V. Solodovnikova, V. J. Sirenko and F. V. Dakhno National Medical Academy of Post-Graduate Education named after P.L.Shupyk , Institute of Reproductive Medicine Infertility can be a result of chromosomal abnormalities in 2.8Y13.1% of infertile couples: in females 1.1Y9.8% and in males 2.1Y14.3%. Materials and methods: Cytogenetic investigations were performed on 257 patients with reproductive problems - primary infertility (group 1) and secondary infertility (group 2) which needed in assisted reproductive technology. Results: The overall frequency of chromosomal abnormalities was 34,65%. The frequency of chromosomal abnormalities was seen to be higher in females (27,29%) than in males (7,36%). The frequency of chromosomal abnormalities was similar in the group 1 (17,38%) and in the group 2 (17,27%). Sex chromosome abnormalities were detected in 2,46% of the males in the group 1 and in 21,38% of the females in the both groups. Chromosomal abnormalities which were detected in both infertility groups are shown in Table 1. Conclusions: High frequency of chromosomal abnormalities which were detected in patients with reproductive problems suggested that cytogenetic analysis and genetic counseling on infertility couples with either primary or secondary infertility should be performed before the application of an assisted reproductive technology.
1.148-P
A case of placental mesenchymal dysplasia characterised by non-clonal chromosome abnormalities Crawford, K. Rippard, S. Imrie, A. Howatson, C. Mcconnell, M. Whiteford and G. Lowther Duncan Guthrie Institute of Medical Genetics, Pathology Department, Yorkhill Hospital, West of Scotland Regional Genetics Service, Ferguson Smith Centre for Clinical Genetics Placental mesenchymal dysplasia (PMD), also known as pseudo-partial mole, is a rare disorder with approximately 51 cases reported worldwide. Placentas with PMD are typically larger than average and show cystic areas on ultrasound but can co-exist with a completely normal fetus; however intrauterine growth restriction and fetal or neonatal death is common. PMD has also been shown to be associated with androgenic/biparental mosaicism and most reported cases of PMD have a normal female 46,XX karyotype. The proband in this case is a non-dysmorphic, growth retarded female infant born at 34 weeks gestation. The pregnancy had been uncomplicated but ultrasound scanning at 30 weeks had suggested an unusual appearance to the placenta. At birth the infant was pale and noted to have a distended abdomen secondary to hepato-splenomegaly. The infant subsequently made good progress and was discharged aged 19 days. During the investigation into the abnormalities in this patient a chorionic
6th ECC; Abstracts
88 villi sample was sent to the cytogenetic department for karyotyping. The analysis of this sample revealed a normal female karyotype in 74% of cells with the remaining 26% showing random, nonclonal chromosome abnormalities. Skin and blood samples were then received both showing normal female karyotypes with no evidence of the abnormalities seen in the villi sample. This case was then referred to the molecular department who compared parental DNA profiles with the profiles from the villi, blood and skin samples. These results showed androgenic/biparental mosaicism in the uncultured villi sample, paternal uniparental isodisomy in the cultured villi cells, and normal biparental inheritance in cultured skin and lymphocyte cells from the baby. These finding along with the clinical finding confirmed the diagnosis of PMD in this new-born. To our knowledge this is the first reported case of PMD to show the karyotypic abnormalities identified here.
1.149-P
Chromosomal aberrations in spontaneous abortions Petrovic and A. Ljubic Institute for Gynecology and Obstetrics, Clinical Center of Serbia The aim of this study was to determine the role of chromosomal aberrations in the etiology of spontaneous abortions. We analyzed the karyotype of placental tissue, taken from spontaneously aborted fetuses. Women included in the study were divided into two groups. In the first group there were 106 women under 35, and in the second group there were 65 women above 35 years of age. Tissue samples were obtained from the abortuses and processed using standard techniques. All specimens were G-banded using trypsin-Giemsa. Sixteen metaphase cell were analyzed for ther chromosome constitution, in each sample. For statistical analysis we used c2 test. From 171 analyzed cases there were 53 (31%) with an abnormal chromosomal constitution and 118 (69%) with a normal chromosomal constitution. Trisomy 21 was detected in 10 cases. Among sex chromosomal aberrations, only monosomy X was found in 7 cases. We found seven cases with trisomy
16 as well as seven cases of trisomy 18. Six cases of triploidy and six cases of trisomy 8 were detected. In three cases we found a marker chromosome. Two cases had trisomy 13. Tetraploidy, trisomy 2, trisomy 14, trisomy 12 and trisomy 20 were found in one case each. In the group of women under 35 (I group) the percentage of chromosomally abnormal fetuses was 26%, while in the group of women above 35 (II group), that percentage was 38%, but there was no statistically significant diference between groups I and II. c2=2,88Gc2(1 and 0,05)=3,841 Hereditary base mistakes are significant cause of spontaneous abortions in early pregnancy. Detection of chromosomal abnormalities gives us the oportunity to plan further treatment of reproduction disorders. 1.150-P
Comparative breakpoint analysis of cytogenetically detected Yq11.2 deletions and AZF microdeletions Chernykh, L. Kurilo, T. Tsvetkova, A. Chukhrova, T. Beskorovainaya, S. Gudzenko, E. Il_ina and A. Polyakov Research Centre for Medical Genetics of RAMS The origin of cytogenetically detected Y chromosome deletions is poorly understood. The aim of the present study was to analyze the localization of breakpoints in Yq macro- and microdeletions. We examined 49 men with Yq microdeletions (AZFa, n=4; AZFb+c, n=5; AZFc, n=40) and 11 patients with cytogenetically visible Yq11.2 deletions. The individuals with partial AZFc deletions were not included in the study. Chromosome analysis was performed on peripheral lymphocytes using standard cytogenetic techniques with GTG- and CBG- staining. AZF deletions were detected according to Laboratory guidelines of EAA/EMQN (1999), with some modifications. The deletion boundaries were determined analyzing proximal and distal loci of each of the AZF regions. The breakpoint mapping has shown that all AZF microdeletions were Fcomplete_. All five AZFb+c microdeletions were regarded as P5/distal P1 deletions. Seven of the 11 cytogenetically detectable Yq deletions covered AZFb and AZFc regions. The breakpoint of one Yq macrodeletion was mapped within the AZFb region
6th ECC; Abstracts distally to the palindrome P5 between sY1283 and sY127 loci. In four cytogenetically detected Yq deletions the breakpoints were localized within the AZFc region (n=3) or at its proximal border (n=1). Commonly, Yq macrodeletion breakpoints were mapped between AZFa and AZFb regions in the interval that displayed high Xp22.3/Yq11.2 homology. Comparative breakpoint analysis revealed obvious distinction in the predominant breakpoints localization between the Yq11.2 macro- and microdeletions. This indicates certain differences between the mechanisms involved in their formation. Evidently, the majority of Yq macrodeletions have not resulted from homologous recombination between Y chromosome palindromes. Apparently, at least half of terminal Yq11.2 deletions may originate from ectopic X-Y recombination during prophase of meiosis I. We suppose that interchromosomal recombination between high homology regions is a common mechanism, which may underly both translocations, and terminal deletions.
89 was normal with mild megaloblastic changes. Physical examination revealed severe short stature with 125 cm height (GG3rd centile), head circumference was small for age yet appropriate for height. She was mentally normal with good grades at school. The skin felt soft and doughy with prominent joint laxity. Both thumbs were slightly placed proximally. Her face was long with a narrow and high palate. There were multiple decayed teeth despite good care. No murmur was heard. Transthoracic echocardiogram was normal and an accessory spleen was detected in an abdominal ultrasound. We performed a routine high resolution karyotype analysis and a chromosomal breakage test with DEB. The karyotype result was: mos 45,X [25] / 46,X,i(Xq) [24] / 47,X, +2i(Xq) / 48,X,+3i(Xq). There was significant evidence for chromosomal breakage, DEB (+). These two findings are intruiging towards recent findings regarding an X-linked gene associated with Fanconi anemia. The gene encoding FANCB, is localized at Xp22.31. Further studies are planned to investigate this hypothesis.
1.151-P 1.152-P
Neutropenia and positive chromosomal breakage test (deb) in a mosaic turner case
A marker chromosome identified at prenatal diagnosis
Alanay, M. Alikas¸ifog˘lu, D. Aktas¸, K. Bodurog˘lu, G. E. Utine and E. Tunc¸bilek
Ercelen, Ebru Perim Onal, Havva Coskun Ucar, Meral Gultomruk and Gulleyla Kilic
Hacettepe University
VKV American Hospital
Turner syndrome (TS) affects 1/3000 liveborn females. The physical phenotype of TS is variable, and short stature may be the only finding. Approximately 5 to 10% of females with TS will demonstrate a 46,X,i(Xq). At least 1/3 of all patients with TS phenotype show chromosomal mosaicism with one 45,X cell line. Turner syndrome stigmata are less pronounced when the mosaic cell lines do not contain a Y chromosome. Many of these individuals demonstrate only short stature and gonadal dysfunction with few of the other well known features. We present an eleven years old girl referred for evaluation of short stature and proximally placed thumb. A previous complete blood count had shown low white blood cell count (3700/mm3), with an absolute neutrophile count of 700. She did not have anemia nor thrombocytopenia. A bone marrow aspiration
Supernumerary marker chromosomes (SMC) are Fadditional markers_ whose origin and composition cannot be determined by conventional cytogenetics. Molecular cytogenetic methods are necessary to identify these SMCs. In this case, a mosaic marker chromosome was detected at amniocentesis of a 40 year old woman referred for advanced maternal age. Pseudomosaicism was distinguished from true mosaicism by the analysis of cord blood cells. Once the true mosaicism was demonstrated, parental chromosome analysis were carried out and found to be normal. CBG,NOR and FISH studies demonstrated that the origin of this mosaic SMC is an disatellited dicentric chromosome 15 (47,XY,+idic(15;15) (q12;q12)[15]/46,XY[15]). FISH was performed with centromeric 15 probe both on paternal and fetal blood to further define the origin of the marker. It
6th ECC; Abstracts
90 was also noticed that both the fetus and the father have typical centromere constriction with G-banding and were positive with C-banding. FISH with a panel of the chromosome specific a-satellite probes and chromosome painting probes failed to show a signal on one chromosome 15. The alphoid DNA may have been severely or completely deleted from this chromosome 15, suggesting that a-satellite sequences may not be essential for normal centromere functions. Alternatively, this chromosome, as well as the father_s chromosome 15, may contain an activated latent centromere (neocentromere) through an unknown epigenetic mechanism (Choo 1997, 1998; duSart et al. 1997).
precedent for a deletion of 7q21 without phenotypic effect but many previous deletions transmitted from normal parents to normal children have also been ascertained at prenatal diagnosis and involve G-dark bands with low to moderate gene density (see Group 1 in Barber JCK, J Med Genet 2005;42:609Y629 or at (http://www. ngrl.org.uk/Wessex/collection/). The absence of phenotypic effect in this family further confirms that G-dark euchromatic deletions may be compatible with a normal phenotype and underlines the importance of analysing familial karyotypes even when apparently unbalanced structural rearrangement are found at prenatal diagnosis. 1.154-P
1.153-P
Transmitted interstitial deletion of band 7q21 without phenotypic effect; prenatal diagnosis of a new family
Review of chromosome aberration breakpoints in the context of ECARUCA (European Cytogeneticists Association Register of Unbalanced Chromosome Aberrations) project
Kilic, Meral Gultomruk, Ebru Perim Onal, Havva Coskun Ucar, Nesrin Ercelen, Viv K. Maloney and John C. K. Barber
Riegel, Rosa Baldinger, Alessandra Baumer and Albert Schinzel
VKV American Hospital, Genetics Disease Diagnostic Center, Istanbul. Turkey, Wessex Regional genetics Laboratory and National Genetics Reference Laboratory, Salisbury District Hospital, Salisbury, UK A 38-year-old woman (G1P0A0) was referred for prenatal diagnosis from amniotic fluid. An interstitial deletion of the G-dark band 7q21.3 was found in the fetus. Parental karyotyping by GTG-banding showed that the phenotypically normal father had the same deletion. The deletion was confirmed in fetal and paternal tissues using dual colour FISH with RP 11 library BACs from the Sanger Institute (www. ensembl.org/homo_sapiens/cytoview). BACs from sub-bands 7q21.13 and 7q21.2 were deleted and indicate a deletion of at least 3 Mb including 17 known genes. A BAC from medial 7q21.3 was retained indicating that the putative split hand and foot malformation 1 (SHFM1) locus was not deleted. The karyotype of the father was therefore 46,XY,del(7)(q21.13q21.3).ish del(7)(134N3,264N14-,94A10+). We are not aware of a direct
University of Zu¨rich Within the ECARUCA project, molecular cytogenetic re-examinations were performed for European laboratories with the aim to better define breakpoints in various structural chromosome aberrations. As the main aim of the Register is to better know and understand the phenotype and course of rare chromosome aberrations, it was considered important to precisely define the aneuploid segments with respect to karyotype-phenotype correlation. More than 200 patients were so far examined with molecular cytogenetic methods. The results of the studies proved to be very useful and not rarely surprising. The initial determination of breakpoints had to be revised in almost all cases. In some patients even the chromosome involved had not been correctly determined. Deletions in some cases concerned segments which were not even overlapping with the initially determined segment. Especially large was the discrepancy in instances of duplication-deletions. With the cytogenetic workup of cases in the context of the ECARUCA project we were able to clarify and better determine many aberrations. In addition, however, we
6th ECC; Abstracts showed the necessity to reinvestigate previously determined structural chromosome aberrations with molecular methods since it is evident that in many patients in whom especially de novo duplications, interstitial deletions and additional marker chromosomes were determined and/or published the aberration(s) determined will be either incomplete or incorrect or both. This will result in many revisions of initial karyotypes and lead to much better karyotype-phenotype correlation and new insights into the impacts of chromosome aneuploidy in humans.
91 revealed addition on the long arm of chromosome 14 [add(14)(q32)]. Parental blood karyotype disclosed normal karyotype in the mother (46,XX) and an insertion ins(14;5)(q24.1;q13q15) confirmed by FISH technique in the father. The aberration in boy was characterized further using FISH technique and the additional chromosomal material was proven to be of 5q origin, namely 5q13Yq15. Phenotypic differences between both patients and the differences in the results of conventional cytogenetic and FISH analyses may allow to define regions of chromosome 5q responsible for different phenotypic features.
1.155-P
Partial trisomy of 5q as a result of unbalanced insertion Drozniewska, Lauda-Swieciak Anna, Juraszek Anetta, Soszynska Krystyna, Skonieczka Katarzyna, Duszenko Ewa and Haus Olga Departament of Clinical Genetics, Collegium Medicum UMK, Bydgoszcz, Departament of Hematology, Medical University, Wroclaw Partial trisomies of chromosome 5 long arm were rarely described. In most cases they resulted from de novo duplications. In some patients the presence of additional copy of 5q was due to a balanced parental translocation. In very few patients it was caused by an insertion. We present two families where the partial trisomy of 5q was the result of a balanced insertion. In the first family, we report on two brothers with mental retardation and facial anomalies. Analysis of GTG-banded chromosomes demonstrated that the patients had an extra chromosomal material in the long arm of chromosome 2, presumably from chromosome 5. Fluorescence in situ hybridization (FISH) confirmed the origin of the material from chromosome 5. The karyotypes of these patients were established to be: 46,XY, GTG.ish.ins(2;5)(q13q22;q31),+5(q13q22). A balanced translocational insertion was detected by conventional GTG-banding studies and confirmed by FISH technique in their cousin, thus defined as an insertion carrier. In the second family, we report on a boy with psychomotor retardation, weight defficiency and facial anomalies. Routine cytogenetic analysis
1.156-P
High frequency of mosaic CREBBP deletions in RSTS patients and mapping of somatic and germline breakpoints Gervasini, Castronovo Paola, Bentivegna Angela, Mottadelli Federica, GiovannucciUzielli MariaLuisa, Faravelli Francesca, Pessagno, Tenconi Romano, Neri Giovanni and Larizza Lidia University of Milan, San Paolo Hospital, Medical Genetics School, University of Florence, Genetics, Galliera Hospital of Genoa, Gaslini Institute of Genoa, University of Padoa, Genetics, Cattolica University of Roma Rubinstein-Taybi syndrome (RSTS) is a rare malformation disorder caused by mutations in the CREBBP and EP300 genes accounting for up to 60% and 3% of the tested patients, respectively. About 10% of CREBBP mutations are deletions, often extending to flanking regions, with scattered breakpoints. By FISH and microsatellite analyses as first step of CREBBP mutation screening we identified in 60 Italian RSTS patients, six deletions, three of which present in a mosaic condition, a finding yet unreported. Using BAC clones and small-sized CREBBPprobes we could assess the extent of all deletions. Only two of the twelve breakpoints were found to encompass the same region, confirming the heterogeneity in size and boundaries of CREBBP deletions. However four of our five intragenic breakpoints clustered to the 5¶ end of CREBBP, around exon 2,
6th ECC; Abstracts
92 where a peak breakpoints underlying rearrangements in RSTS patients and tumors is apparent too. The search of genomic motifs did not evidence LCRs, as expected by the lack of a recurrent RSTS. By contrast, the percentage of interspersed repetitive elements, mainly Alu and LINEs is in the smaller 5¶CREBBP region around exon 2 significantly higher than that in the entire gene or the average in the genome suggesting this feature might be implicated in the vulnerability of the region to breaking. Search of EP300 microdeletions was also afforded by FISH, but no deletion carrier was identified among CREBBP-negative cases, pointing to a minor role of this second gene in the aetiology of RSTS. As to genotype phenotype correlation the clinical presentation was typical in all cases, although more severe in the three patients carrying constitutional deletions, raising.the issue of possible underdiagnosis of a subset of mild RSTS patients. No apparent correlations were observed between increase in the deletion size, from150 Kb to 2.6 Mb, and more severe phenotypic spectrum in the three patients carrying constitutional deletions. Supported by A.S.M. 1.157-P
The family with the multiple cases of the partial trisomy or monosomy of 22q13.3 or 7p22 due to familial subtelomeric reciprocal translocation t(7;22)(p22;q13.3), detected by FISH analyses Zaja˛czek Stanisław, Grygien´czo-Raz´niewska Edyta, Wierzba Jolanta, Sabiniewicz Robert, Iliszko Mariola and Sodowska Henryka Pomeranian Medical University Dept of Genetics and Pathology, Pomeranian Medical University, Szczecin, Poland , Dept. of Pediatry, Hematology and Oncology, Medical University, Gdan´sk, Poland, Dept. of Pediatric Cardiologyand Congenital Heart Malformations, Medical University, Gdan´sk, Poland, Dept. of Biology and Genetics, Medical University, Gdan´sk, Poland, Prenatal Medicine Outpatient Clinic GENOM, Ruda S´la˛ska, Poland We present a results of FISH analyses, performed in members of extended VI- generation family, carrying
reciprocal balanced, subtelomeric translocation t(7;22)(p22;q13.3). The proband was a 2-yr boy with partial, maternally derived, trisomy of 22q13.3 with signs of mild step psychoneurological retardation, epilepsy, ASDI+PDA, intraabdominal vascular anomalies, urethral reflux and multiple dysmorphic signs. Many other family members were also identified as a carrying the balanced translocation, partial trisomy or monosomy in region 22q13.3 and 7p22. 1.158-P
Familial translocation (2;18) ascertained through recurrent spontaneous abortions Bagci, Doc. Dr. Fusun Duzcan and Prof. Dr. Erkan Alatas Pamukkale University, Medical School, Dept. of Medical School, Pamukkale University, Medical School, Dept. of Gynecology and Obstetric We report a young woman who presented with a reproductive history of two recurrent spontaneous abortions. Genetic etiology of recurrent fetal loss is determined by the demonstration of parents_ chromosomal constıtution. Analysis of the family members from 2 generations revealed 3 phenotypically normal individuals carring the same reciprocal translocation. The great majority of apparently balanced translocations are associated with multiple miscarriages and normal phenotype. The proband’s karyotype was identified as 46,XX,t(2;18)(p15;p11.2) by giemsa banding techniques. The karyotypes of the proband’s father and brother are 46, XY,t(2;18)(p15;p11.2). Her sister had two spontaneus abortions, her chromosomal analysis could not determined because she lives in another city. Cytogenetic studies of the embryonic tissue derived from any of her spontaneous abortions have not been studied. Cytogenetic studies of unbalanced miscarriages are difficult due to the growth failure of early loss and usually macerated abortions. Reciprocal translocations are of great clinical importance. The carriers of balanced reciprocal translocations have increased risks of creating gametes with unbalanced chromosome translocations leading to miscarriages or children with abnormalities. Genetic counseling and Genetic testing is often offered to families carrying a translocation.
6th ECC: Abstracts 1.159-P
A 4 Mb deletion of chromosome 8p23.1 associated with mental retardation and mild systolic murmur Neroutsou, Thomaidou Loreta, Liehr Thomas, I. Saitis, P. Tsoplou, E. Manolakos and A. Metaxotou Bioiatriki S.A, First Department of Pediatrics Athens University, Institute for Humangenetic and Anthropology Jena, Germany A deletion of 8p 23.1 region (4 Mb) was found in a 3-year old boy from Greece, with speech and language delay. Conventional cytogenetic analysis was performed and a potential interstitial deletion was detected in the short arm of chromosome 8 with a breakpoint in p 23.1. Further clarification of 46,XY, del (8p) was carried out by molecular-cytogenetic analysis with multicolor banding, while FISH subtelomeric studies confirmed the deletion and the breakpoint appeared to be at the 8p 23.1Y23.2. In order to investigate delay and/or heart defects, three genes that are harbored at this chromosome region have been studied. Gata-binding protein 4 gene (GATA-4), localized to 8p 23.1Yp22, is known to give rise to heart defects when detected. Angiopoietin-2 (ANGPT-2) maps to 8p 23.1 and is involved in blood and vessel formation. Finally, microcephaly primary autosomal recessive 1 (MCPH 1), which also maps to the same chromosomal region is related with microcephaly. All three genes were detected in this young boy_s DNA with molecular techniques. Further studies are essential to determine the haploinsufficiency status of GATA-4, ANGPT-2 and MCPH-1 genes, as well as the clinical significance of the 8p 23.1 deletion. 1.160-P
Unbalanced translocation (15;18) in two brothers with isolated azoospermia Dupont, Leclercq, Eustache, Dupont, le Tessier, Baverel and Lebbar Groupe Hospitalier Cochin - Saint Vincent de Paul
93 We report on a 31-year-old man referred for chromosome analysis due to infertility caused by azoospermia. Sperm analysis revealed major abnormalities of the spermatozoon heads. Chromosomal analysis by conventional karyotyping detected an apparently unbalanced translocation 45,XY, der(18)t(15;18) (q11.2;q23). Clinical evaluation of the patient reported no dysmorphic features and no impairement in cognition. His brother who also presents isolated azoospermia was found to have the same chromosomal abnormality. Additional FISH studies with locus specific BAC probes confirmed the unbalanced status of the rearrangement, resulting in a terminal deletion of approximately 3 Mb on the long arm of chromosome 18 and the loss of the der(15)t(15;18) in all examined cells. The myelin basic protein (MBP) gene and the galanine receptor (GALNR) previously involved in 18q deletion syndrome (Cody 1997) are localized centromeric to the breakpoint on 18q23 and are not deleted in our patients. The 2 Mb associated monosomy of the proximal 15q region do not include Prader-Willi/Angelman critical regions. This pericentric region of chromosome 15 contains truncated or non-fonctional copies of genes (Fantes 2002) and copy number variations are considered euchromatic variants. Chromosomal abnormalities are reported in almost 13% of infertile men with azoospermia (Mau-Holzmann 2005) and rarely affect autosomal chromosomes. To our knowledge, we report here the first case of unbalanced autosomal translocation diagnosed in two azoospermic brothers. Phenotypegenotype correlation, evaluation of the risk for the offspring and appropriate assisted reproductive management are discussed.
1.161-P
Microinversion 8p23, idic(8)(p23) and invdupdel(8p): genesis of a chromosome abnormality Lebbar, F. Baverel, C. Dupont, G. Viot, D. Doummar and J. M. Dupont AP-HP; Universite´ Paris Descartes, Faculte´ de Me´decine, Hoˆpital Cochin, Laboratoire de Cytoge´ne´tique; 123 Bd de Port Royal, Paris, AP-HP, Hoˆpital Cochin, Service De Gyne´cologie Obste´trique, AP-HP, Hoˆpital Trousseau, Service de Neurope´diatrie
6th ECC: Abstracts
94 Inverted duplication deletion of 8p [inv dup del (8p)] is a complex chromosome 8 rearrangement with an estimated prevalence of 1/10,000Y15,000 newborns. It consists of a distal deletion 8p23-pter, an intact intermediate segment and an inverted duplication of various extents. The phenotype of patients with inv dup del (8p) include severe mental retardation, agenesis/hypoplasia of the corpus callosum, facial dysmorphism, congenital heart disease, orthopedic abnormalities, and hypotonia. The proposed mechanism of formation of inv dup del (8p) requires two independent events:(1) the formation of a dicentric chromosome 8qter-cen-8p::8p-cen-8qter by non allelic homologous recombination and (2) secondary breakage at anaphase. Genomic organisation of the 8p23 region can support the occurrence of such rearrangement due to the presence of two olfactory receptor gene-clusters, associated in some individuals with a polymorphic inversion [inv(8)(p23)]. This heterozygous inv(8)(p23) was found in 26% of normal europeans as well as all mothers of 10 reported patients with inv dup del (8p). We report here one case of inv dup del (8p) in which the two parents carry a polymorphic 8p23 inversion. Our second observation concerns a 45, XX idic(8)(p23) karyotype in a two years old girl with developmental an speech delay. We_ve studied breakpoints of this dicentric and compared them with those previously described in inv dup del (8p). A heterozygous 8p23 inversion was also found in her mother. This polymorphic inversion was systematically found in one parent of patients carrying a 8p rearrangement when authors looked for it. However, heterozygotes are common in the population whereas rearrangements are rare. Furthermore, none of the 950 subjects reported to date with such rearrangements have sibs with the same abnormality. This suggest that heterozygous parents have only a low risk of having children with an 8p rearrangement.
We present two female siblings at the age of 7 and 3 years, with similar and characteristic findings of short stature (? 3rd perc.), macrocephaly (997th perc.) and mild psycho-motor retardation; a peculiar face with prominent forehead, deep set eyes, blue sclerae, hypertelorism, epicanthus, short philtrum; high arched palate, small teeth, low-set posterior rotated ears with thickened helices, sparse hair, pectus excavatum, clinodactyly of 4th and 5th fingers and broad first toes. Routine cytogenetic analyses revealed a partial trisomy 2p21-9p23, due to a paternaly derived insertion of chromosome 2 material into chromosome 6; karyotype: 46,XX,der(6)ins(6;2)(p12;p21p23)pat. These results were confirmed by reverse in situ hybridisation. In contrast to terminal trisomy 2p that is repeatedly reported, interstitial partial trisomy 2p is rarely observed. The delineation of phenotypic findings to causative, non-terminal partial trisomy 2p is puzzeling. Up to now, there is only one publication of the same partial trisomy 2p21-9p23. Clinical features in common are: growth failure, macrocephaly, development delay, prominent forehead, low-set ears with helix anomaly, and clinodactyly. A comparison with other cases of partial trisomy 2p extending beyond 2p21-9p23 confirms these observations. Our studies now allow to delineate a common phenotype of trisomy 2p21-9p23 and lead to a more accurate genotypephenotype assignment in partial trisomy 2p.
1.163-P
Skewed X inactivation in a case having partial trisomy 10q with mild phenotype caused by an unbalanced X;10 translocation ¨ . Aldemir, B. S¸enel, Durak, G. Bademci, O I. C ¸ imen and S. Artan
1.162-P
Phenotype of two siblings with pure partial trisomy 2p21-9 9 2p23 Neumann, B. Heye, J. Mu¨ller-Navia, J. R. Exeler, J. Horst and I. Kennerknecht University of Muenster, Inst. of Clin. Genetics Mainz
Eskisehir Osmangazi University Medical Faculty, Eskisehir Osmangazi University Medical Faculty Department of Medical Genetics Trisomy of distal 10q is associated with a characteristic syndrome and has been described in many cases. It is almost always the result of an unbalanced translocation but patients with proximal or medial segment trisomy of 10q have been described less often.
6th ECC: Abstracts A 7 1/2 year-old girl was referred to our clinic because of growth retardation (concordance with 5 1/2 years), delayed speech development and facial dysmorphism. Physchomotor development and neurological status of proband were normal. Height (G3p) and weight (G3p) were low, head circumference was within the normal range. Dysmorpholological findings were flat and round face, high forehead, bluish sklerae, normal inner canthal distance and short outer canthal distance (G-2SD) of eyes, broad nasal bridge, short philtrum, bow-shaped mouth, highly arched palate, low-set posteriorly rotated ears, short neck, normal posterior hair line, broad chest with widely spaced nipples, kyphoscoliosis and clinodactyly. The child has learning difficulties at school. The karyotype of the proband showed a de novo unbalanced X;10 translocation, 46,X,der(X)t(X;10) (Xq28;10q22). The parental karyotypes were normal and there was no family history of repeated miscarriages, mental retardation, or malformation syndromes. Replication banding and molecular analyses showed that der(X) was late replicating. The unbalanced t(X;10) was confirmed by using MultiplexFISH analysis, and loss of the subtelomeric region of Xq and 10q trisomy were seen in subtelomeric region FISH analyses. We couldn_t find any report with the same breakpoints of unbalanced t(X;10) as in our case. As clinical phenotype of our patient is mild in relation to the region of 10q trisomy, we hypothesized that skewed X inactivation with prefential silencing of the translocated X;10 chromosome might account for this difference between phenotype and genotype.
1.164-P
Chromosome constitutions of primary infertile men and women Ozdemir, B. Durak, O. Cilingir, G. Bademci, M. Canturk and S. Artan Eskisehir Osmangazi Universty Medical Faculty Department of Medical Genetics Eskisehir-Turkey
95 1.165-P
De novo monosomy of 22pter-9 9 q13 caused by an unusual unbalanced translocation Altunoglu, Birsen Karaman, Hulya Kayserili, Kader Yılmaz and Seher Basaran Istanbul University, Istanbul Medical Faculty, Department of Medical Genetics 22q11 deletion syndrome is an autosomal dominant syndrome caused by defects of the third and fourth branchial arches, and recognizable by thymus hypo/ aplasia, parathyroid hypo/aplasia, conotruncal heart anomalies, velopharyngeal incompetence, learning problems and facial dysmorphism characterized by a prominent nose with squared nasal root, narrow palpebral fissures and small mouth with a thin upper lip. Estimated prevalence varies from one in 4000 to one in 6395. A 96 days old male infant was consulted at the intensive care unit in the postoperative period. He had been operated due to truncus arteriosus and thymic hypoplasia was noted at peroperative exploration. Physical examination uncovered dysmorphic features; hypertelorism, wide-depressed nasal root, small mouth with thin upper lip and mildly-prominent, low-set ears. Chromosome analysis by GTG banding at 550Y600 band levels revealed only one normal chromosome 22 and an additional segment on 2q (45,XY,j22,2q+). For the identification of the additional segment, FISH study using D22S75 and N85A3 probes was performed. On the derivative chromosome 2, one signal for the control probe of chromosome 22q telomeric region (N85A3) was obtained, while there was no signal for the DiGeorge region probe (D22S75). A further investigation using 2q subtelomeric probe (DJ1011017) showed a signal on derivative chromosome 2. Parental karyotypes were normal. According to the cytogenetic and molecular cytogenetic results, the karyotype of the index patient was interpreted as 45,XY,j22,2q+.ish der(2) (2pter92q37.3::22q13-9qter?) (D22S751, N85A32, DJ10110172). This de novo, unbalanced translocation caused a monosomy of 22pter-922q13?. Although a microdeletion on 2q terminal region is excluded cytogenetically, there remains a possibility of a deletion at the molecular level. Although 22q11 deletion is the most common microdeletion entity,
6th ECC: Abstracts
96 22q11 deletion as a result of an unbalanced translocation is encountered rarely. On the basis of this case, genotype-phenotype correlation of monosomy 22pter-9q13 will be discussed.
1.167-P
1.166-P
S. Candan, Birsen Karaman, Hu¨lya Kayserili, Nuray Kırmızı and Seher Basaran
Clinical evaluation of Prader-Willi and Angelman syndrome patients with 15q11-13 deletion
Istanbul University, Istanbul Medical Faculty
Kurtul, K. Bodurog˘lu, Y. Alanay, E. Utine, B. Volkan Salancı, D. Aktas¸, M. Alikas¸ifog˘lu and E. Tunc¸bilek Hacettepe University Medical Faculty
Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are two clinically distinct neurobehavioral disorders, partly due to the deletions on 15q11Y13. Diagnostic difficulties exist due to variable clinical features at different ages. Clinical criteria which contain major, minor and supporting findings are reported to facilitate diagnosis of Prader-Willi syndrome. The diagnosis of Angelman syndrome is based on clinical findings such as mental retardation, absent speech, inappropriate laughter, ataxic gait, jerky movements. FISH analyses was done by using PWS/AS probe to 26 patients with suspected diagnosis of PWS and 34 patients with suspicion of AS. Their clinical features, laboratory findings were evaluated. Deletion on 15q11Yq13 was found in 11(%42,3) of 26 patients suspected to have PWS and in 11(%32,4) of 34 patients suspected to have AS. Mental retardation and speech problems were present in all of the 11 patients with AS deletion. Ataxia, inappropriate laughter, microcephaly and seizures were observed in 90.9%, 63.6%, 81.8% 72.7% of patients, respectively. All of the 11 patients with PWS deletion had mental retardation. Obesity was a finding in 8 of the patients. Only two of the PWS patients had epilepsy. Growth hormon, blood glucose, IGF1, IGFBP3, insulin, plasma lipids were normal in all of the cases. Other less frequent features of AS and PWS patients are presented and discussed.
A case of monosomy 8p23.3Yter and trisomy 16p13.3Yter; cytogenetic, molecular cytogenetic and clinical findings
We describe here a 3-month-old girl with monosomy 8p23.3Yter and trisomy 16p13.3Yter. The clinical features included facial dysmorphism, cleft palate, overlapping fingers with ulnar deviation, congenital heart defect and asplenia. The conventional cytogenetic analysis on peripheral blood lymphocytes by using GTG banding technique at 600 band level showed an additional thin band on the terminal region of the chromosome 8p (46,XX,8p+). Parental karyotypes were found to be normal. Fluorescent in situ hybridization (FISH) by using wcp 8 probe showed that the additional band on the 8p was not painted. Telomere specific probes for chromosome 8 showed no signal on the p terminal of the derivative chromosome 8. By using multiprobe telomere system (Cytocell), 16p telomere was seen on the derivative chromosome 8p terminal. According to these cytogenetic findings, the patient was carrier for monosomy 8p23.3Yter and trisomy 16p13.3Yter. Our case will be presented with clinical and chromosomal findings and discussed from the view of the literature.
1.168-P
Two cases with Williams syndrome Kuru, A. Cirakoglu, Y. Tarkan-Argu¨den, S. Yilmaz, G. S. Guven, A. Cinar, M. Seven, A. Deviren, S. Hacihanefioglu and A. Yuksel Istanbul University,Cerrrahpasa Medical Faculty, Istanbul University, Cerrrahpasa Medical Faculty, Dept. of Medical Genetics, Istanbul University, Cerrrahpasa Medical Faculty, Dept. of Medical Biology, I
6th ECC: Abstracts Williams Syndrome (WS) is a rare but well recognised neurodevelopmental disease affecting the connective tissue and the central nervous system. The Underlying molecular mechanism is a submicroscopic chromosomal deletion involving Elastin gene (ELN) at chromosome 7q11.23. It is characterized by mental retardation, elfin face, short height and characteristic cognitive profile. The incidence is usually given as 1 in 20,000 live births, but new prevalence estimates are as high as 1 in 7,500, meaning that WS could account for 6% of all cases of mental retardation of genetic origin. Fluorescent in situ hybridization (FISH) with Williams Syndrome DNA probe which is intended for research use in identifying a deletion in the area of the ELN gene is useful in diagnosing Williams syndrome that would otherwise be difficult to diagnose using standard cytogenetics. Case 1 was a 11 months old boy. He was the second child of non-consanguineous parents. The family history revealed that the parents had two first trimester miscarriages, and one healthy brother who is still alive. Cytogenetic analysis was performed with GTL and HRB banding on periferal blood culture, and a 46,XY,del(7)(q11.23) karyotype was detected. Case 2 was a 6 years old girl. She was the only child of non-consanguineous parents who had no medical or family history of note. Cytogenetic analysis was performed with GTL banding on periferal blood culture, and 46,XX chromosome constitution was found. Fluorescence in situ hybridisation (FISH) analyses were applied using a probe for the Williams Syndrome chromosome region on 7q11.23 and a control probe for the 7q36 region (ONCOR) to identify a deletion in the elastin gene in the metaphase spreads of both our cases. The FISH results revealed a deletion in the Williams Syndrome region in both cases.
97 weight: 18 kg (G3.p), head circumference: 44 cm (G3.p)). Bone age was consistent with 7 years. She had atipic facies consisting of a triangular and small face, long nose, deeply placed eyes,mild hypertelorism and short philtrum. We were unable to perform an IQ test because she couldn_t speak Turkish but she had never attended school. She had multiple cafe au lait spots of various size. Cytogenetic analysis revealed ring chromosome 15 with both peripheral blood lymphocytes and fibroblast culture from skin biopsy. On follow up she was found to have mild conduction type of hearing loss on the left. Fundus examination was normal. In her physical examination there was a sistolic murmur and echocardiography revealed a perimembranous VSD. She had marked osteopenia confirmed by DEXA. Endocrinologic tests revealed growth hormone deficiency and she was started on hormone replacement therapy. Ring chromosome 15 [r(15)] syndrome is characterised by specific facial features, cafe au lait spots, failure to thrive, mental retardation. Hyperpigmentation and cafe au lait spots are rare signs in ring chromosome syndromes, but with r(15) syndrome, cafe au lait spots have been described in about 30% of patients and have been considered to result from the deletion of gene(s) on distal 15q. In addition, insulin like growth factor I receptor gene is located within the 15q25Yq26 region. This region is one of the break points in r15 resulting in deletion of the gene and marked intrauterine and postnatal growth deficiency. These patients are known to have a good response to hormone replacement therapy.
1.170-P
Three cases with 9p deletion syndrome
1.169-P
Yanar, Onur Bag˘ci, Bu¨lent Bag˘lama, ¨ zon, Ju¨lide Caferler and Hakan O Beyhan Tu¨ysu¨z
A girl with growth hormone deficiency and chromosome ring 15
Istanbul University, Genetics
¨ zdamar and Beyhan Tu¨ysu¨z Bag˘ci, Elif O Istanbul University We described a 11 year 10 months old girl with marked growth retardation (length: 108 cm (G3.p),
We report 3 cases with similar atypic facies including trigonocephaly with a prominent metopic suture, mongoloid axis, inner epichantic folds, anteverted nares, long philtrum and small ears. Cytogenetic analysis revealed deletion of the short arm of chromosome 9. The karyotype of two cases showed de novo
6th ECC: Abstracts
98 deletion 9 p (p22Ypter). Third case had 45,XY, j9,j21,t(9;21)(9qterY9p23::21q21Y21qter)mat. Although no patients had growth retardation, two of the three cases had mild motor-mental retardation, only one of them had severe motor-mental retardation. This third patient had hypoxic ischemic encephalopathy due to birth asfixia leading to intracranial hemorrage. This case also had hypertrophic gingiva, high palate, partial syndactyly, patent ductus arteriosus, hydrocele, cryptorchidism and hipertonisity. The other male patient had hypospadias, bilateral inguinal hernia and cryptorchidism. The female patient had a high palate, bilateral pes equinovarus, bilateral wide gap between first and second toes and her labia majora were hypoplastic. Abdominal ultrasound of the patients were normal. All of the three patients had similar atypical facies and craniofacial features consistent with 9p- deletion syndrome. Mild to moderate mental retardation without significant growth retardation is also consistent with the syndrome but only one patient had severe motor-mental retardation due to HI˙E. 1.171-P
Association between DNA repair gene polymorphisms and micronucleus frequency in coronary artery disease S. Gu¨ven, Mehmet Gu¨ven, Bahadir Batar, ¨ z, Nazlı Birinci, Nergiz Domanic, Erdinc¸ O Turgut Ulutin and Seniha Hacıhanefiog˘lu I.U. Cerrahpasa Medical School, Department of Cardiology
1.172-P
Small supernumerary marker chromosomes: cytogenetic identification, molecular characterization and correlation with the phenotype Sanz, A. Sousa and S. Gonzalez Hospital Donostia
The frequency of de novo supernumerary marker chromosomes (SMC) that are found in amniocenteses and cannot be identified by standard cytogenetic techniques has been calculated as approximately 1/2500. Several factors, such as: inheritance, chromosomal origin and mosaicism seem to be the most important variables to evaluate in order to establish the risk for the fetus. FISH has made possible the quick identification of the chromosomal origin of SMCs. Nowadays, the only possibility to achieve a more precise prognosis is by the establishment of a link between its chromosomal origin and other reported cases in the literature. A panel of alpha-satellite DNA probes has been used for the identification of chromosomal origin of different small SMCs and in addition, molecular analysis of the SMC was performed using polymorphism markers, to establish, first, the parental origin of the SMC, and second, a possible relationship between its phenotypical effects and the eucromatic regions which are contained in SMCs. The chromosomal origin was established in 11 small SMCs (one derived from chromosome 1, two derived from 1/5/19, one derived from 7, one derived from 11, two derived from 13/21, two derived from 14/22, two derived from 15) and molecular analysis of 6 of them was performed. Here we present the correlation between different factors (familial origin, chromosomal origin, mosaicism, polymorphism marker contained, etc.) and the phenotype of the patients. Our results show that the phenotype is different according to the familial origin and the chromosomal origin of the marker chromosome. Although more investigations in this way are needed, these results are important to establish a more precise prognosis when a chromosome marker is found at prenatal diagnosis.
1.173-P
Constitutional pericentric inversion of chromosome 22 associated with reproductive failures Stana, Adriana Rodica Maria, M. Bari, G. Peltecu, G. Popescu, N. Florina and A. Lungeanu Clinic Hospital Filantropia, Bucharest, Victor Babes National Institute
6th ECC: Abstracts We present a case of a 28-year-old woman with mild mental retardation plus paraparesis and a poor reproductive history. First child, a boy with intrauterine growth retardation who died 9 days after birth, had symptoms similar to deletion of 22q syndrome such as anal atresia (operated) and heart failure. The second pregnancy was interrupted because ultrasound investigation revealed multiple malformations such as cleft lip and palate, unilateral renal agenesis and umbilical cord cyst and the third pregnancy ended in a spontaneous abortion at 6 weeks of gestation. The proposita was born prematurely at 30 weeks of gestation from a twin pregnancy, after a difficult delivery by a 37 year old mother. Her dizygotic twin sister is more severely affected by mental retardation and paraparesis. Chromosome karyotyping using conventional banding technique showed 46,XX,inv(22)(p11-9q12) present only in the patient. Her husband and her twin sister had normal karyotypes. Although her twin sister with more severe clinical signs has normal karyotype, the question still remains: how really balanced is the proposita’s chromosomal rearrangement? We suppose that unbalanced chromosomal complements could have been derived from this apparently balanced pericentric inversion in the three pregnancies, and that these could range in severity depending on the degree of chromosomal imbalance. In fact, the maternal inverted 22 chromosome appears to be the cause of fetal wastage, the abnormal offspring and the abnormal pregnancy.
99 by profound mental retardation, macrosomy, seizures and distinct dysmorphic features, including coarse facies, temporo-frontal alopecia, small nose with anteverted nares, long philtrum and hypo-hyperpigmentation streaks. The i12p is found in fibroblasts, whereas the karyotype of lymphocytes is normal. We here report 12 cases with Pallister Killian Syndrome (PKS) phenotype whose clinical diagnosis was confirmed by karyotyping. The cytogenetic findings revealed 8 cases as mosaic isochromosome 12 p leading to tetrasomy 12 p in only fibroblasts and 4 cases with full trisomy 12p both at fibroblasts and blood lymphocytes. One of the eight 12p tetrasomy cases was diagnosed prenatally in amniocyte cell culture. Seven other tetrasomy 12p cases were evaluated due to their dysmorphic features and moderate to severe psychomotor retardation. As a result of their distinct features consistent with PKS testing in fibroblasts and in blood lymphocytes was considered at the same time. Three out of 4 trisomy 12 cases were unbalanced products of parental translocations. Two out of them, first cousins, were unbalanced products of familial translocation between chromosomes 12 and 15 with the breakpoints 12q11 and 15q11. One trisomy 12p was also a product of unbalanced paternal translocation of (12; 22). The remaining trisomic case was a de novo tandem duplication of 12p with a breakpoint of 12p 12.3 which was confirmed by molecular cytogenetic studies. We will report the follow-up data of 12 cases with PK phenotype of mosaic tetrasomy 12p and trisomy 12p cases and overlapping features leading to diagnosis. Phenotype-genotype correlation of trisomy and tetrasomy 12p will be discussed in view of the literature.
1.174-P
Pallister-Killian phenotype and followup data of 12 cases with 12p tetrasomy and trisomy A. Kocbas, B. Karaman, S. Basaran, M. Yu¨ksel-Apak and H. Kayserili Istanbul University, Istanbul Medical Faculty Pallister Killian Syndrome (PKS) is a rare chromosomal abnormality caused by tissue-limited mosaicism for tetrasomy of chromosome 12p. It is characterized
1.175-P
What would be the right councelling for familial balanced translocations? G. Yes¸il, A. Turk Inanc¸, B. Bag˘lama, ¨ zdamar and B. Tu¨ysu¨z E. O Istanbul University
6th ECC: Abstracts
100 1.176-P
1.177-P
Unilateral peters_ anomaly type I in an infant with 22q11.2 deletion syndrome
A boy with mosaic trisomy 8 and cyct like radiolucent lesion on left tibia
K. M. Erdog˘an, G. E. Utine, Y. Alanay, B. Volkan-Salancı, K. Bodurog˘lu, D. Aktas¸, M. Alikas¸ifog˘lu and E. Tunc¸bilek
Yılmaz, Elif Yılmaz, Halide Gu¨l Akyar, ¨ zcan and Ufuk Yanar, Zeliha O Beyhan Tu¨ysu¨z
Hacettepe University
Istanbul University
The 22q11.2 deletion syndrome (DiGeorge/ velocardiofacial syndrome) is the most common microdeletion syndrome. The range of clinical features in affected individuals is extensive, including cardiac malformations, cleft palate or velopharyngeal insufficiency, developmental delay and mild facial dysmorphism. Here we present a 4-month old boy, referred for facial dysmorphic findings. He was born at term with a birth weight of 3000 gr (50th centile) to consanguineous parents. On physical examination, his length was 60 cm (10th centile), weight was 4200 gr (below 3rd centile), head circumference was 38 cm (below 3rd centile). He had leukocoria in the right eye, bifid nasal tip, micrognathia, highly arched palate, small mouth and an asymmetric crying face. Arachnodactyly in his hands and feet was noted. His thumbs were proximally located. A systolic murmur was heard and echocardiography revealed ventricular septal defect, patent ductus arteriosus, moderate degree pulmonary hypertension. Abdominal and renal USG showed minimal dilatation in pelvis of left kidney. Thoracic CT showed cardiomegaly, dilatation in pulmonary arteries, atelectatic and consolidation areas in both lungs. Ophthalmological examination showed an anterior segment dysgenesis, namely Peters_ anomaly type I in the right eye. Cranial MR showed reduction in the thickness of the anterior body and genu areas of corpus callosum. The karyotype was 46,XY. FISH analysis from his peripheral blood showed deletion at 22q11.2 locus. To our knowledge Peters_ anomaly in 22q11.2 deletion syndrome has been reported only once by Casteels et al and our case is the second case of Peters_ anomaly is seen in association with 22q11.2 microdeletion syndrome.
A 6 months-old boy referred to our clinic with multiple major anomalies. He was the first child of nonconsangineous parents. Renal cysts were detected at 34 weeks by prenatal USG. His birth weight was 2600 g. He gained head control at 6 months. His weight, height and head circumference were 6250 g (3Y10.p), 67 cm (50.p) and 40 cm (G2.p) at 6. months respectively. He had high and narrow palate, flexion contracture on his left thumb, deep longitudinal plantar creases, a dimple on right knee, an accessory nipple on his left preaxillary region, 3 cafe-au-laits larger than 1 cm on abdominal region and wide mongolian sign. His left tibia was torsioned and a large cystic lesion was detected on left tibia by X-ray. He had corneal transplantation because of left corneal leukoma. His renal USG findings were consistent with grade 4 vesicoureteral reflux bilaterally. His karyotype from cultured lymphocytes was 47,XY,+8 (90%)/46,XY(10%) and from cultured skin fibroblasts was 47,XY,+8 (94%)/46,XY (6%). Mosaic trisomy 8 syndrome is characterised with normal advanced growth, long and expressionless face in late childhood, everted and thick lower lip, high-narrow palate, narrow and hypoplastic iliac wings, pigmentation anomalies, absent or hypoplastic patella, limitation of joints. In some patients neoplasia of hematological system or nephroblastoma, leiomyosarcoma are described. Intelligence is normal generally and there is no correlation between the ratio of mosaicism and the incidence of major malformations or the degree of mental retardation. Cystic lesions in skeletal system haven_t been described previously associated with mosaic trisomy 8 syndrome.
6th ECC: Abstracts 1.178-P
A prenatally diagnosed partial trisomy 11q13.2Yqter syndrome due to maternal pericentric inversion 11 ¨ zdamar, Elif Yılmaz, Ufuk Yanar, O ¨ ztunc¸, Hale Demir, Figen Aksoy, Funda O Seyfettin Uludag˘ and Beyhan Tu¨ysu¨z Istanbul University Following a high risk prenatal screening of the first pregnancy in a 25 years old-woman, amniocenthesis was performed and fetal karyotyping showed an extra material of chromosome 11p. Prenatal USG was normal while fetal echocardiagraphy showed hypoplasia of right ventricule and tricuspit valve. Parental karyotyping revealed a pericentric inversion in the mother, karyotype:46,XX,inv(11)(p15.2;q13.2). The fetal karyotype was 46,XY, rec(11)dup(11q)inv(11) (p15.2;q13.2)mat. The pregnancy was terminated. Fetal physical examination showed horizontal palpebral fissures, hypertelorism, depressed nasal bridge, a broad and short nose, thick alae nasi, a prominent and deep philtrum, retromicrognathy, low set ears, narrow shoulders, an umblical cord with 2 vessels. Autopsy findings consist of absence of interventricular septum in the heart; in the middle there was only one atrioventricular valve resembling mitral valve, 2 ventricules were combined anteriorly and the ductus botalli was short, right kidney and the urinary bladder were smaller than normal. In the brain cerebellar hemispheres were noticed to be smaller than normal. Partial trisomy 11q syndrome is usually secondary to malsegregation of a parental translocation involving other chromosomes and is associated with partial monosomy or trisomy of another chromosome. The trisomic segment usually involves the distal region of the long arm of the chromosome 11(q21õq23Y9qter)}. Pure partial trisomy resulting from constitutional duplication of 11q is quite rare; only three cases were reported. In rare cases in which large segments were involved major malformations and mental retardation were more severe and the survival was shorter. Our case is the first
101 case of pure large partial trisomy 11q syndrome due to maternal pericentric inversion of chromosome 11. Besides the atypic face appearence, as the trisomic segment was large severe major anomalies (hypoplasia of right heart, right kidney and urinary bladder) were also present in our case.
1.179-P
A case with ring chromosome 18 Yilmaz, A. Deviren, D. Kuru, A. Cirakoglu, M. Kuskucu, E. Yosunkaya-Fenerci, Y. Tarkan-Argu¨den, G. S. Guven, A. Yuksel and S. Hacihanefioglu Istanbul University,Cerrrahpasa Medical Faculty, Dept. of Medical Genetics, Genomed LTD Patients with r(18) can manifest features similar to del(18p), del(18q) or both syndromes. In some cases, features of van der Woude syndrome, and insulindependent diabetes mellitus, agammaglobulinemia or only facial dysmorphisms are reported. One fourth of the reported cases are male. A four-year-old boy was referred to our department for neurodevelopmental delay and dysmorphism. He was the third son of healthy, non-consanguineous parents. Because some of his clinical findings suggested Fanconi anemia, investigation of chromosomal breaks by NTM (Nitrogen mustard) and DEB (Diepoxybutane) stimulation was performed in addition to conventional chromosome analysis. As the result was found to be within normal limits, Fanconi anemia was excluded. Cytogenetic analysis using GTL banding revealed a karyotype of 46,XY,r(18). This result was further confirmed by FISH (whole chromosome painting and subtelomeric FISH) and QF-PCR. The QF-PCR technique also revealed that the ring chromosome was derived from the paternal homologue. The parents were found to have normal karyotypes. There are less than 100 reported cases with r(18). Our patient shows hyperpigmentation, longitudinal separation of hand nails, bifid nasal tip and markedly decreased sole creases, findings which differ from the reported cases in the literature.
6th ECC: Abstracts
102 1.180-P
Genotype-phenotype correlation in 5p deletion syndrome patients ¨ zdamar, Bu¨lent Bag˘lama, Yılmaz, Elif O ¨ zcan, Emir Keresteci Ufuk Yanar, Zeliha O and Beyhan Tu¨ysu¨z Istanbul University The 5p deletion syndrome (Cri du Chat Syndrome) is a chromosomal disorder caused by a partial terminal or interstitial deletion of the short arm of chromosome 5. The characteristic features are low birth weight, characteristic high-pitched cry, microcephaly, downward slanting of palpebral fissures, broad nasal bridge, hypertelorism, epicanthic folds, retromicrognathia, growth delay and severe neuromotor retardation. We investigated the genotype-phenotype correlation of 10 cases. The deletion breakpoints were as follows: p15.1 (n=3), p15.2 (n=1), p14.2 (n=3), p13.3 (n=1), p13 (n=1). The last one was with dup(20)(pterYp11.2) due to parental balanced translocation. In six cases the deletions were de novo, and in two cases the deletion was secondary to parental balanced translocations. Four of the patients had low birth weight, seven of them had the typical cat cry. In the follow up, the head circumferences of all the patients were under 3rd centiles. All of them had significant neuromotor retardation, head control was achieved at 6 months to 1 year, and sitting was achieved at 1 to 4 years of age. Walking was achieved usually between 4 to 7 years of age. Three of them couldn_t walk, one of them was the patient with large deletion (p13.3). None of the children was able to talk, only a few of them were able to say 3Y4 words. The typical facial features of the syndrome were present in general. There were also abdominal wall defects, urogenital system anomalies, cardiac defects, eye anomaly. On CNS imaging, delayed myelinization, cerebral-cerebellar cortical or brain stem atrophy, hydrocephalus, lateral ventricular dilation, wide subarachnoid space, thin corpus callosum were detected; only in one patient was there no anomaly in an early cranial CTI. We noticed that the typical cat cry disappears rather early, significant microcephaly occurs postnatally and verbal delay is more prominent. The major organ anomalies and severe neuro-
motor retardation are more common in large segment deletion patients.
1.181-P
Unusual male karyotype with or without Y chromosome Umay, C. Beyazyurek, M. Yesil, H. Karadayi, A.Ozden, Y. Sabuncuoglu, H. Yelke, Y. Saglam, S. Ozkan and S. Kahraman Istanbul Memorial Hospital Introduction: Genetic abnormalities including chromosomal abnormalities and microdeletions in the Y chromosome are mostly identified in up to 60% of infertile males, especially in men with Non-Obstructive Azoospermia (NOA). In this study, we report a special type of sex chromosome abnormality, which contains also microdeletions in the Y-chromosome. Materials and Methods: 20 normal NOA patients who attended our clinic because of infertility were evaluated. Semen analysis was done in each case and all of them were analyzed with both cytogenetic and molecular methods. Chromosome analysis was performed on peripheral blood lymphocytes using GTG banding. FISH was performed by using whole chromosome painting, locus specific, centromeric and telomeric probes. Screening of SRY and AZF loci was performed by using PCR. Results: Semen analysis showed that all patients had NOA. Cytogenetic analysis revealed that 8 patients had a 46,XX male karyotype, one patient had a 45,X male karyotype. 11 patients had idic(Yp). Two cases were pure 46,X,idic(Yp), and the other 9 were mosaics with the karyotype 45,X/46,X,idic(Yp). After the AZFa,b,c region detection: 11 patients had a complete AZFa,b,c deletion. Two of the complete AZFa,b,c deletion and 9 complete AZFb,c deletion cases also have a idic(Yp) chromosome. Among 11 complete AZFa,b,c deletion patients, 8 were positive for SRY gene and the remaining 3 were negative. According to FISH study which was applied to 6 SRY-positive 46,XX or 45,X patients, in 5 patients the SRY gene was translocated to the X chromosome. For the other patient, a 45,X,tas(Y;2)(p11.3;qter) karyotype was identified.
6th ECC: Abstracts Conclusions: Isodicentric Y chromosomes are common structural rearrangements of the Y chromosome in infertile males. Usually in 46,XX and 45,X males, the SRY region is translocated to the terminal p arm of chromosome X. In our study, the SRY is translocated to chromosome 2. Although the SRY region is involved in male sex determination, in its absence other autosomal genes may be important for sexual development. Before starting of an ART, it is important that NOA patients should be genetically investigated.
1.182-P
Structural chromosome abnormalities in couples with recurrent fetal losses Cirakoglu, Y. Tarkan-Argu¨den, S. Yilmaz, D. Kuru, A. Deviren, G. S. Guven, E. Pasalioglu, I. M. Gu¨rsel, S. Eren, S. Arpag, F. Aydogdu, N. Birinci, H. Kurt and S. Hacihanefioglu. Istanbul University,Cerrrahpasa Medical Faculty We present a retrospective study of cytogenetic data of 369 couples who had recurrent miscarriages and/ or fetal deaths. The mean age for females was 30 and for males was 33. Chromosomal analyses were performed using Giemsa-banding according to standand procedures on peripheral lymhocytes. Additional banding techniques like C-banding and NOR, and FISH were used for characterizing chromosomal rearrengements. Structural chromosome abnormalities were shown in 19 (5.15%) of the couples. Out of 19 carriers, 6 were females and 13 were males. The abnormalities were balanced in 15 cases and unbalanced in 4 cases. The balanced rearrangements were reciprocal translocations in 11 cases (õ3%), robertsonian in 2 cases (0.54%), and inversions in 2 cases (0.54%). Chromosomes involved in rearrangements were; 2, 4 (in 4 cases each), 14 (in 3 cases), 6, 8, 11 and 13 (in 2 cases each), 1, 16 and 18 (in one cases each). Pericentric inv(9)(p11q13) were excluded because of considering as a population variant. Seven cases had had pericentric inv(9)(p11q13). In 3 cases, unbalanced abnormalities were supernumerary marker
103 chromosomes and 2 of them found as mosaic conditions. In addition to chromosomal abnormalities, at least one chromosome variant were shown in 59 cases. 9qh+ was the most common chromosome variant that found in 25 cases (6.8%). Yqh+ and 16qh+ were obtained 10 cases (%2.7) each, and 1qh+ was seen in 8 cases (%2.16).
1.183-P
18p deletion syndrome with premature adrenarche and telarche in two cases Bag˘lama, Go¨zde Yes¸il, Elif Yılmaz, ¨ zdamar and Beyhan Tu¨ysu¨z Elif O Istanbul University Deletion 18p- syndrome is characterized by mental and growth deficiency, ptosis or epichantal folds, prominent auricles. However; there is broad variability in the phenotype. Holoprosencephaly is an expected finding with a ratio of 12%. The prognosis is poor for these patients. In this study, two cases with different phenotype and clinical symptoms but no growth retardation and major anomalies were presented. First patient was a male at the age of 10 who had developmental delay without growth retardation. He had mild mental retardation and premature adrenarche. A cafe-au-lait spot with a measurement of 810 cm was observed on the left inguinal portion of abdomen. His EEG showed a dysritmic pattern. He also had hypertelorism, upslanting palpebral fissures, long bulbous of nose, short philtrum and mild pectus excavatus. The second patient was a 4 year old girl with mild mental retardation, immune deficiency and premature menarche. The MRI of the brain revealed hypo-demyelination in supratentorial and subcortical white matter. She had common features reported in the literature such as microretrognathi, large ears, upslanting palpebral fissures, hypertelorism, epichantus, highly arched palate and hypotonia. Both cases had a broad deletion area on the short arm of the chromosome 18(p11.2Ypter). Contrary to expectation holoprosencephaly or serious MRI findings were not present.
6th ECC: Abstracts
104 1.184-P
Hospital Santa Maria, Centro Genetica Clinica
Choanal atresia and mega-cisterna magna in a case with interstitial deletion of 13q22–q32
Mental retardation affects 1Y3% of the general population. The underlying genetic causes are in many cases unknown. Cryptic aberrations involving the subtelomeric regions of chromosomes have been found to be responsible for mental retardation and multiple congenital anomalies. Such hidden abnormalities rate have been detected at the subtelomeric regions in around 5% of the patients, but varies between 3% and 23% depending on the clinical criteria applied in the selection of patients. However, the exact incidence of these aberrations is still unclear. In this study, we report the results of subtelomeric FISH analysis on a pool of 188 patients with mental retardation, dismorphic features and normal standard karyotype. The routine screening with subtelomeric FISH probes was performed using a comercially available kit which allowed the evaluation of all 41 telomeric regions, excluding the short arms of acrocentric chromosomes. The incidence of abnormal results detected in our series was 9%. The authors describe the cryptic rearrangements found and compare the effectiveness of this analysis regarding the application of clinical criteria. Our results confirm previous findings of subtelomeric rearrangements in the etiology of mental retardation and provide additional cases to the literature on subtelomeric abnormalities.
Ibrahim Keser, Zafer Cetin, Ercan Mihci, Sukran Tacoy and Guven Luleci Akdeniz University Faculty of Medicine Department of Medical Biology and Genetics, Akdeniz University Faculty of Medicine Department of Pediatric Medical Genetics Interstitial deletion of the long arm of chromosome 13 is a very rare chromosomal abnormality. Cases with interstitial deletions have various phenotypes depending on the deleted region of chromosome 13. Here we report a 3 months old baby boy whose karyotype was found as 46,XY,del(13)(q22Yq32) associated with choanal atresia and mega-cisterna magna as a central nervous system malformation. In addition, proband showed some clinical findings including microcephaly, hypertelorism, depressed and wide nasal bridge, down slanting palpebral fissures, high and narrow palate, small and cupid shaped mouth, low-set ears, bilateral single phalanxes, secundum atrial septal defect, renal malformations observed in previously reported similar cases. To our knowledge, our case is the first for interstitial deletion of chromosome 13 and choanal atresia and mega-cisterna magna association. Also, parental origin was investigated for the deleted chromosome 13q to identify the clinical findings in our case. Our findings showed that detailed clinical and molecular studies are needed to reveal clinical variations observed between ceases with 13q deletions. 1.185-P
Subtelomeric chromosomal rearrangements in patients with idiopathic mental retardation and dismorphic features Avila, A. Sousa, M. R. Santos, S. Serafim, C. F. Pinto, I. Gaspar, A. Medeira, A. B. Sousa, P. Rendeiro, M. P. Tavares and I. Cordeiro
1.186-P
Complete gonadal dysgenesis 46,xy in two sisters and their mothers_ maternal aunt with a female phenotype A. Bisgin, G. Bagci, S. Berker Karauzum, B. Trak and G. Luleci Akdeniz University Faculty of Medicine Department of Medical Biology and Genetics, Pamukkale University Medical Faculty Department of Medical Biology, Akdeniz University Faculty of Medicine Department of Gyneacology and Obstetrics
Swyer_s syndrome is a form of pure gonadal dysgenesis characterized by a female phenotype, 46
6th ECC: Abstracts XY karyotype, hypoplastic gonads, and a normal mullerian system. They appear to be normal females; however, they do not develop secondary sexual characteristics at puberty, do not menstruate, have streak gonads in ovarian localisation, and elevated levels of gonadotropins. We report two sisters both with 46,XY karyotype and normal female phenotype (Swyer_s Syndrome). These sisters were studied from a clinical, endocrinological and genetic perspective. In 1998 the older sister was presented to us at the age of 15 with a main complaint of primary amenorrhea. Physical and gynecological examinations, hormonal and chromosomal analyses were performed in an attempt to reveal the etiology. A 46,XY karyotype was found in 200 GTG-banded metaphases with no detectable mosaicism. She underwent laparoscopic removal of bilateral dysgenetic gonads due to a risk of developing gonadoblastoma. In 2005 her sister was presented to us at the age of 15 with primary amenorrhea. Chromosome analyses was performed and revealed a 46,XY male karyotype, the same as her elder sister. In 2006, she also underwent laparoscopic removal of bilateral dysgenetic gonads. As a proposition we counceled the family for molecular studies of sex determining region Y (SRY gene). The molecular investigation undertaken on the two sisters and their parents, revealed absence of SRY. An other case was also observed in a sibship of a maternal aunt who has the same history of primary amenorrhea but is married with no consanguinity and has no children. Her karyotype is 46,XY. We discuss the findings of our patients together with other familial cases in the literature.
1.187-P
Recurrent structural abnormality in PND associated with maternal low level mosaicism Rendeiro, G. Fernandes, F. Prata, R. Vieira, R. Lemos, I. Duraes, A. Pereira, C. Cruz, J. Henriques and P. Tavares
105 ity of these cases refer to aneuploidy recurrence, most of them associated with parental meiotic errors leading to high frequency of non-disjunctions. Parental mosaicism is another important cause of recurrent chromosomal alterations, especially when the abnormal cell line has a higher expression in germinal cells, increasing the risk for abnormal pregnancies. We present a case with a recurrent chromosomal alteration - ins(18) - on consecutive gestations, associated with maternal low level mosaicism. Cytogenetic analysis was performed on cultured amniocytes from amniotic fluid, for PND, and on peripheral blood lymphocytes for parental studies. FISH analysis was performed using subtelomeres (Vysis) and painting (Metasystems) probes for chromosome 18. In the first gestation PND for chromosomal defects was done due to advanced maternal age. Cytogenetic analysis detected an abnormal chromosome 18, with material of unknown origin on the long arm. Parents_ karyotypes were normal. The alteration was described as an add(18)(q21.3)de novo. In the second gestation, the amniotic fluid analysis detected the same alteration as in the previous pregnancy. Following this unexpected result, parents_ karyotypes were repeated and 100 metaphases were scored. The add(18) was detected in 7% of the cells in maternal peripheral blood. FISH characterization of the abnormal chromosome, with subtelomere and painting probes, revealed an insertion of a short-arm segment (probably 18p11.21Yp11.23) into the long arm at band 18q21.3, final result was (ISCN 2005): 46,XX,add(18)(q21.3)mat.ish ins(18)(q21.3p?11.21p?11.23)mat(wcp18p+,pter-) This case confirms the importance of low level parental mosaicism related to recurrent chromosomal abnormalities detected at PND; therefore it should be taken into serious account in genetic counseling.
1.188-P
A consaquineous couple with a 44,XY,der(13;14)der(13;14) and 45,XX,der(13;14) karyotypes and genetic counseling
CGC Centro de Genetica Clinica, Servic¸o de Obstetrı´cia Hospital S. Sebastia˜o
Go¨kc¸en, F. Bal, U. Akpulat, K. Bozkurt and E. Aktan
There are several reports of consecutive gestations with the same chromosomal abnormality. The major-
Gentan Center for Diagnosis of Genetics Diseases, ¨ zel Ege Tu¨p Bebek Merkezi, IVF Center, I˙zmir O
6th ECC: Abstracts
106 Robertsonian translocations represent the most common balanced structural rearrangements seen in the general population with a frequency in newborn surveys of about 1 in 1000. The most common Robertsonian translocation is between chromosomes 13 and 14. This rob(13;14) translocation makes up õ75% of all Robertsonians. The potential liveborn chromosomally unbalanced outcome of this is translocation trisomy 13 (Patau syndrome). There is also potential for uniparental disomy (UPD) for chromosome 14 following trisomy rescue. Translocation trisomy 14 is expected to result in first trimester loss. For rob(13;14) carriers the overall risk of miscarriage is not expected to be significantly different from the back ground risk of 15% (up to two miscarriage); however, some a rob(13;14) present with infertility or recurrent spontaneous abortions. A couple (female:39, male:44) with infertility problem applied to our laboratory to chromosome analysis. After standart cytogenetic analysis from peripheral blood, we observed 44,XY, der(13;14)der(13;14) and 45,XX,der(13;14) karyotypes. Hence, interestingly, the partners are the same Robertsonian translocation carrier. The couple were counselled about the Robertsonian translocation, infertility and the way to have a healty baby.
1.189-P
Subtelomeric FISH analysis of chromosome 10 Karaca, M. A. Soylemez, E. Yosunkaya Fenerci, M. Seven, A. Deviren and A. Yuksel Istanbul University Cerrahpasa Medical School, Istanbul Zeynep Kamil Eg˘. Ar. Hast We report a 15 years old boy with mild mental retardation, microcephaly, minimal facial dysmorphism with narrow and flat forehead, malformed low set ears, prominent lips. He also presented hyperextansibility, hypotonia, dorsal scoliosis and 1/6 systolic murmur on cardiac oscultation. His parents were not consanguinous. He had developmental delay, such as sitting without support at 12 months, walking at 24 months and speaking at 24 months. He had some feeding difficulties during early childhood. Subtelomeric FISH analysis showed deletion of 10q and duplication of 10p on subtelomeric sites. Our
patient has only a small number of features that have been reported within the cases of 10p duplication/ 10q deletion syndrome previously. This suggests deletion and duplication of mentioned pieces are smaller than the loss within 10p duplication/10q deletion syndrome.
1.190-P
Two siblings with 5p deletion syndrome of genotypically normal parents: gonadal mosaicism? ¨ zdamar, Elif Yılmaz, Tuysuz, Elif O Birsen Karaman and Ufuk Yanar Istanbul University The 5p deletion syndrome is a chromosomal disorder caused by partial terminal deletion of the short arm of chromosome 5. The patient was the first child of consangineous parents. He was born at term, birth weight, height and head circumference were normal. Neuromotor development was significantly delayed, he sat and started to say 3Y4 words at 4 years, he was still unable to walk. On admission he was 6.5 years old, his weight, height and head circumference were all under 3rd centiles, he had hypertelorism, epicanthal folds, high nasal bridge, operated preauricular skin tags, retromicrognathy, high arched palate, widely spaced hypoplastic nipples, bilateral transverse lines, hypospadias, operated cryptorchidism, and bilateral talipes cavus. He was operated for congenital cardiac defects, also he had inguinal hernia. On cranial MRI brain stem atrophy and hypoxic changes were detected. On eye examination no vision was obtained, and bilateral optic discs were temporally pale. The karyotype was 46,XY, del(5)(p13.3Ypter) and the karyotypes of the parents were normal. FISH analyses showed whole painting in deleted chromosome 5 by whole painting probe chromosome 5. In the following pregnancy amniocenthesis was performed and fetal karyotyping was similar to the previous child: 46,XX,del(5)(p13.3Ypter). On the fetal ultrasonography the intestinal loops and stomach were dilated, there was single umblical vessel, cerebral ventriculomegaly, cerebellar hypoplasia, polyhydramnios. Although genetic counselling was given to the family, pregnancy wasn_t terminated. The affected fetus was born at 36th week and she had short neck,
6th ECC: Abstracts
107
hypertelorism, low set ears, micrognathia, on the follow up intestinal atresia was revealed. These two siblings with the same chromosomal anomaly from healthy parents with normal karyotypes are presumably typical examples to gonadal mosaicism.
not enough data to explain the lack of del(X)(p22) in males. This could result either from non-random distribution of del(Xp) among the siblings of del(Xp) mothers, or from serious disturbances in development of del(Xp) male fetuses, leading to early prenatal death.
1.191-P
1.192-P
Familial Xp deletions
X/Y translocation in a family with 4 affected members in 3 generation showing Leri-Weill dyschondrosteosis phenotype
Stembalska, Jakiel Anna, Laczmanska Izabela, Kozlowska Joanna, Makowska Izabela and Sasiadek Maria Medical University of Wroclaw We report on two familial Xp deletions diagnosed using GTG-banding techniques and confirmed by FISH analysis. In both families Xp deletion has been observed in healthy, fertile women. In family A, terminal deletion X(p22.1) was diagnosed first in a 13-year-old girl referred to the genetic department because of short stature (G3c). Her psycho-physical development was normal (including regular menstruation). The karyotype of the girl was 46,X,del(X) (p22.1). Thus, cytogenetic diagnosis was offered to her family. In her mother, also presenting short stature, mos 45,X/46,X,del(X)(p22.1) was observed. Further cytogenetic analysis of fibroblasts revealed the same mosaic karyotype, however, the percentage of 45,X and 46,X,del(X)(p22.1) cells was different from those, observed in the lymphocytes (33% and 67% versus 62% and 38%, respectively). Two sisters of the proband were diagnosed with normal karyotypes. In family B, del(X)(p22.1p22.2) was first diagnosed in female newborn, referred to the geneticist with clinical diagnosis of Down syndrome (patient 1). In the girl trisomy 21, accompanied by del(X)(p22.1p22.2) was shown. The same deletion was observed in other women in her family: in the girl_s mother (patient 2) and proband_s mother sister (patient 3) as well as in proband_s sister (patient 4). All of them presented normal psycho-physical development. Prenatal diagnosis performed in patient 3 revealed a female fetus with del(X)(p22.1p22.2). All male family members (sons of patient 2 and 3) were diagnosed with normal karyotypes. It could be concluded that Xp deletions with the break-point in the band 22 do not result in disturbances, of neither the gonadal nor the psychophysical development in females. However, we have
Bal, A. Go¨kc¸en, B. Karaman, A. Balog˘lu, T. C ¸ okıs¸ılak, U. Akpulat and S. Bas¸aran Gentan Center for Diagnosis of Genetics Diseases, I˙stanbul University, Istanbul Medical Faculty, Department of Medical Genetics, C¸apa, ˙Istanbul, ¨ RK Training and Research Hospital, Izmir ATATU X/Y translocations occur rarely in the human population. The majority of these translocations have breakpoints at Xp22 and Yq11 when analyzed cytogenetically. Some of these translocations are sporadic events, whereas others are familial. All females with Xp22;Yq11 translocation are fertile and of normal intelligence. When the region of SHOX gene is deleted, because of the haploinsufficiency of this gene, short stature and Leri-Weill dyschondrosteosis are expected in the phenotype. All males carrying such translocations have an additional intact Y chromosome. Although some of these males appear to have a normal phenotype, others might have various abnormalities. Leri-Weill syndrome represents a short stature syndrome characterised by the mesomelic shortening of the forearms and legs and by bilateral Madelung deformity of the wrists. Recently, mutations in the pseudoauttosomal homeobox gene SHOX and a deletion involving genes in Xp22.3 have been reported to be causative for this disorder. We present here a new family with 4 affected members in 3 generation. The index case with X/Y translocation with the breakpoints of Xp22 and Yp11 was diagnosed prenatally. Classical cytogenetic and fluorescense in situ hybridization techniques determined the unbalanced translocation. Chromosome analyses of the parent and grandparent showed that the mother and grandmather, who were
6th ECC: Abstracts
108 affected clinically, were also carrier for this translocation. According to the family history, a sister of the mother showed a similar phenotype.
breakpoints in this rearrangement will facilitate a preimplantational diagnosis of the embryo using subtelomeric FISH probes if the couple would like to benefit from assisted reproduction techniques.
1.193-P
A 3p;9q translocation without evidence of subtelomeric 3p sequences on the derivative chromosome 9. A non-reciprocal translocation? E. Margarit, R. Queralt, M. A. Vallecillos, C. Morales, A. Sa´nchez and A. Soler Hospital Clinic de Barcelona A sterile 33 years old man referred to our laboratory for karyotyping was found to carry a translocation between the short arm of chromosome 3 and the long arm of chromosome 9: 46,XY,t(3;9)(p26;q22). At microscope resolution, we were not able to detect any fragment of the terminal 3p dark G-band translocated to the long arm of the derivative 9 chromosome. In order to investigate the breakpoints of the chromosomal reorganization, we performed fluorescence in situ hybridization (FISH) studies using subtelomeric probes specific for 3p and 9q. The hybridization with a subtelomeric 9q probe showed, as expected, one signal on normal chromosome 9qter and a second signal on the derivative chromosome 3, carrier of the 9q22-qter region on the short arm. Confirming our observations on conventional cytogenetics, two different subtelomeric probes for 3p hybridized to pter on normal chromosome 3 and to the same position on the derivative chromosome 3. These results seem to point out an absence of 3p sequences on the derivative chromosome 9, thus indicating that this translocation might not be reciprocal. The non-reciprocal translocations involve the fusion of the translocated chromosomal fragment with the telomeric sequences of a second chromosome, and they have been observed in neoplastic cells, but they are infrequent as constitutional rearrangements. An alternative explanation to our observations is that the breakpoint on 3p in this reorganization is distal to the position of most telomeric 3p probe we used (50159Y226820bp position). Additional studies will be done in order to investigate our findings. The precise definition of the
1.194-P
Two cases of der(15)t(Y;15): clinical and cytogenetical study Vyatkina, L. Petrova, I. Fedorova, A. Pendina, N. Sadik, O. Chiryaeva, V. Dudkina and T. Kuznetzova Ott_s Institute of Obstetrics & Gynecology RAMS
1.195-P
A case description of a baby with 4P-syndrome Mortezapour1, F. Mahjoubi, S. Soleimani, M. Rahnama, F. Razazian, M. Zamanian, F. Manouchehri and F. Nasiri Iran blood Transfusion Organization Research Centre (IBTO), Tehran, Iran Wolf-Hirschhorn syndrome (WHS) is a rare developmental disorder associated with deletion of short arm of chromosome 4. Well-known genetic condition of WHS are typical facial anomalies, midline defects, skeletal anomalies, prenatal and postnatal growth retardation, hypotonia, mental retardation, and seizures. Here we report a new case of WHS who was referred to our clinic for cytogenetic investigation. The patient was a 9 month old baby boy with developmental delay, hypotonia, respiratory and heart problem, prominent eyes and forehead and delayed bone age. GTG banded karyotype reveald a deletion on segment of 4p (p15.31 pter). Due to a broad spectrum of possible morphologic abnormalities followed by mental retardation, prenatal diagnosis is very important. Postnatal recognition of the syndrome requires genetic counseling of parents and supportive multidisciplinary treatment.
6th ECC: Abstracts
1.196-P
Cytogenetic investigation in 727 Iranian patients with mental retardation Nasiri, F. Mahjoubi, S. Soleimani, M. Rahnama, F. Mortezapour, F. Razazian, F. Manouchehri and M. Zamanian Iran blood Transfusion Organization Research Centre (IBTO), Tehran, Iran, Clinical Genetic Dept. National Institute for Genetic Engineering and Biotecnology, Tehran, Iran and Iran Blood Transfusion Organization Research Centre (IBTO), Tehran, Iran
1.197-P
Partial trisomy 13q Rahnama, F. Mahjoubi, S. Soleimani, F. Mortezapour, F. Razazian, M. Zamanian, Manouchehri, M. Nourozinia, M. T. Akbari and F. Nasiri Iran Blood Transfusion Organization Research Centre (IBTO), Tehran, Iran, Clinical Genetic Dept. National Institute for Genetic Engineering, I, I, Akbari Medical Genetics Laboratory, Tehran, Iran It has been shown that the trisomy of the distal part of chromosome 13 is related to different clinic findings than cases with classic trisomy 13. The different trisomic segments of the long arm of chromosome 13, which might be either translocated or inserted in different chromosomes, have been reported. Our case was a baby boy and the first child of an unrelated couple. He was born at term following a normal pregnancy. He was referred to our clinic at the age of 4 months. He had postaxial polydactyly and syndactyly of the left hand. He was deaf and legally blind. He was generally presented with developmental delay, microcephaly, trinogocephaly, hypotelorism, and with feeding problem. Cytogenetic analysis carried out using Trypsin Giemsa G banding (GTG), the karyotype 46,XY,der(14)t(13;14) (q13p11.1)+13q13 was deter-
109 mined in our patient. His mother and father were investigated and found to have normal karyotypes. To the best of our knowledge, this is the first report of a case where the trisomic segment of chromosome 13 is translocated on to chromosome 14.
1.198-P
Sex reversal syndrome using conventional cytogenetic technique Razazian, Mahjoubi, F. Tootian, S. Rahnama, M. Mortezapour and F. Manouchehri Iran Blood Transfusion Organization Research Centre (IBTO), Tehran, Iran, Clinical Genetic Dept, National Institute of Genetic Engineering and Biotechnology, Tehran, Iranand Akbari Medical Genetics Laboratory, Tehran, Iran and Clinical Genetic Dept. National Institute for Genetic Engineering and Iran Blood Transfusion Org Advances in experimental endocrinology, biochemistry, genetics, and molecular biology have all contributed to our understanding of the process of human sex differentiation in the past decades. Based on the recognition of the underlying anomaly in the process of sexual differentiation, intersex disorders may be divided into abnormal gonadal determination and abnormal genital differentiation. Males with ambiguous genitalia but two differentiated testis are called MPH. Females with ambiguous external genitalia but normal ovaries and normal internal genitalia are called FPH. Abnormal gonadal determination is mainly dependent on sex chromosomal defects that can be detected by cytogenetic analysis or by DNA probes for genes located on the Y chromosome. XX males may be divided into three subgroups: 46,XX males with the SRY gene, 46,XX males without the SRY gene, and XX/XY mosaics. DAX1 lies on the X chromosome. When it duplicates it causes an individual who is genetically male to develop physically as a female. During a period of 8 years (from 1997 to 2006) we have reported 32 patients referred for sex reversal which was more common in the female group (n=16, 0.7%) compared to the male population (n=10, 0.4%). We conclude that simple conventional cytogenetic methods are
6th ECC: Abstracts
110 very helpful to identify males or females with sex reversal. In addition, molecular cytogenetic technology such as FISH and molecular methods to investigate the presence or absence of some critical genes such as SRY would be very useful to explain phenotypic heterogeneity in the group of males and females with sex reversal.
1.199-P
1.200-P
The prenatal diagnosis of chromosomal abnormalities. Study about 1071 cases Hardizi, E. Chadli, O. Chokairi and G. en-Nouhi Laboratory of Histology Embryology Cytogenetic, University of Medecine, Rabat, Morocco, Laboratory of Cytogenetic, Pasteur Institute. Casablanca. Morocco
A report of a case with ring chromosome 18 M. Zamanian, F. Mahjoubi2, S. Soleimani1, M. Rahnama1, F. Mortezapour1, F. Razazian1, F. Manouchehri1 and F. Nasiri1 1
Iran Blood Transfusion Organization Research Centre (IBTO), Tehran, Iran, Iran blood Transfusion Organization Research Centre (IBTO), Tehran, Iran; 2 Clinical Genetic Dept. National Institute for Genetic Engineering and Biotecnology, Tehran, Iran Rings of chromosome 18[r(18)] are frequent among ring chromosomes: depending on the size of the deleted regions in 18p and 18q, the clinical symptoms of r(18) correspond more or less to the typical signs of the 18p and 18q deletion syndromes. Ring chromosome 18 [r(18)] syndrome is characterized by mild to moderate learning disability, behavioural disorders, and various dysmorphic features. Here we report an additional case of a 14 months girl with r (18). The girl was born at term after an uncomplicated pregnancy and delivery. Birth weight was about 1.5 kg, length 48cm, and head circumference 36cm. The girl presented hypertelorism, hypotonia, epicanthal folds, abnormal fingers, low set ears, and abnormally growth of teeth. Echocardiography indicated dilatation of the aorta. Karyotyping after lymphocyte culture at the age of 14 months revealed 46,XX,r(18)(q21.2qter). The parents had normal karyotypes. The clinical feature of our case is mostly compatible with the other reported cases of r(18) except for the presence of abnormal teeth and a heart problem. This report further contribute to to the knowledge of clinical findings in r(18) patients.
1.201-P
FISH diagnostics of microdeletion syndromes in Belarus Khurs, N. Rumyantseva, A. Polityko, V. Kulak and I. Naumchik Republican Medical Center BMother and Child^ Here we present the scheme of diagnostics of microdeletion syndromes such as Prader-Willi (PWS), Angelman (AS), Williams-Beuren (WBS), CATCH 22 in Belarus Republic. It includes clinical examinations and laboratory diagnostics in affected families. 1. Clinical examinations and diagnostics. & Physicians (neurologists, pediatricians, cardiologists, etc.) send affected patients to Republican Medical Center BMother and Child^ or Regional Genetics Centers for genetic counseling. Contingent of high risk are children having multiple malformations, mental delay, growth retardation, obesity, neurological signs (muscular hypotonia, seizures, etc), heart diseases. & Geneticists register preliminary clinical diagnosis, plan the specific ultrasound examinations needed, laboratory examinations. 2. Laboratory diagnostics. & Conventional postnatal and prenatal cytogenetic studies are obligatory (GTG-banding, level of resolution 400Y850 bands) (Republican Center, Regional Genetics Centers). & Subsequent molecular cytogenetic diagnostics: detection of microdeletion by FISH analysis using the appropriate commercially available locus specific probe ((Republican Center). & Cytogenetic and FISH studies of parents or other relatives
6th ECC: Abstracts depends on examination data of proband. & Molecular diagnostics of UPD in PWS, AS cases. Results of molecular cytogenetic diagnostics. Totally 93 patients with preliminary clinical diagnosis Bmicrodeletion syndromes^ were studied in Belarus. This group included 41 patients with presumable PWS, 9Ywith AS, 13Ywith WBS and 30Ywith CATCH 22. The diagnosis was confirmed by FISH results for 27% of PWS, 11% of AS, 62% of WBS and 17% of CATCH 22 patients. Conclusion. The effectiveness of molecular cytogenetic diagnostics substantially depends on the criteria of clinical screening of the patients and scheme of risk group formation.
1.202-P
Case report: lissencephaly with der(17)t(17;18)(p13.3;p11.1) Egriboz, V. Koksal, M. A. Soylemez, B. Ulucay and O. Etlik Burc Genetic Diagnosis Center Miller-Dieker Syndrome (MDS) is associated with deletions of 17p13.3 region and is characterized by type 1 lissencephaly with severe multiple congenital anomalies/mental retardation, prominent forehead, bitemporal narrowing, flat midface, short nose with upturned nares, prominent upper lip and small jaw. Survival time for affected individuals is not long and they do not usually reach to adulthood. MDS is caused by visible or large submicroscobic deletions of chromosome 17p13.3 involving lissencephaly critical region. Approximately 20% of these deletions are associated with a derivative chromosome 17 inherited from a parent who is a carrier of balanced reciprocal tranlocation involving chromosome 17 and another chromosome. Here we report a case of MDS, a 16 months of baby, associated with maternally inherited unbalanced reciprocal translocation between chromosome 17p and 18p resulting in partial monosomy for 17p13.3 and partial trisomy for 18p11.1. Although there are some translocations resulting in MDS in the literature, to our knowledge, this is the first report of Miller-Dieker phenotype associated with such a translocation and therefore may contribute to the delineation of the phenotype resulting from a partial monosomy 17p and partial trisomy 18p.
111
1.203-P
A case report: prenatal diagnosis of 47,XX,der(15)t(4;15)(q35;q21.3) Taser Guney, M. Yesil, Y. Sabuncuoglu, A. Ozden, B. Umay, N. C. Yılanlıoglu, C. Beyazyurek, H. Karadayı, S. Kahraman and Y. Saglam Istanbul Memorial Hospital Here we present a prenatal diagnosis of a case with partial trisomies of both chromosomes 4 and 15. The propositus, a 28 year-old, woman was referred to our clinic for an ultrasound examination. Fetal ultrasonography at 17 weeks of gestation identified with epicardial effusion and oligohydramnios. Previous maternal obstetric history revealed a missed abortion at 11 weeks of gestation. The patient had genetic counseling and chorionic villous sampling (CVS) was done the following week. Prenatal chromosome analysis was performed according to the standard cytogenetic methods using G-banding technique and a marker chromosome was detected in 30 metaphase spreads. Chromosome analysis of phenotypically normal parents was done to find the origin of abnormal chromosome. Karyotype analysis of the mother revealed 46,XX,rcpt(4;15)(q35;q21.3) while that of father had normal karyotype of 46,XY. Thus, fetus had an abnormal female karyotype of 47,XX,der(15)t(4;15)(q35;q21.3). Furthermore, to identify origin of the derivative chromosome, fluorescence in situ hybridization (FISH) analysis was performed on fixed metaphases by using commercially supplied telomeric, locus specific and centromeric probes. The patient was informed about poor prognosis associated with these findings and the family decided to terminate the pregnancy at 20 weeks of gestation. The female fetus had a crownheel length 24cm, foot length 3.2cm and head circumference of 13cm. Autopsy studies demonstrated depressed nasal bridge, bilateral low-set malformed earns, bilateral cystic dysplastic kidney, uretheral construction, bladder hyperplasia, aspleni and epicardial effusions. To date, many reports have described multiple congenital abnormalities in cases with unbalanced forms of reciprocal translocation (4;15) of parental origin, however, this case has
6th ECC: Abstracts
112 special significance since, these clinical findings such as aspleni have not been described previously.
defining the trisomy 4q phenotype, this case of familial pure partial trisomy 4q32q34 should contribute to the karyotype/phenotype correlation for this critical region.
1.204-P
Pure partial trisomy 4q32q34: a familial report with the associated phenotype A. Guichet, E. Colin, O. Ingster and D. Bonneau Service de Ge´ne´tique, CHU Angers, France Duplication of the long arm of chromosome 4 has been described in more that 60 patients. In most cases, the duplication resulting from an unbalanced segregation of a balanced translocation in one of the parents is associated with partial monosomy for other chromosomal material. This leads to wide phenotypic variability complicated by the number and size of the breakpoints reported. However, partial duplication of chromosome 4q has been very rarely reported. We present a case of familial pure partial duplication of 4q32q34, affecting a mother and her two sons, characterized by distinctly dysmorphic features and mental retardation. The index case was a boy referred for developmental delay at 18 months of age. The pregnancy had been uneventful. The child had dysmorphic features but showed no growth retardation. Bilateral convergent strabismus had appeared at the age of 12 months. At the time of consultation, the psychomotor delay was such that the child could neither walk nor talk. Cytogenetic analysis performed on a peripheral blood sample revealed a 46,XY, der(6)ins(6;4)(q26;q32.1q35) abnormality. FISH analysis (using commercial, BAC, and MultiFish probes) confirmed the pure trisomy 4q32q34. When the parental karyotyping was done, the mother_s karyotype showed the same 46,XX, der(6)ins(6;4)(q26;q32.1q35) abnormality. She also had distinctively recognizable dysmorphic features, and suffered from moderate mental retardation and strabismus. The couple had a second child for which they refused a prenatal cytogenetic diagnosis. Eventually, at birth they allowed the child to be karyotyped. He was then discovered to have the same karyotype as the mother and his older brother. He too had dysmorphic features but no strabismus as yet. As simple duplications are more useful for
1.205-P
Autosomal aneuploidies in three patients with normal phenotype Perez Granero, M. Bernues Martı´nez, R. Alfaro Arenas, B. Sierra, C. Govea Callizo and J. Rosell Andreu Hospital Universitario Son Dureta Autosomal aneuploidies give rise to mental retardation and/or different phenotypic features in most of cases. However, there are some cases with minimal repercussions. We report three patients with different numerical autosomal mosaicisms, that showed a normal phenotype. We also present a review of literature. Patient 1: A 25-year-old woman was referred to our hospital for genetic counselling because she had two abnormal pregnancies. The first one died at 24 weeks_ gestation and the second one was delivered at 27 weeks and died a week later. Cytogenetic analysis of peripheral blood of this patient showed 5% of cells with trisomy 18. Patient 2: A 37-year-old man was referred for infertility. Cytogenetic analysis revealed a trisomy 8 mosaicism (33%). Skin biopsy showed trisomy 8 mosaicism as well (10%). Patient3: A 29-year-old man was referred for genetic counselling with his wife, because the couple had an abnormal twin pregnancy. The first fetus aborted spontaneously at 9 weeks_ gestation, and the second one died inmediately after birth. The chromosome analysis of this patient revelad a 47,XY,psudic(9)(q13),+9/46,XY karyotype consistent with mosaicism for tetrasomy 9p. Skin biopsy showed a normal male karyotype. All three cases with a normal phenotype have a reproductive failure. Constitutional cytogenetic abnormalities have a wide variation in phenotype. It has been suggested that clinical findings could be influenced by the degree of mosaicism and the presence of tissue-limited mosaicism. We discuss the implications of these findings in genetic counselling and their involvement in infertility.
6th ECC: Abstracts
1.206-P
Chromosomal abnormalities in recurrent spontaneous abortions: investigation of 73 couples R. Frikha, M. Meddeb, A. Amouri, T. Rebai and N. B. Abdelmoula Faculty of Medicine Sfax, Genetics Laboratory, Tunis, Pasteur Institute, Tunis This paper presents the results of cytogenetic investigations in 73 couples referred to our genetic councelling clinic because of at least 2 spontaneous abortions. Seven structural chromosome abnormalities were found in 6 couples (8,22%). Three of them were pericentric inversion of the chromosome 9, two in men and one in a woman. Inv(9)(p11q13), despite being categorised as a minor chromosomal rearrangement, may favour fetal aneuploidy by possible presence of interchromosomal effects. If these are not considered, frequency of chromosome aberrations will be 5,48%. Two of the four major structural aberrations were detected in the same couple; a paracentric inversion, inv(10)(q25q26) in the man and a Robertsonian translocation; t(13;15)(q10;q10) in his wife. The two others were reciprocal translocations; a t(1;4)(q31;q26) identified in a woman and a t(4;17)(p16;p12) in a man. Two very low level mosaic numerical aberrations found at the cytogenetic level were eliminated by FISH (two 45,X cells in a woman and one 47,XXY cell in a man). Frequencies will be refined in considering the number of miscarriage recurrences and clinical history of patients. We conclude that cytogenetic analysis should be an integral part of etiological exploration in couples with recurrent abortions.
1.207-P
Cytogenetic abnormalities related to male infertility Abdelmoula
113 infertility and potentially transmissible to the offspring. To assess the frequency of chromosomal aberrations in reduced male fertility, 371 males with nonobstructive oligozoospermia (n=200), azoospermia (n=140) or teratospermia (n=31) were included in this study. Peripheral blood cultures were set up according to standard protocols and 15 RHG banded metaphases were analyzed in each case. Fluorescence in situ hybridization analysis was done in some cases to identify the percentage of mosaic cell lines and any cryptic or low-level mosaicism.. A total of forty three aberrant karyotypes was diagnosed, corresponding to an abnormality frequency of 11.6% (43/371). The following frequencies of abnormalities according to spermatogenetic impairment were observed: 21.4% (30/140) for azoospermic men, 5.5% (11/200) for oligozoospermic men and 6.4% (2/31) for teratospermic men. Among the azoospermic group of patients, sex chromosome abnormalities were predominant, 76.6% (27/30): 47,XXY (n=23), 46,XX (n=1), 47,XYY (n=2) and idic(Y) (n=1). There were three other autosomal abnormalities: rob(14;21) (n=1) and rob(13;14) (n=2). For oligospermic men, reciprocal translocations were the major abnormalities, 45,5% (5/11): t(4,9)(p15.3;p21), t(11;22)(q24;q11), t(16;22)(q13;q12), t(2;3)(p24;q26) and t(11;21)(q13;p11). Robertsonian translocations were found in 3 cases: rob(14;21) (n=1) and rob(13;14) (n=2). One patient mosaicism for numerical sex chromosome aneuploidy: 47,XXY[14]/46,XY[16] and two patients had a deletion of the Y. Finally, a familial t(1;18)(p21,q12) was detected in two men who have a teratospermia leading to a high frequency of chromosomal abnormalities in this group.
1.208-P
Williams-beuren syndrome children with supravalvular aortic stenosis and 7q11.23 microdeletion: clinical assessment and cytogenetic analysis Trabelsi, B. Gargouri, M. Meddeb, A. Amouri, T. Rebai and N. Abdelmoula Faculty of Medicine of Sfax
Faculty of Medicine Genetic abnormalities related to male infertility need to be considered in terms of being causative for male
In the present study, results of conventional and molecular cytogenetic analysis in eight Tunisian patients suffering from supravalvular aortic stenosis
6th ECC: Abstracts
114 are shown. Phenotypes of 7q11.23 microdeleted children are presented. Patients were diagnosed at the department of heart disease at Hedi Chaker Hospital of Sfax (Tunisia). Cytogenetic analysis consisted of standard karyotyping and 7q11.23 microdeletion identification by fluorescence in situ hybridization (FISH). No chromosomal aberrations were detected by RHG banding whereas 7q11.23 microdeletion was detected in four patients. The patients with the deletion were three males and a female aged 16, 5, 3 and 6 years respectively. Williams-beuren syndrome was suspected on the basis of dysmorphic facies or neurobehavioral phenotype in five patients. Diagnosis was confirmed for only four of them. In the remainder 4 children with isolated SVAS, 7q11.23 microdeletion was absent. Our study confirms the diagnostic usefulness of elastin gene deletion analysis by FISH and provides further evidence that the typical WBS phenotype is associated very often with 7q11.23 deletion. We concluded that screening of 7q11.23 microdeletion should be done for all patients with SVAS because establishment of Williams-Beuren syndrome in the neonatal period and infancy can sometimes be difficult. Moreover, a detailed cardiac evaluation must be performed in all patients with Williams-Beuren syndrome due to the high frequency of cardiovascular abnormalities. Detection of the 7q11.23 deletion by fluorescence in situ hybridisation (FISH) is a sensitive confirmatory test that facilitates genetic counselling, family screening, and the formulation of a long-term management plan for the patient. If no deletion is found in SVAS patients, mutational studies within the elastin gene should be performed to establish a phenotype-genotype correlation.
1.209-P
Identification of a chromosome 21 tandem duplication in a newborn Martinoli, Emanuela, M. Volonte`, M. Venturin, G. V. Zuccotti, L. Pogliani, L. Dalpra` and P. Riva University of Milan, L. Sacco Hospital, University of Milan, University of Milano-Bicocca, Monza Structural aberrations involving chromosome 21 are rarely detected. We identified the presence of a partial in tandem duplication of chromosome 21 in
a baby with pathological features. At birth the baby showed: Apgar 6 at 1 minute, 8 at 5 minutes, 9 at 10 minutes; weight 3040gr, lenght 49cm and cranic circumference 30,5cm. Nuclear magnetic resonance highlighted corpus callosum complete agenesia, enlarged lateral ventricles, especially on the left, near trigon and occipital lobe. Cerebella vermis had poor development showing only the most rostral portion, cerebellar hemispheres and encephalic trunk seem hypoplasic. In conclusion there are signs of encephalopathy prevalently in left hemisphere. Kidneys, liver, urinary tract, spleen and pancreas are normal. Based on QFQ banding technique the duplicated region was 21q11.2Y21.3. FISH using WCP21 probe confirmed the total chromosome 21 origin of the duplicated region and the LSI Down Syndrome Critical Region probe showed only two signals in the correct position on both chromosomes 21. The study of chromosome 21 polymorphisms of parental karyotypes and the child allowed the identification of a paternal variant on the duplicated chromosome 21. The molecular analysis will provide a fine definition of the duplicated region.
1.210-P
Prenatal diagnosis of chromosome disorders in Tunisian population Bhouri, H. Elghezal, S. Mougou, S. Hidar, W. Denguezli and A. Saad Farhat Hached University Teaching Hospital Cytogenetic prenatal diagnosis is used for detecting foetal chromosomal disorders in order to prevent mental and physical handicaps. It has become available in Tunisia since few years. Here, we report the results of 6012 foetal karyotypes carried out by cultured amniocytes analysis in the Cytogenetics and Reproductive Biology Department located in the University Teaching Hospital of Soussa (Tunisia), during the last 10 years. Karyotyping was performed on 4231 cases (70,38%) for the systematic screening of aneuploidy, either for advanced maternal age (936 years), or pathologic nuchal translucency thickness or pathologic maternal serum markers. Karyotyping was performed on 1781 cases (29,62%) for the exploration of a foetal malformation revealed by ultrasound scan, the presence of a chromosomal
6th ECC: Abstracts
115
anomalies in parents, brothers or close family or to identify the sex of the foetus in various medical situations. The global rate of chromosomal anomalies was 5.36%. The highest predictive value was observed in the group of balanced parental chromosomal anomalies (45.83%), fetal ultrasound abnormalities (11.14%) and nuchal translucency thickness (10.28%). These result emphasise the sensitivity of the parental chromosomal anomalies and fetal ultrasound anomalies however our maternal serum screening program should be revised in order to perform the pertinence of this prevention activity.
Conclusions: These results confirm the elevated impact of chromosomal abnormalities in infertile males. Numerical sex chromosomal abnormalities are the cause of more severe impairment of spermatogenesis than autosome abnormalities. Surprising was the finding that even in the families, where the males were with azoospermia or oligozoospermia, females had also a high incidence (11%) of chromosomal abnormalities. Our results showed the importance of performing routinely the chromosome analysis in both partners of the families with fertility disturbances.
1.211-P
1.212-P
Chromosomes in fertility disturbances
Interstitial deletion of chromosome 2q31Yq33 associated with ectodermal dysplasia features
Mikelsaar, J. Lissitsina and M. Punab Institute of General and Molecular Pathology, University of Tartu, Centre of Andrology, Tartu University Clinics Chromosomal abnormalities disturb the spermatogenesis and oogenesis, they cause higher frequency of spontaneous abortions and contribute to the decreased fertilization rate. They have been found in 3Y13% of infertile couples: in males 2Y14% and in females 1Y9.8%. The aim of this study was to detect chromosomal abnormalities in patients with fertility disturbances. A cytogenetic analysis (in each patient at least 35 metaphases were analysed) and FISH studies were performed in 143 infertile men (49 azoospermics and 94 oligozoospermics), 36 infertile couples and 30 control fertile men. Chromosomal abnormalities were detected in 17(11.8%) infertile males: in 9 azoospermics (18.4%) and in 8 oligozoospermics (8.5%). Autosomal abnormalities occurred most frequently in oligospermic (7.4%) and constitutional karyotype 47,XXY was more prevalent in azoospermic males (16.3%). Among 17 chromosomal abnormalities, mosaicism was diagnosed in 7 cases, of which 2 were in azoospermics and 5 (mainly autosomal abnormalities) in oligozoospermics. In 36 couples, in which men had either azoospermia or oligozoospermia, chromosome anomalies were found in 8(22.2%): in 5 males and in 4 females, whereas in one couple, both partners had a chromosome abnormality (mos47,XXY and 46,Xfra(X), respectively). Of female partners 8% had low-level gonosomal mosaicism.
Rifai, M. Port Lis, A. Aboura, B. Benzaken and A. Verloes National Institute of Health, Department of Pediatrics, University Hospital, Cytogenetics Unit, AP-HP Robert Debre´ Hospital, Clinical Genetics Unit, INSERM U676, AP-HP Robert Debre´ Hospital Deletion of 2q32 has been associated with the wrinkly skin syndrome (WWS) and isolated cleft palate. We report a patient with an interstitial deletion of the long arm of chromosome 2. She presented with prenatal and postnatal growth retardation, microcephaly, facial dysmorphism, cleft palate, camptodactyly, bilateral pes valgus, and severe mental retardation. She also showed thin and sparse, brittle, slowly growing scalp hair, oligodontia with abnormally shaped teeth, normal sweating and normal fingernails. These features are consistent with a diagnosis of ectodermal dysplasia. We will present precise mapping of the deletion, as determined by molecular cytogenetics techniques and compare it with previously reported cases. The MCA pattern of this girl confirms the existence of a clinically recognizable 2q32 microdeletion syndrome, as recently delineated by Van Buggenhout et al. (Eur J Med Genet 2005). It confirms that a novel locus for ectodermal dysplasia may lie on chromosome 2q31q33. We recommend to consider cytogenetic and/or molecular screening for del(2)(q32) in patients with severe MR and ectodermal dysplasia with teeth and hair involvement.
6th ECC: Abstracts
116
1.213-P
Cytogenetic analyses in medical genetic laboratory of medical biology department in Afyonkarahisar Kocatepe University Solak, Fıstık Tevhide, Eser Betu¨l, So¨ylemez Zafer, Yıldız Handan, ¨ . Erdog˘an Mu¨jgan, C O ¸ ag˘layan Sacide, Yu¨ksel Erdinc¸, S¸amlı Hale and S¸ims¸ek Solmaz Afyonkarahisar Kocatepe University, Faculty of Medicine, Department of Medical Biology, Dokuz Eylu¨l University, Faculty of Medicine, Department of Medical Biology and Genetic
1.214-P
Mental retardation, dysmorphic features and developmental delay of unknown origin: diagnostic relevance of conventional chromosome analysis and subtelomer FISH screening Gross, Kron, Vogt, Neuhaus, Seipel, Decker and Steinberger Bioscientia, Center for Human Genetics Mental retardation (MR) describes a pattern of persistently slow learning of basic motor and language skills during childhood and a significantly below-normal global intellectual capacity as an adult. Mental retardation is the most common developmental disorder. Approximately 3% of the total population are affected by MR. It is more common in males than in females. For nearly 50% of the patients, the cause of mental retardation is not known. Genetic alterations account for 30% of cases and are thus the most common cause of MR. Mental retardation occuring in combination with dysmorphic features can be the result of structural changes of the terminal
parts of the chromosomes: the subtelomeric regions. These changes are found in 7Y10% of the affected patients. Thus subtelomeric mutations are the most common cause of developmental delay. In contrast to these findings, only 1% of cases with mental retardation are caused by molecular changes which are responsible for the fragile X syndrome. Over a period of almost 10 years (1997 to 2007) we analysed 4851 patients by conventional chromosome analysis with one or more of the following symptoms: mental retardation, dysmorphic features, developmental delay and suspected diagnosis of fragile X syndrome. We studied 64,7% (3139) males and 35,3% (1712) females. A chromosome abnormality was found in 8,2% (398) patients, 50,3% (200) in males and 49,7% (198) in females. Furthermore we analysed 234 cases with the subtelomer FISH method. For 14,5% (34) of the cases alterations of the subtelomeric regions, that could not be diagnosed with conventional chromosome analysis were detected. Taken together the results of the subtelomer FISH and the conventional chromosome analyses it could be demonstrated that these methods make especially in this combination- an important contribution to the identification of genetic causes of mental retardation.
1.215-P
Two cases with similar clinical symptoms but different karyotypes Eser, Solak Mustafa, Fıstık Tevhide, Bu¨ku¨lmez Ays¸egu¨l, Ko¨ken Res¸it, S¸amlı Hale and So¨ylemez Zafer Afyonkarahisar Kocatepe University, Faculty of Medicine, Department of Medical Biology, Afyonkarahisar Kocatepe University, Faculty of Medicine, Department of Pediatrics Cytogenetic analysis currently assist to define and diagnose many inherited disorders with similar clinical symptoms despite having different chromosomal rearrangements. In this study, cytogenetic analysis was carried out in our department for two cases diagnosed as Bmultiple anomalies^ in the Department of Pediatrics. Case 1: A four day-old baby (H.K.) had micrognatia, with thin and long fingers, with
6th ECC: Abstracts additional camptodactyly of the 1st and 2nd fingers, flexion contracture at the elbow and knee joints, high palate, clitoromegaly, prolapse of vagina, VSD and PDA. Case 2: The second four day-old baby (H.K.) also had some similar symptoms such as micrognatia, ASD and PDA as well as some different ones such as nail hypoplasia, triggered finger, fingers in flexion positions, compressed nose, and frontal bossing. Chromosomal analysis was performed using modified Bwhole blood^ and Bmicrotechnique^ methods followed by Giemsa-Trypsin- Leischman (GTL) banding in our laboratory. For both cases, 50 metaphase spreads were investigated. The karyotype of the first case was determined as 46,XX,dup(1)(q31q41), and the second one was, however, 47,XX,+18. This study also proves the importance and necessity of the cytogenetic investigations for supporting and confirming the differential diagnosis as well as for finding out the different chromosomal abnormalities in cases with similar clinical symptoms.
1.216-P
Polymicrogyria associated with a de novo partial monosomy 18p and partial trisomy 20p Mabboux, S. Brisset, V. Gadjos, M. L. Maurin, P. Labrune and G. Tachdjian Service d_Histologie, Embryologie, Cytoge´ne´tique, INSERM U782, AP-HP, Universite´ Paris Sud, Hoˆpital Antoine Be´cle`re, Clamart, Service de Pe´diatrie, Hoˆpital Antoine Be´cle`re, Clamart, Service d_Histologie, Embryologie, Cytoge´ne´tique, INSERM U782, AP-HP, Universite´ Paris Sud, Hoˆpital Antoine Be´cle`re, Clamart This is a presentation of a rare case of mosaicism of partial monosomy 18p and partial trisomy 20p. A fifteen-month old girl was referred at our pediatric_s unit because of developmental and growth delay, dysmorphic features including microcephaly, bilateral ptosis and telecanthus and nervous system anomalies. Brain MRI was performed, highly suggesting the diagnosis of polymicrogyria. The proposita was the first child of healthy unrelated parents originating from Chad. She was born after a full term uneventful pregnancy. The family history was not contributory. Chromosome and FISH analyses performed on
117 peripheral blood lymphocytes showed a mosaic and complex karyotype with four different cell lines. Eighty-one percent of studied cells have 46 chromosomes with a dic(18;20)(p11.1;p11.2) and an inv dup(20p). The dic(18;20) was a result of a translocation of the segment 18p11.1 onto 20p11.2. Different skin biopsies underlined the complexity of the karyotype and confirmed the mosaicism. Both parents were cytogenetically normal, suggesting a de novo rearrangement. The literature dealing with partial monosomy 18p/ partial trisomy 20p has been reviewed and four cases have been reported. All of them resulted from abnormal segregation of a balanced parental translocation. Possible mechanism(s) giving rise to this complex karyotype and genotype-phenotype correlation are discussed.
1.217-P
A case of t(11q;15q) in a child with intractable epilepsy F. Celep, F. M. Sonmez and A. Karaguzel Karadeniz Technical University Faculty of Medicine, Dept. of Medical Biology,Trabzon, Turkey, KTU Fac of Medicine Dept. of Pediatric Neurology, Trabzon, Turkey The four year old female patient was admitted to Child Neurology outpatient clinic with complaints of mental and motor retardation and generalized tonicclonic convulsions. She was the third child of nonconsanguineous parents following a full-term uncomplicated gestation. The other childeren of the family were mentally retarded. After delivery, she had polycythemia. Physical examination revealed severe mental and motor retardation with growth retardation (weight 11 kg, height 98 cm) and microcephaly (42.5 cm, below 3 percentile). There was micrognathia, low-set ears, clinodactyly of fifth fingers, hammer thumb, pescavus deformity and flexion deformity in right elbow. Neurological examination revealed hyperactivity of deep tendon reflexes, positive babinsky sign and spasticity. Laboratuary investigation showed iron deficiency anemia. Other biochemical results including ammonium, lactat, tandem MS and urine organic acids were normal. Echocardiographic and ultrasonograpic evaluation were normal. EEG revealed active epileptiform
6th ECC: Abstracts
118 abnormality derived from bilaterally parietooccipital region. In MRI investigation, cerebral atrophy was observed. Sodium valproate treatment was started. Because of the intractable seizures, three different antiepileptics were added to valproate therapy. Two months later, she was admitted to status epilepticus and died. Chromosomal studies were carried out on cultures of peripheral blood lymphocytes and metaphase spreads prepared by standard procedures. She had a chromosomal abnormality; 45,XX,t(11;15) (q24;q11.2),del(15)(pter-9q11.2). Investigation of the chromosomes of the parents showed that the abnormality had been inherited from the mother who was a carrier of the balanced translocation. Her father had a normal karyotype.
1.218-P
A severely mentally and motor retarded 9 years old girl with monosomy 3pter-p25 and trisomy 8q24-qter due to a familial reciprocal translocation t(3;8)(p25;q24) in a mother, maternal grandmother and prenatally diagnosed brother Balci, Ebru Aypar, M. Sinan Beksac and Oliver Bartsch Hacettepe University, Department of Pediatrics, Hacettepe University Ihsan Dogramaci Children’s Hospital, Department of Obstetrics and Gynecology, Hacettepe University Faculty of Medicine, Institute for Human Genetics, Johannes Gutenberg University We report a family with a t(3;8)(p25;q24) in three generation, maternal origin. The mother had 46,XXt(3;8)(p25;q24) and her mother had the same karyotype. The maternal grandmother had four spontaneous abortions and the mother had three abortions, and a 9 years old severely mentally and motor retarded female. This patient was first admitted at age 17 months. She had never talked and walked. She was microcephalic and spastic,and had a high arched palate, thick philtrum, micrognathia and a small hemangioma on the upper lip. The mother had a balanced reciprocal translocation t(3;8)(p25;q24). Fluorescent in situ hybridization (FISH) showed the breakpoint 8p24 was located distal to the TRPS1
locus, the gene for trichorhinophalangeal syndrome. The mother was pregnant again and we performed amniocentesis. The fetal karyotype was 46,XY,t(3;8) (p25;q24). The baby was born by cesarian section and was healthy. FISH study demonstrated t(3;8)(p25; q24)(wcp8+sp;wcp8+sp;D8S547/TRPS1+st, D3S1270/D3S1297+mv). The baby was also phenotypically normal. This is a very interesting familial reciprocal translocation t(3;8) with abnormal findings with a breakpoint in 8q which does not distrupt the region of TRPS1. This has not been reported in the literature previously. Stefanova M. et al. reported a balanced reciprocal translocation t(3;8)(p21.2;q24.3) in a mother and daughter with Zimmermann-Laband Syndrome in 2003.
1.219-P
X aneuploidy scoring by FISH Erdel, P. Probst, D. Mueller and G. Utermann Medical University Innsbruck The detection of low level gonosomal mosaicism during routine cytogenetic analyses in adult females is often difficult to interpret. Reasons are biological as the age dependent loss of X chromosome in female blood lymphocytes or technical due to selection of cells during lymphocyte culture, delocalization of single chromosomes in metaphase preparations or co-localization of FISH signals in interphase nuclei. For these reasons we screened 50 healthy females aged from 21 to 42 years for X aneuploidy. Per subject 50 lymphocyte metaphases (MP) and 200 interphase nuclei (IP) from PHA stimulated peripheral blood cultures were analyzed by FISH. The frequency of X chromosome loss ranged from 0% to 8.6% and that of triple X from 0% to 6.8%. The mean rate for X chromosome loss on MP and IP was 2.2% and 3.9%, respectively, and for triple X 0,5% for both techniques. The females were then divided into two equally sized age groups. At age 21 to 35 years the means for X loss were 2% and 2,5% and at age 36 to 42 years 3.7% and 4.1% on MP and IP, respectively. A similar age related effect on frequency of triple X (0.4% vs. 0.7%) was observed on MP but not on IP (both groups 0.5%). On the basis of these data the cut off value (defined as mean of false positive plus 3 times the standard
6th ECC: Abstracts
119
deviation) for a disorder related X chromosome aneuploidy was set to 9.1% (MP) and 8.3% (IP) for X chromosome loss and 4.4% (MP) and 2.1% (IP) for triple X. Our data should further assist diagnostic cytogenetic laboratories to interpret the significance of 45,X and 47,XXX cells detected in women aged from 21Y42 years.
1.221-P
1.220-P
Cytogenetically recognizable insertions are rare findings in clinical cytogenetics. So far, almost all cases with a partial trisomy due to an unbalanced segregation were associated with multiple congenital anomalies and/or mental retardation (MCA/MR). Here we report a family with a balanced 6/7 insertion in the father (karyotype: 46,XY,ins(7;6)(p15;q16? q16?)) and partial trisomy in his obviously healthy daughter. The father had 4 children with three wives. One child died postnatally due to a severe cardiac defect, two children had MCA/MR but were not available. Following the diagnosis in the father the eldest daughter asked for genetic counseling. She was twenty years old, obviously healthy, had attended a regular school, and was now working as a waitress. Surprisingly, cytogenetic investigations revealed two normal chromosomes 6 and one derivative chromosome 7 (karyotype: 46,XX,der(7)ins(7;6)(p15;q16? q16?)). Molecular cytogenetic investigations localized the breakpoints to 6q16.1, 6q21, and 7p15 and demonstrated a partial trisomy of at least 9.75 Mb containing a minimum of 20 genes. More exact breakpoint determination is in progress. In conclusion, this case further illustrates the variability and plasticity of the human genome, and should make cautious in the clinical interpretation of cytogenetic results in particular copy number variations.
Fetal wastage associated with parental chromosomal abnormalities: a Tunisian study Amouri, Ben Rekaya Mariem, Talmoudi Faten, Kilani Olfa, Ounaies Najla, El Kamel Lebbi Imen, Kacem Olfa, Kaabi Yoldos, Zhioua Fathi and Bouayed Abdelmoula Nouha Pasteur Institute of Tunis, Service de Gyne´cologie, Hopital AZIZA OTHMANA, Tunis, Laboratoire d’Histologie Embryologie, Faculte´ de Me´decine de Sfax, Tunisia Infertility and recurrent miscarriage are a major medical-social problem in Tunisia. Recurrent miscarriage (RM;92 consecutive early pregnancy loss) affects around 1% of fertile couples. Several causes are responsible for the condition called Frecurrent_ or Frepeated_ abortion. Parental chromosomal anomalies have been directly associated with repeated abortions. Since April 2002, 122 couples were referred to our Cytogenetic Laboratory of the Pasteur Institute of Tunis for chromosomal analysis after two or more miscarriages. Altogether, 15 abnormal karyotypes were found and the overall incidence of chromosomal abnormalities was 12% (women 8%; men 4%). Among them, 8 cases (53%) have a balanced translocation; 1 case (6%) was carrier of a pericentric inversion. In 40% cases with abnormal karyotypes, we found some cell lines with aneuploidies of sex chromosomes. So, overall 7,5% of the couples ascertained for RM, included one carrier. It also appear that translocations (both robertsonian and reciprocal) and inversion were associated with a higher risk of pregnancy wastage. Therefore, genetic counselling should be offred to these couples and investigations performed on their extended families.
Partial trisomy 6q in a healthy woman Mueller, M. Erdel, C. Fauth, F. Fresser, G. Utermann and D. Kotzot Department for Medical Genetics, Molecular and Clinical Pharmacology, Medical University Innsbruck
1.222-P
Prenatal diagnosis of a XX male in a fetus with increased nuchal translucency Murru, A. Azzena, L. Martorana, S. Deidda, M. Agiolucci, M. Balestrino, R. Marongiu, M. Virdis, S. Orru` and C. Carcassi University of Cagliari
6th ECC: Abstracts
120 The incidence of sex differentiation disorders is estimated by prenatal diagnosis to be 1/2500. Among these disorders XX male syndrome is rather uncommon with an incidence of 1/20000 newborn males. We report a case of a 38 years old woman, referred to our genetic counselling service during the 14th week of gestation to perform prenatal diagnosis because of an increased nuchal translucency (NT 2.8 mm with a CRL 73 mm). The risk of chromosomal pathologies in this pregnancy was increased to 1:27 (from 1:127, for maternal age). Bi-test analysis showed normal levels of hCG and PAPP-A. Cytogenetic analysis on in-situ cultured amniocytes (14 clones) by GTG banding revealed a 46,XX karyotype. The routine foetal ultrasound examination performed two weeks after amniocentesis revealed discordance between chromosomal sex (46,XX) and phenotypic male sex. In order to exclude male XX syndrome, human error, massive maternal cells contamination, deficit of 21-OH, a cytogenetic analysis of foetal blood from the umbilical cord was performed. FISH of uncultured lymphocytes first, and GTG banding later, confirmed a 46,XX karyotype. Pregnancy was subsequently interrupted. Post-mortem examination revealed a normal male fetus, with biometric parameters consistent with gestational age. FISH analysis revealed the translocation of SRY gene in the paternal X chromosome. XX male syndrome is rather uncommon and probably underestimated because chromosomal sex and phenotypic sex, revealed during ultrasound examination at 20th week, are not methodically compared. This is the first report of an association between XX male syndrome and increased nuchal translucency.
1.223-P
Two sibs with currarino syndrome with 7q34 deletion due to maternal t(7;14)(q34;p13) Silan, C. Zafer, D. Kuru, K. Mahmutyazicioglu and S. Hacihanefioglu Duzce University, Istanbul University, Karaelmas University We present two sibs with Currarino syndrome due to a 7q34 deletion. The Currarino triad involves the
association of partial sacral agenesis with intact first sacral vertebra (sickle-shaped sacrum), a presacral mass, and anorectal malformation (Currarino et al. 1981). The specific sacral anomaly is distinct to this syndrome. A pregnant woman was referred to us because she was anxious about her husband_s nephews who had mental retardation and congenital anomalies. Their parents are first degree relatives. Case 1:15 year-old male patient with microcephaly, flat occipute, big dismorphic ears, narrow palpebral space, enophthalmus, ezotrophia, nose asymetry, thin upper limb. He was operated on three times for chronic constipation. Case 2:13 year-old female patient with microcephaly, big ears and thick limbs. She had one operation for chronic constipation. Congenital sacral hyphoplasia, tethered cord, neurogenic bladder and hydronephrose were detected. We analysed chromosomes from peripheral blood samples and found pure 7q34Yqter deletion due to a maternal balanced translocation, t(7;14)(q34;p13). Result of FISH analysis of the mother was: 46,XX, t(7;14)(q34;p13).ish t(7;14)(q34;p13)(wcp7+;wcp14+). The Patient_s uncle (and mother_s cousin) who is the husband of pregnant woman was also analysed and found to be normal. Clinical and chromosomal findings in these patients are compared to those previously recorded in similarly investigated patients from the literature with terminal 7q deletion.
1.224-P
Sry gene in a female 45,X[45]/46,X,+mar[55] Martorana, R. Murru, M. Atzeni, A. Azzena, M. Angiolucci, A. Floris, V. Licheri, A. Maludrottu, S. Orru` and C. Carcassi University of Cagliari We describe a case of 41 year old woman, referred to our genetic counselling service for infertility. Anamnestic data showed primary amenorrhoea, streak gonads and uterine hypoplasia. Histological analysis from gonadic biopsy showed atrophic ovarian tissue with absence of follicles. Development of secondary sex female characters and height were normal. The patient received hormone replacement therapy from the age of 20. Cytogenetic analysis on cultured
6th ECC: Abstracts lymphocytes by GTG banding revealed a mosaic karyotype: 45,X[45]/46,X,+mar[55]. By Multipainting FISH, marker chromosome was identified as Y derivative. Locus specific FISH showed a positive signal of SRY gene in all the markers. The patient was referred for gonadectomy due to a high risk of developing gonadoblastomas. Until now very few cases of mosaic showing Y cell line are described in females without stigmata of Turner_s syndrome. The study of these patients may help to elucidate many of the molecular events that are involved in sex differentiation and reproductive disorders. A deeper understanding helps to improve patient care both by avoiding unfavourable events and by increasing the quality of their life.
1.225-P
The usefulness of comparative genomic hybrydization (CGH) in genetics counselling process Kałuz˙ewski, A. Mastalerz-Eckelsdorf, I. Płowas´, Z. Helszer and M. Constantinou Medical University of Lodz, Genetics Clinic, Medical University Hospital No. 3 in Lodz We present a 2 year of experience on the usefulness of CGH with the use of the dynamic standard reference intervals defined in our laboratory. The CGH was used for definition of standard reference intervals on the basis of an average of 20 control cases. CGH technique was employed in the routine studies of 24 patients, including 6 cases with normal karyotype, 5 cases with chromosomal aneuploidy, 8 cases with mosaic marker chromosome and 5 cases with chromosomal translocation. The obtained results were confirmed by FISH or M-FISH. The chromosomal imbalance was detected in 16 of 24 cases. The CGH allowed for clarification of chromosome aberration in 8 cases and for confirmation of chromosome aberrations in 6 cases. In 2 cases the CGH allowed for identification of subtle chromosome rearrangation. Genetic counselling was feasible in 21/24 of analysed cases. with chromosomal imbalance detected by CGH. In our studies this method was especially useful for clarification of
121 chromosome aberrations and identification of origin of chromosome markers. The presented results confirm the attractiveness of the CGH for these laboratories, which, for economical reasons, are not able to use the microarray CGH.
1.226-P
Trisomy of medial 15q as result of analphoid supernumerary ring chromosome detected by CGH and FISH Constantinou, I. Płowas´ and B. Kałuz˙ewski Medical University of Lodz, Genetics Clinic, Medical University Hospital No. 3 in Lodz We report on a 21 year old patient with a de novo mosaic, analphoid ring of chromosome 15q22.2Yq24.1. The clinical manifestations of this patient are mild and include long stature, obesity, striae distensae in the hypogastrium, malocclusion and bilateral gynecomastia with scarce glandular tissue. M-FISH and FISH using a chromosome 15 painting probe indicated that the ring is of chromosome 15 origin. Further CGH analysis and FISH with the PML locus-specific probe and BAC probes specific for 15q demonstrated that the extra material derived from the medial part of the long arm of chromosome 15, including bands q22.2, q22.3, q23, q24.1. Additionally we positively verified the presence of DNM1DN6 and DNM1DN7 duplicons on the chromosome marker. In our opinion, the most likely location of kinetochore formation is 15q24.1. We discuss the relationship between the genotype and phenotype of the patient, comparing it to the reported cases of trisomy of medial 15q.
1.227-P
Prenatal cytogenetic analysis results, cytogenetic diagnosis center, duzen laboratories group Burul, Aksakal, Candemir and Laleli Duzen Laboratories
6th ECC: Abstracts
122
1.228-P
Postnatal cytogenetic analysis results, genetic diagnosis center, duzen laboratories group Z. Candemir, M. Ozdemir, S. Keles, M. Bahce, Y. Ozkutlu and Y. Laleli Duzen Laboratories
1.229-P
A prenatal case of a 46,XX[44]/ 48,XX,+2XMAR[11].ish(D14Z1/ D22Z1+,WCP+)mat. karyotype, with marker chromosome effects on the phenotypes in three generations
ments are disscussed. Although the family members carrying the marker chromosome have normal phenotypes, the effect of the the mosaic marker in the fetus cannot be determined. With all this information genetic counselling was given to the family. The etiology of the mentally retarded child has to be identified before a new pregnancy should be planned.
1.230-P
Small supernumerary marker X chromosome lacking XIST in a boy with isolated short stature Esclaire, F. Terro, S. Bourthoumieu, M. Bardel, V. Aubard, C. Le Caignec and C. Yardin
Sayar, G. Toksoy, B. Turkover, T. Yardımcı and Z. Sahinoglu
Limoges University Hospital, Nantes University Hospital
Zeynep Kamil Women and Children’s
Small supernumerary marker chromosomes (SMCs) are reported in about 0.05% of the human population. Approximately half of these markers are present in mosaic karyotypes. SMCs can be derived from all human chromosomes but markers derived from the X chromosome are relatively rare. Phenotypic consequences of SMCs can considerably vary depending on differences in euchromatic DNA-content, different degrees of mosaicism and uniparental disomy of the chromosomes homologous to the SMC. In the particular case of markers derived from the Xchromosome, phenotypic consequences depend on an additional specific parameter: the presence or not of the XIST gene in the mar(X) or r(X). Because XIST gene is required for the inactivation of the X chromosome, it has been hypothesised that the loss of XIST results in functional disomy for the sequences contained in the marker or ring chromosome, which is responsible for an abnormal phenotype. Indeed, all the previously described male or female patients with a small supernumerary XISTnegative mosaic mar(X) or r(X) exhibited mental retardation and/or facial dysmorphism and congenital abnormalities. Here, we report on a mosaic supernumerary XIST-negative mar(X) in a male patient with a normal phenotype except a short stature. This mosaic 47,XY,+mar(X)/47,XXY/46,XY was first prenatally diagnosed in amniocytes at 35 weeks of
Fetal karyotype 46,XX[44]/48,XX,+2xmar[11] was identified by amniotic fluid analysis of a pregnant woman referred for advanced maternal age and a mentally retarded child. CBG and NOR banding analysis showed that these marker chromosomes are monocentric and bisatellited and that they have the same structure. In order to identify whether they are inherited in the family, chromosome analysis of the parents and their mentally retarded child was done. The results showed that the mother has the same marker in a singular form with mosaic structure and the mentally retarded child has the marker in the singular form in all cells from blood lymphocytes. Additionally chromosome analysis was done on the grandparents. The grandmother has the same marker with mosaic structure in singular and double copy. To identify the origin of the marker specific to this family FISH analysis was performed and the origin from chromosome 14 was determined. The painting probes include series involving satellites, therefore the existence of euchromatin materials in the marker chromosome could not be proven. Second level ultrosonographic findings were normal. The fetus has two marker chromosomes in mosaic form so that an adverse effect on the phenotype cannot be predicted; genetic counselling and prenatal treat-
6th ECC: Abstracts gestation because of intra-uterine growth retardation. The newborn presented the same mosaic in lymphocytes and exhibited a normal male phenotype with growth retardation (j3SD) but without any congenital malformation or dysmorphic feature. The followup until 36 months of age showed growth retardation without any clinical or psychomotor abnormality. This unexpectedly mild phenotype suggests that the prognosis for mar(X) or r(X) chromosomes lacking XIST may be better than had been previously considered. This has important implications for counselling, especially when such mar(X) or r(X) chromosomes are prenatally diagnosed.
1.231-P
Chromosomal aberrations detected prenatal during last ten years in Vojvodina Jovanovic Privrodski, Kavecan Ivana, Krstic Aleksandar, Gacina Ljiljana, Rudez Jasmina and Radoicic Savic Gita Institute for Children and Youth Health Care of Vojvodina Center For Medical Genetics is regional center for teritory of Vojvodina (northern part of Sebia) and it serves 2.000.000 inhabitants. In teritory of Vojvodina there are 20.000 deliveries per year. In this paper we present frequencies of pathological findings of karyotypes in prenatal material. During last ten years 1997Y2006 we had 21.369 prenatal analyses. We had 18.423 karyotype analyses from amniotic fluid, and we found 220 patological findings. We had 2532 analyses from fetal blood (77 patological findings), and we had 414 chorion villi samples (58 patological findings). During last ten years in our Centre we have found 355 fetuses with chromosomal aberrations (1.66%).
1.232-P
Frequencies of prenatal and postnatal detected trisomy of chromosome 21 in vojvodina in last ten years
123
Kavecan, Jovanovic Privrodski Jadranka, Krstic Aleksandar, Obrenovic Milan, Gacina Ljiljana, Tarasenko Tatjana, Cihi Valerija, Fojkar Mirjana and Rudez Jasmina Institute for Children and Youth Health Care of Vojvodina
1.233-P
Prenatal mosaicism of 45,X[27]/ 46,X,idic(Y)(q11)[17]/46,X,+mar[3]: characterization of Y chromosome structural abnormality by molecular and cytogenetic studies N. Baena, E. Solsona, N. Aloui, C. Ferna´ndez, A. Cisneros, N. Belzunces, M. Costa, A. Alvarez, M. Piferrer and N. Capdevila Balague´ Center Dicentrics Yp are among the most common structural abnormalities of the human Y chromosome and they are usually associated with mosaicism. An isodicentric chromosome for the short arm of the Y chromosome is associated with a wide range of phenotypes. It has been reported in females with Turner syndrome, short stature alone, children with ambiguous genitalia, infertile male and normal males. We report a 35-year-old pregnant woman referred for anxiety. A sample of amniotic fluid was taken for karyotyping. QF-PCR showed a normal fetus for chromosome 13, 18 and 21, but two cell lines, XY and XYY, were detected. FISH in uncultured amniocytes with centromeric probes of chromosomes X and Y showed 40.2% nuclei XY, 34.8% nuclei XYY and 21.4% nuclei X. Cytogenetic study in amniotic fluid showed three cell lines, a 45,X in 57,4% of metaphases, a 46,X,idic(Y)(q11) in 36,2% of metaphases, and 46,X,+mar in 6,4% of metaphases from two primary cultures. FISH in metaphase cells with centromeric probes of chromosomes X and Y showed that the chromosome marker is derived from the Y chromosome. We suggested ultrasound examination in order to evaluate fetal gender and a molecular study of microdeletion of chromosome Y. Ultrasound showed a male and molecular study indicated a deletion of AZFb, AZFc
6th ECC: Abstracts
124 and AZFd genes Previously, it has been suggested that the proportion of cells containing the idic Yp might influence the phenotypic sex of the carrier but it is demonstrated that phenotypic sex cannot be predicted on the basis of the proportion of 45,X cells found in amniotic fluid cultures. Adult males with idic Yp present with a history of infertility and it is due to a result of loss or disruption of all or part of the Yq11.2 AZF gene. When an unusual sex chromosome abnormality is found at prenatal diagnosis the range of associated phenotypes is not well delineated confounding genetic counselling. During counselling the possibility of future infertility in idic Yp males should be included.
1.234-P
to be polymorphism. Final report shows a translocation t(6;12)(q26;p13) inherited from the mother. Molecular cytogenetic technology should be used in cases with suspected structural deletions, these studies demonstrate the value of a systematic search for cryptic chromosome rearrangements. The identification of balanced translocation carriers emphasizes the significance for genetic counselling and prenatal diagnosis.
1.235-P
A case 45,XX, t(13q;14q) with heterozygote mutation (F, XIIIV34L, MTHFRC677T and MTHFRA1298C)
Prenatal molecular characterization of a 46,XY,?del(12)(p13) case in a cytogenetic study from amniotic fluid
¨ zdemir and C Sezgin, C ¸ akar, O ¸ olak
Adela, E. Solsona, N. Aloui, C. Ferna´ndez, N. Belzunces, M. Costa, J. M. Cabada, N. de los Santos, A. Alcala´ and A. Ac¸c¸ Alvarez
Cytogenetic and Y chromosome microdeletion screening in infertile males
Balague Center
M. Balkan, S. Tekes¸, H. Isi, A. Gedik, S. Simsek and M. N. Alp
Cryptic rearrangements involving the terminal regions of chromosomes are suspected to be the cause of idiopathic mental retardation in a significant number of cases. We describe a case ascertained prenatally because of advanced maternal age that showed a karyotype of 46,XY,del(12)(p13) in 20 metaphases from two independent cultures. We recommended confirming this result by FISH in order to exclude a cryptic translocation. FISH analysis with sub-telomeric probe of chromosome 12 showed a signal of 12p in an other chromosome from group B or C. Then, FISH was performed using centromeric probes from chromosomes 4, 5, 6 and telomeric probe from chromosome 12 shows a signal of 12ptel in 6qtel (identified by probe CEP6). This results shows a translocation t(6;12)(qtel;ptel). Positive findings should be followed up with parental studies showing the same translocation in the mother. MLPA study detected a deletion of gene PSMB1 mapped at 6q27 which was inherited from the mother and a deletion of gene PSMB1 which was considered
Cumhuriyet University
1.236-P
Dicle University AIMS: The aims of this study were to detect the type and prevalence of major somatic chromosomal anomalies and Y chromosomal microdeletions (azoospermia factor genes, AZF) in infertile men referred to human medical genetic centre from urology clinic of Dicle medical faculty prior to employment of assisted reproduction techniques. Materials and methods: 80 infertile men (52 were azoospermic, 25 were oligospermic and three were asthenospermic) were studied for the cytogenetic evaluation and molecular AZF screening program. Karyoptying was performed on peripheral blood lymphocytes according to standard methods. Polymerase chain reaction (PCR) amplification using 15 Y-specific sequence-tagged sites of AZF region were performed to screen the microdeletions in the AZF region of the Y chromosome. RESULTS: The 71 (88.8%) of 80 cases had normal karyotype (46,XY).
6th ECC: Abstracts The total prevalence of chromosomal abnormalities was found to be 11.2% (9/80), including 7 patients with Klinefelter syndromes and 2 patients with balanced autosomal rearrangements. All of the patients with Klinefelter Syndrome had azoospermia, but carriers with translocation had oligospermia. The deletions of the Y chromosome were seen in one patient (1.3%) with features of normal karyotype and azoospermia. Microdeletions were seen in the AZFc and AZFd regions. Neither AZFa nor AZFb microdeletions were detected. Conclusions: Our findings suggest the need for routine cytogenetic analysis and PCR screening prior to employment of assisted reproduction techniques.
1.237-P
Prenatal diagnosis of a direct intrachromosomal duplication 11p12Y11q11.1f2.1 Kieback, C. Hennig, A. Jauch and T. Liehr Gemeinschaftspraxis Prager/Junge/Hennig/Linne, Dresden, Germany, Institut fu¨r Humangenetik, Ruprecht-Karls-Universita¨t, Heidelberg, Germany, Institut fu¨r Humangenetik und Anthropologie, Jena, Germany Prenatal diagnosis of a direct intrachromosomal duplication 11p12Y11q11.1õ12.1, a one year follow up Kieback,P.(1); Hennig,C.(1);Jauch,A.(2);Liehr,T.(3) (1)Gemeinschaftspraxis Prager/Junge/ Hennig/Linne,Dresden,Germany (2)Institut fu¨ r Humangenetik, Ruprecht-Karls-Universita¨t, Heidelberg, Germany (3) Institut fu¨r Humangenetik und Anthropologie, Jena, Germany Amniocentesis was performed after a positive test result of the first trimester screening: risk for Down syndrome 1:27 with increased nuchal translucency (NT) of 3.4 mm and missing nasal bone. Prenatal cytogenetic analysis revealed the karyotype 46,XX,dup(11)(p12p11)dn. FISH analysis was performed to confirm the breakpoints. A dicentric chromosome 11 with a direct duplication of 11p12Y11q11.1õ12.1 was identified. The following fetale karyotype was observed: 46,XX,dup(11)(p12p11)dn.ish dup(11) (p12q11.1õ12.1)(wcp11+,AN+,D11S324+,WT1+,
125 dJ1053P10+, bA12C11+, D11Z1+,dJ1053F10+, bA12C11+,D11Z1+,bA77M7+). Parents decided to continue the pregnancy. A healthy girl was born at term. At the age of one year she had no developmental delay and no major abnormalities. There was only mild craniofacial dysmorphism: round facies, flat occiput, hypertelorism, wide nasal bridge, broad nasal tip and a deep philtrum. The clinical examination showed no other physical or neurological abnormalities except of a strabismus divergens alternans and mild hyperopia with astigmatism. To our knowledge this is the first report of a dup(11)(p12q11). E. Goossens described a patient with a similar duplication dup(11)(p12). His patient was a 53-year-old male with mild to moderate mental retardation without gross dysmorphic stigmata. Both patients with dup11p12 show similar clinical signs: round facies, flat occiput and a strabismus without severe dysmorphic features and no internal malformations were detectable. While the man shows a mild to moderate mental retardation the psychomotoric development of the girl at the age of one year was normal.
1.238-P
Detection of Y chromosomal material in patients with a 45,X karyotype by PCR method C. Nur Semerci, N. Lale Satiroglu-Tufan, Serap Turan, Abdullah Bereket, Beyhan Tuysuz, Elif Yilmaz, Hulya Kayserili, Birsen Karaman, Serap Semiz, Fusun Duzcan and Huseyin Bagci School of Medicine, Pamukkale University, School of Medicine, Marmara University, Cerrahpasa Faculty of Medicine, Istanbul University, Istanbul Faculty of Medicine, Istanbul University, Department of Pediatrics, School of Medicine, Pamukkale University, School of Medicine, Pamukkale University A 45,X karyotype is one of the common chromosomal abnormalities characterized by short stature, lack of development of secondary sexual characteristics, webbed neck and cubitus valgus. This phenotype was described by Turner in 1938 and was called Turner syndrome (TS). About 40Y60% of the patients
6th ECC: Abstracts
126 with TS phenotype have a 45,X karyotype, the rest either have a structurally abnormal X or Y chromosome or mosaicism with a second cell line. Determination of Y chromosome derivatives in patients with a 45,X karyotype is important for the management of these patients due to increased risk of gonadoblastoma. Low level mosaicisim of Y chromosome may be missed by cytogenetic methods. The aim of our study is to analyze cryptic Y chromosome derivatives using Y specific sequences in 40 Turkish patients with pure a 45,X karyotype. 14 different Y specific sequences along the Y chromosome were selected for the detection of cryptic Y chromosome material by PCR analysis. The present study demonstrated that 2 patients with a 45,X karyotype (5%) have Y specific sequences except SRY by PCR analysis. One of them had displayed enhanced virilisation whereas other had no virilisation. In conclusion, it has been found by PCR analysis that 5% of patients with a 45,X karyotype have Y chromosome sequences in the absence of any marker chromosome by cytogenetic analysis. This data also suggest that the patients with a 45,X karyotype should be analyzed for the presence of Y chromosome derivatives by sensitive methods, such as PCR, in order to calculate the future risk of developing gonadoblastoma
1.239-P
Case presentation: the pregnancy of a Down syndrome mother T. Yardımcı, B. Tu¨rko¨ver, C. Sayar, G. Toksoy, M. Uludog˘an and B. Tandog˘an Zeynep Kamil Women and Children’s Hospital Case presentation The pregnancy of a Down syndrome mother despite evidence of normal sexual development, there remain few cases of documented fertility in Down syndrome women. Our case, 22 years old Down syndrome patient, referred to our outpatient policlinics (Zeynep Kamil Hospital Genetic Diagnosis Center) for genetic counselling for her ongoing pregnancy with her parents and husband. In her obstetric history she had a miscarriage of 16 gestational weeks in her previous pregnancy. Her ongoing pregnancy was 19 weeks
and 2 days by ultrasonography. Peripheric blood karyotype analysis and fetal karyotyping following amniocentesis were programmed for her after a genetic counselling session. Her blood karyotype revealed out to be 47,XX,+21. Fetal karyotyping following amniocentesis revealed out no gross numeric and structural abnormality (46,XX). The delivery was by sectio and she had a healthy baby with no complications. This is one of the few intresting genetic counselling for a pregnant Down syndrome patient who has a healthy baby.
1.240-P
An unusual chromosomal disorder in a case of true hermaphrodite M. Z. Reena, K. O. C. H. Clarence, Z. Zubaidah, W. K. Chia, L. L. Wu, R. A. Raja Aimee, Z. A. Nor Zarina and N. A. Sharifah National University of Malaysia, Institute of Medical Research, Malaysia We report on a 12 year old boy who was phenotypically male with a problem of undescended testes. Intraoperatively, he was accidentally found to have an ovary and a fallopian tube. He was later diagnosed with true hermaphroditism. Karyotype analysis of his blood showed monosomy X, monosomy chromosome 19 and an additional marker. Fluorescence in situ hybridization (FISH) analysis of his blood using SRY gene and CEP X probes showed the presence of a single chromosome X with two SRY genes in 80% of the cell lines. The two SRY genes identified appear to be located on one of the autosomes. The remaining 20% showed monosomy X only. Further analysis of his blood with spectral karyotyping (SKY) showed translocation of chromosome Y to chromosome 19. FISH analysis with 19p and 19q telomeric probes showed the presence of both telomeric regions. However, extra chromosomal material was noted at the distal part of the q telomeric region of chromosome 19. Further investigation with FISH analysis using Xp/Yp and Xq/Yq confirmed the presence of double p telomeres and the absence of the q telomere of chromosome Y. The
6th ECC: Abstracts conclusion and possibilities of all the investigations will be discussed in the presentation.
1.241-P
Unusual prenatal case with multiple marker chromosomes G. Toksoy, B. Tu¨rko¨ver, C. Sayar, M. A. So¨ylemez, T. Yardimci, N. Tarhan, S. Cesur and M. Uludogan Zeynep Kamil Women and Children_s Hospital Here we report a prenatal case with clonally present different marker chromosomes with GTG banding in multiple cell lines cultured from amniotic cells obtained at 18 weeks of gestation. The amniocentesis was performed because of an increased risk for Down syndrome based on a first trimester screening test but without ultrasonographically detected features. Fetal karyotype was 47õ50,XX,+mar1, +mar2,+mar3[cp50]. CBG and NOR banding showed that all markers had one centromere and no satellites. One of the markers had an unstained region on both arms with CBG banding. Both parents were found to have normal karyotypes. FISH analysis by multiprobe (cytocell) revealed marker chromosomes derived from chromosome 3, 7, and 8. The pregnancy was terminated after genetic counselling. The Fetus presented a small ventricular septal defect, cliteromegaly, and pulmonary segmental defects on autopsy examination following termination at 22 weeks of gestational age. Cytogenetic analysis of skin fibroblasts confirmed these results.
1.242-P
Cytogenetic and molecular characterization of the derivative Y chromosome: a case study of an azoospermic patient T. Roovere, M. Peters, N. Horelli-Kuitunen, T. Mo¨lter-Va¨a¨r, M. Punab, S. Rootsi, O. Poolamets and A. Salumets Nova Vita Clinic, Centre for Infertility Treatment and Medical Genetics, Viimsi, Estonia, Department
127 of Obstetrics and Gynaecology, University of Tartu, Tartu, Estonia; Department of Biotechnology, Institute of Molecular and Cell Biology, University of Tartu and Estonian Biocentre, Tartu, Estonia, Nova Vita Clinic, Centre for Infertility Treatment and Medical Genetics, Viimsi, Estonia; Medix Laboratories Ltd., Espoo, Finland, Nova Vita Clinic, Centre for Infertility Treatment and Medical Genetics, Viimsi, Estonia; Department of Cell Biology, Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia, Andrology Unit of Tartu University Clinicum, Tartu, Estonia, Estonian Biocentre, Tartu, Estonia, Nova Vita Clinic, Centre for Infertility Treatment and Medical Genetics, Viimsi, Estonia; Department of Obstetrics and Gynaecology, University of Tartu, Tartu, Estonia; Department of Biotechnology, Institute of Molecular and Cell Biology, University The use of assisted reproduction, even in cases of azoospermia, with sperm cells obtained from testicular tissue is rapidly escalating. These high demands have substantiated the importance of determining the complex genetic background of severe male factor infertility since infertility-causing genetic alterations could possibly be transmitted to male offspring by infertility treatment. Our report addresses the complex genotype-phenotype interactions in an azoospermic male patient. Cytogenetic, molecular cytogenetic and molecular genetic studies indicated the derivative Y chromosome with duplication of Yp11 (including SRY gene) and deletion of Yq11 (including azoospermia factor Y AZFb-c) regions as the most probable cause of the severe testicular failure. Our study emphasizes the importance of detailed genetic evaluation of infertile male patients to provide proper genetic counseling and individualized reproductive risk assessment.
1.243-P
Two cases with de novo 21/21 translocation Down syndrome: review of literature G. Gulec Ceylan, Deniz Erol and Huseyin Yuce Firat University Medical Center
128
1.244-P
Detection of cryptic chromosomal abnormalities by comparative genomic hybridisation among infertile males whose conventional cytogenetic studies are normal and have no Y chromosomal microdeletion K. Yararbas, H. I. Ruhi, K. Aydos, A. H. Elhan and A. Tukun Bakirkoy Women’s and Children’s Education and Research Hospital, Ankara University Faculty of Medicine Department of Medical Genetics, Ankara University Infertility Diagnosis, Therapy and Research Center, Ankara University Faculty of Medicine Department of Biostatistics Infertility is one of the most common health problems all over the world, concerning about one out of five couples. Male factor contibutes to a considerable proportion. Assisted reproductive techniques have made it possible to treat this problem but at the same time the genetic problem is passed on to the next generations. By using Comparative Genomic Hybridisation Y CGH we aim to find previously unidentified genetic aetiological factors among infertile males. Thus it would be possible to explain some more idiopathic cases and give more accurate counselling to the couples. At the same time it could be possible to predict de novo infertility related locuses. Patients with positive CGH abnormalities have additional clinical and laboratory findings such as varicocele, abnormal hormon profiles, cryptorchidism, azoospermia. Looking at it the opposite way, only a small portion of patients with additional abnormalities show CGH changes. The data obtained within this study show that infertile males may carry some chromosomal imbalances that cannot be detected by conventional methods. With additional data it would be possible to identify the aetiologic significance of these findings.
1.245-P
Maternal uniparental disomy for chromosome14: prenatal case report in an inherited Robertsonian translocation
6th ECC: Abstracts
N. Le Du, A. C. Tabet, M. Gerard, S. Drunat, A. L. Delezoide and S. Serero Laboratoire CBCM, Evreux, France, Laboratoire de Cytoge´ne´tique, Hoˆpital R. Debre´, Paris, France, Service de Ge´ne´tique Clinique, Hoˆpital R. Debre´, Paris, France, Laboratoire de Ge´ne´tique Mole´culaire, Hoˆpital R. Debre´, Paris, France, Unite´ de Foetopathologie, Hoˆpital R. Debre´, Paris, France, Laboratoire CBCM, Evreux, France In prenatal diagnosis, maternal uniparental disomy of chromosome 14 (mUPD14) is still a rare event. A distinct phenotype is described and should raise clinical suspicion for the mUPD14 syndrome: preand postnatal growth retardation, muscular hypotonia, early onset of puberty, joint laxity, variable psychomotor delay, minor dysmorphic features and obesity. However, many of these features are not evident in infancy and only in utero growth retardation (IUGR) is accessible by prenatal ultrasound examination. In 2002, Kotzot et al. reviewed the first two cases of prenatal UPD (Papenhausen 1999; Berend, 2000), both associated with a de novo rob(13;14), among 451 cases of non-homologous Robertsonian translocations. The only other prenatal case was described by Ruggeri et al. in 2004 (de novo rob(14;21)). The overall estimated frequency of UPD risk in case of a non-homologous Robertsonian translocation involving chromosome 14 (and/or 15) is about 0.6% (Ruggeri 2004). Our maternal UPD14 case described below is the first prenatal report of mUPD14 associated with an inherited rob(13 ;14). Amniocentesis was performed on a 26 years old woman carrying a Robertsonian translocation involving chromosomes 13 and 14. Analysis of the fœtal karyotype revealed the same balanced rearrangement. Systematic molecular testing showed mUPD14. Ultrasound evaluation performed after diagnosis revealed an IUGR. Following genetic counselling about the phenotypic effects of mUPD14 and the wide range of development (from normal to severe retardation), the parents opted for a termination of the pregnancy. Foetal examination showed low weight for age, mild facial dysmorphism, Vth finger clinodactyly and mild hypoplasia of the frontal lobes, which can be attributed to the mUPD14. Various tissues were cytogenetically studied (skin, lung, kidney, placenta) and did not show a low level of trisomy 14 mosaicism. The translocation was
6th ECC: Abstracts homogenous. We review the literature on mUPD14 and discuss the complexity of genetic counselling in these prenatally discovered cases.
129 flexion deformity of right hand and rocker-bottom of left foot. To our knowledge, this is the first prenatal case associated with partial trisomy of 18p11.2-qter.
1.247-P 1.246-P
Prenatal diagnosis of partial trisomy 18 (18p11.2 - qter) in a fetus associated with increased nuchal translucency
Partial trisomy 18p and monosomy 18q resulting from a paternal pericentric inversion, inv(18)(p11.23q21.1).
D. Demir, I. Mendilcioglu, E. Pestereli, E. Mihci, M. Ozcan Caliskan and G. Luleci
B. Ozyilmaz, O. Sezer, F. Ekici, M. Karayel, T. Sesen and G. Ogur
Akdeniz University, Faculty of Medicine, Department of Medical Biology and Genetics, Akdeniz University, Faculty of Medicine, Department of Obstetric and Gynecology, Akdeniz University, Faculty of Medicine, Department of Pathology, Akdeniz University, Faculty of Medicine, Department of Pediatrics
Ondokuz Mayis University Medical Faculty Department of Medical Genetics, Ondokuz Mayis University Medical Faculty Department of Pediatric Genetics, Ondokuz Mayis University Medical Faculty Department of Otolaryngology
We present the prenatal diagnosis of a fetus with abnormal sonographic finding by cytogenetic and molecular cytogenetic analysis. Because of increased nuchal translucency in this fetus, chorionic villus aspiration was performed at 12 weeks_ gestation. We detected an additional large segment on chromosome 15p by GTG banding analysis in all cells obtained from cultured chorionic villus samples of the fetus. The origin of this additional large segment was suspected to be chromosome 18q. CBG banding analysis revealed that this derivative chromosome has one centromere. Parental chromosomal analysis was done to trace the origin of this derivative chromosome and parental chromosomes were found to be normal by GTG tecnique. Subsequently, amniocentesis was performed at 16 weeks_ gestation to confirm this finding. We detected the partial trisomy of 18p11.2-qter resulting from a de novo unbalanced translocation between chromosome 15 and 18 in all analyzed cells. Fetal karyotype was identified as 46,XY,der(15)t(15;18)(q13.1;p11.2). In addition, this chromosomal aberration was confirmed by FISH analysis using chromosome 18 specific whole painting probe. After genetic counseling, the family decided to terminate the pregnancy. Pathological examination showed that this fetus had micrognathia, low set ears, down-slanting palpebral fissures,
In this report we present a 7-month-old dysmorphic boy with a recombinant chromosome 18, rec(18), resulting from a paternal pericentric inversion, inv(18)(p11.23q21.1). The recombinant chromosome had a partial deletion of chromosome 18q and a partial duplication of chromosome 18p [46,XY, rec(18)dup(18p)inv(18)(p11.23q21.1)pat]. The affected child presented mostly with the clinical findings of 18q Deletion Syndrome: facial dysmorphism, bilateral external auditory canal atresia, congenital heart defect and overriding toes. Clinical findings of dup(18p) were less remarkable. Clinical and cytogenetic data was compared to cases in the literature. There was variation in the break points and the relevant phenotypes of recombinant offspring in the reported cases. However,the break point 18p11.2 and the dup18p/ del18q recombination in the offspring, as found in our case, were more common than others. The pathological mechanisms, the risk of having recombinant offspring, and genetic counselling issues for carriers of inversion 18 are discussed in the report.
1.248-P
Two cases of distal trisomy 10q resulting from maternal balanced translocation
6th ECC: Abstracts
130
H. Akbas, D. Oral, R. Yildirim, M. Fidanboy and T. Budak, Dicle University, Faculty of Medicine, Diyarbakir, Department of pediatrics, Dicle University, Faculty of Medicine Diyarbakir, We describe an eight year old male and his first degree double cousin with a distal 10q trisomy resulting from a maternal balanced reciprocal translocation involving chromosome 9 and 10. Their karyotype using GTG-banding was 46,XY,der(9)(9qterY9p24::10q25Y10qter)mat. The translocation was also confirmed by FISH studies. We found a balanced translocation involving chromosomes 9 and 10 [46,XX,t(9;10)(p24;q25)] with cytogenetic and FISH studies in the mothers of these children who had a normal phenotype. The clinical features of our cases are as follows: mental retardation, small nose with depressed nasal bridge, hypertelorism, blepharophimosis, micrognathia, dental anomaly and higharched palate.
1.249-P
Cytogenetic and clinical study of a male infant with ambiguous genitalia ¨ nen, D. Oral, M. Balkan, H. Duran, A. O M. N. Alp and T. Budak
2.1-O
Progression dynamics of evolutionary-new centromeres Francesca Antonacci, Pietro D’Addabbo, Nicoletta Archidiacono, Angelo Cellamare, Maria Francesca Cardone, James L. Sprague, Evan E. Eichler, Mariano Rocchi and Mario Ventura Univerity of Bari, University of Washington School of Medicine Extensive FISH experiments with BAC probes, as an independent and complementary approach to the official sequence assembly of the macaque genome, were utilized to compare macaque (MMU)/human synteny organization. Surprisingly, we found that 9 macaque and 5 human Evolutionary New Centromeres (ENC) originated after Old World monkey/Hominoidea divergence. Clearly, ENCs have a significant impact on shaping genomes. Construction of a BAC contig of the pericentromeric region of the ENC of macaque chromosome 4 (human 6) allowed us to disclose the dynamics of ENC formation and progression by comparison to human region at 6q24.3, which conserves the ancestral genomic organization. The analysis revealed that a segment of 250 kb in the seeding region was extensively duplicated around the macaque ENC. These duplications were strictly intrachromosomal. Our results support hypotheses that novel centromeres triggers only local duplication activity, and that the absence of genes in the seeding region played an important role in ENC tolerance and progression.
Dicle Uni. Medical Faculty A one-year-old male infant was clinically diagnosed as an intersex case with ambiguous genitalia and hypospadias. Clinical, hormonal and genetic findings are presented. In the examination of patient, bilateral testicular volume and phallus was found undersized. Serum concentration of testosterone was found low level. G-banding of his chromosomes show that patient has balanced translocation involving chromosome 3 and 4 [46,XY,t(3;4)(p25;q31.3)]. This finding was confirmed by fluorescent in situ hybridization (FISH). The proband inherited this translocation from his father. His sister has this translocation as well. But clinically father and sister of proband were normal.
2.1-P
New polymorphism in heterochromatin regions of Equus asinus chromsomes detected by horse DNA satellite probes N. Alaoui, J. Jordana, E. Magnani, G. Nergadze, E. Giulotto and M. Ponsa` Dept Biologia CelIlular, Fisiologia i Immunologia. Facultat de Cie`ncies, Universtat Auto´noma de Barcelona, Dept Cie`ncia Animal i dels Aliments.
6th ECC: Abstracts Facultat de Veterina`ria. Universitat Auto`noma de Barcelona, Dipartimento di Genetica e Microbiologia. Universita´ di Pavia, Non centromeric heterochromatin bands have been described in Equus asinus species (EAS, 2n=62 F. Equidae) in the juxtacentromeric and telomeric positions in different chromosomes of the karyotype. Chromosome EAS1 presents heterochromatic bands in a juxtacentromeric position in the q-arm and in a terminal position in the p-arm. Satellite DNA polymorphism in the constitutive heterochromatin of Equus asinus chromosome 1 (EAS1) is presented. In our cytogenetic study, the chromosomes of five animals with normal karyotype were analysed by sequential G and C banding. Fluorescence in situ hybridization was then performed on the chromosomes of these animals using two probes isolated from a horse genomic library and containing sequences from the two major horse satellite families (C37 and 2P1) Metaphases spreads were prepared from fibroblast cultures and peripheral blood cultures of five different non related and phenotypically normal Equus asinus individuals. The metaphases were then in situ hybridised with two horse satellite DNA probes: the C37 and 2P1 clones were isolated from a horse genomic library in the phage vector lambda-GEM11. C37 contains a tandem repeat of 221 bp and 2P1 clone contains a satellite sequence composed of tandem reiterations of a 23 bp unit. FISH results obtained have shown different hybridization patterns in different donkey specimens; four different polymorphic forms of EAS1 have been identified. These patterns can be interpreted as the result of different rearrangements that occurred in the heterochromatic regions of chromosome EAS1.
2.2-P
Chromosomal mapping of rRNA and histone gene clusters in mussels and clams J. Pasantes Luden˜a, C. Pe´rez-Garcı´a, N. S. Hurtado and P. Mora´n University of Vigo The class Bivalvia includes some of the best-known marine invertebrate species, many of which are
131 commercially harvested around the world. Most chromosome studies on species of the families Mytilidae and Veneridae have been performed using classical cytogenetic techniques and there are only a few works using fluorescent in situ hybridisation (FISH). In order to physically map the rRNA and histone gene clusters to mitotic and meiotic chromosomes of species of Mytilidae (Mytilus, Brachidontes, Perumytilus,) and Veneridae (Dosinia, Venerupis, Ruditapes, Venus), chromosome preparations were obtained from gill and gonadic tissues of juvenile individuals after hypotonic treatment and fixation with methanol/acetic acid. Surface spread synaptonemal complexes from mature males were also obtained. Species specific probes for histone genes, 18+28S rDNA internal transcribed spacers (ITS) and 5S rDNA were generated by PCR. While a variable number of both histone gene clusters and major and minor ribosomal gene clusters were detected in the species belonging to the Mytilidae, a single gene cluster for each gene family was noted in all Veneridae species. On the contrary, the distribution patterns of the family clusters on the chromosomes of both Mytilidae and Veneridae showed large differences among species.
2.3-P
Effects of chromium picolinate on micronucleus frequency and morphology of lymphocytes in calves Nalan Imamoglu, Fatma Uyanik, Berrin Kocaoglu Guclu, Onur Erdem, Bilal Cem Liman and Hamiyet Donmez Altuntas Halil Bayraktar Health Service Vocational College, University of Erciyes, Kayseri, Turkey, Department of Biochemistry, Faculty of Veterinary Medicine, University of Erciyes, Kayseri, Turkey, Department of Animal Nutrition and Nutritional Diseases, Faculty of Veterinary Medicine, University of Erciyes, Kayseri, Turkey, Deparment of Pharmacology and Toxicology, Gu¨lhane Military Medical Academy, Ankara, Turkey, Deparment of Pharmacology and Toxicology, Faculty of Veterinary Medicine, University of Erciyes, Kayseri, Turkey, Department of Medical Biology, Faculty of Medicine, University of Erciyes, Kayseri, Turkey
6th ECC: Abstracts
132 Chromium picolinate (CrPic) has a widespread use as a nutritional supplement. In recent years, in vitro and in vivo studies have suggested that CrPic in the presence of biological reducing agents can generate reactive oxygen species and induced cytotoxicity and genotoxicity. The purpose of this study was to investigate the possible effects of CrPic on micronucleus frequency and morphology of lymphocytes and lipid peroxidation in calves. Twenty-four Holstein calves, 6Y8 wk of age were assigned into three groups (8 calves in each group). Calves in all groups were offered a commercial calf diet and alfalfa hay was provided ad libitum. Commercially available chromium picolinate was used. Control group had no supplemental chromium and the other two groups received orally either 200 mg Cr/day/calf or 400 mg Cr/day/calf for 12 weeks. Blood samples were collected at the end of the study. Morphological changes in lymphocytes were determined by counting the apoptotic cells in 1000 cells showing normal morphology and the ratio of apoptotic cell/normal cell was calculated. Micronucleus (MN) frequency was determined by counting micronuclei in 1000 binucleated cells. Lipid peroxidation was determined as thiobarbituric acid reactive substances (TBARS). Serum Cr levels were measured by a graphite furnace atomic absorption spectrophotometer. In both Cr groups, the cells had a roughened surface and irregularly shaped and segmented nuclei. Supplementation of 200 mg and 400 mg Cr as CrPic significantly increased the percentage of apoptotic cells (pG0.001) and serum malondialdehyde (MDA) levels (pG0.01), slightly increased Cr levels while 400 mg Cr increased MN frequency (pG0.01). The results of this study have suggested that the both levels of chromium picolinate may lead to cytotoxicity and 400 mg Cr may also be genotoxic. However, further studies investigating the mechanism of the action of chromium picolinate are of importance.
V. Caputo, M. Giovannotti, P. Nisi Cerioni, A. Splendiani and E. Olmo Universita` Politecnica delle Marche A karyologycal analysis was carried out on a hatchery stock and some wild autochthonous populations of brown trout (Salmo trutta L., 1758) from central Italy. This study was performed using conventional staining, banding techniques and FISH with telomeric and ribosomal probes. The karyotypes of all individuals analyzed appeared to be well established, and no variation was found in chromosome number (2n=80). The fundamental number (FN) varied from 100 to 101 owing to the polymorphism of the short arm of the NOR-bearing pair (chromosome pair 11) which varied from subtelo- to submetacentric in different individuals. All the sampled populations showed active AgNORs on the short arm of the pair 11, with the only exception represented by a wild individual with a NOR located on a chromosome of the pair 11 and the other on a chromosome of the pair 14. FISH with 18/ 28S ribosomal probes evidenced, besides a conspicuous signal on the whole short arm of the Ag-NOR bearing pair (11th), a variable number of inactive rDNA sites. Hybridization with a 5S probe produced fluorescent signals on the short arms of a subtelocentric pair, while the telomeric probe labelled the tips of all chromosomes. DAPI stained the centromeres of metacentric chromosomes in all the individuals analysed. CMA3 staining gave fluorescence on the Ag-NOR pair and the short arms of six subtelocentric pairs in the farm individuals, whereas in the wild specimens belonging to the Mediterranean mitochondrial lineages the tip of all acro- and subtelocentrics were fluorescent. Moreover, the C-positive material reacted differently to the digestion with endonuclease AluI in hatchery and wild populations. These results seem to be useful for distinguishing allochthonous from native individuals and therefore for the management of this species.
2.4-P
Karyological comparison of hatchery stock and wild populations of brown trout (Salmo trutta L., 1758) from central Italy using FISH and conventional bandings
2.5-P
Radioprotective effects of Hawthorn fruit extract against genotoxicity induced by gamma irradiation in mouse bone marrow cells
6th ECC: Abstracts
S. Hosseinimehr, M. Azadbakht, M. Mousavi, A. Mahmoudzadeh and S. Akhlaphpoor Mazandaran University of Medical Sciences, Sari, Iran, Novin Medical Radiation Institute, Tehran, Iran Ionizing radiation passing through living tissues generates free radicals. Interactions of free radicals with DNA can induce DNA damage lead to mutagenesis and carcinogenesis. The protection against genotoxicity induced by irradiation is important. Natural products are important compounds due to low side effect. The radioprotective effect of hawthorn (Crataegus microphylla) fruit has been investigated in mouse bone marrow cells against genotoxicity induced by gamma irradiation by using micronucleus assay. A single intraperitoneal (ip) administration of hawthorn extract at doses of 25, 50, 100 and 200 mg/kg 1h prior to gamma irradiation (2Gy) reduced the frequencies of micronucleated polychromatic erythrocytes (MnPCEs). All four doses of hawthorn extract significantly reduced the frequencies of MnPCEs and increased PCE/ PCE+NCE ratio (polychromatic erythrocyte/ polychromatic erythrocyte+normochromatic erythrocyte) in mice bone marrow compared with non drugtreated irradiated control (pG0.02j0.00001). The maximum reduction in MnPCEs was observed in mice treated with extract at dose of 200 mg/kg. Administration of amifostine at dose 100 mg/kg reduced the frequency of MnPCE almost 4.8 fold. The total MnPCEs values were 5.7 fold less in 200 mg/kg hawthorn extract group, after being exposed to 2 Gy of gamma rays comparing to those in the respective irradiated control. Crataegus extract exhibited concentration-dependent antioxidant activity on 1,1-diphenyl 2-picryl hydrazyl free radical. It is appeared that hawthorn, particularly flavonoids constituents with antioxidative activity, reduced the genotoxicity induced by gamma irradiation in bone marrow cells.
2.6-P
Cytogenetic aberrations in the freshwater mussel Anodonta cygnea: evidence of environmental genotoxicity?
133
Carrilho, A. Leita˜o and I. Malheiro ICBAS Y Instituto de Cieˆncias Biome´dicas Abel Salazar, Univ. do Porto; CECA Y Centro de Estudos de Cieˆncia Animal, Univ. do Porto, CRIP-Sul - Centro Regional de Investigac¸a˜o Pesqueira Sul, IPIMARINIAP; Centro de Gene´tica e Biotecnologia, UTAD Y Univ. de Tra´s-os-Montes e Alto Douro, Lab. de Citogene´tica, ICBAS Y Instituto de Cieˆncias Biome´dicas Abel Salazar, Univ. do Porto; CECA Y Centro de Estudos de Cieˆncia Animal, Univ. do Porto Drinking waters are contaminated with a large number of organic compounds, some of which have been related to toxic and/or potentially carcinogenic effects. Several studies have already described chromosomal mutations such as aneuploidy and polyploidy as a result of accumulation of exogenous substances. Our studies in Anodonta cygnea acclimatized in drinking tap water and in natural water from the lake where the individuals were collected showed different indexes of aneuploidy between individuals in either rearing conditions, with higher values being found in tap water. These results confirm that chromosome analysis techniques are a simple shortterm test to study the impact of contaminants referred above and that Anodonta cygnea is a suitable organism for environmental monitoring.
2.7-P
Production of Bovine Y chromosome specific FISH probe for validation of cattle sperm separation procedures Shams, F. Mahjoubi, A. Salehi, M. Montazeri Clinical Genetic Dept., National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran, Dept. Of Animal Science, Tehran University, Iran Sex preselection that is based on the many available methods such as flow-cytometric measurement of sperm DNA content and fluorescent in situe hybridization (FISH) together with artificial insemination using sex-specific semen, makes it possible to predetermine the sex of calves. This has the potential to considerably improve cattle breeding, and the
6th ECC: Abstracts
134 efficiency of dairy and meat production. We aimed to develop a simple method based on FISH technique to enable us to differentiate between X and Y bearing sperm. In order to do that, we attempted to make a home made FISH probe specific for pericentromeric repetitive DNA block on the bovine Y chromosome (locus DYZI, Yp13-q12). Genomic DNA was extracted from lymphocyte cells of male cattle. The specific DYZ1 primer was used for the amplification of Y pericentromeric region. The PCR products were then labeled with biotin-16dUTP in a secondary PCR reaction. The labeled PCR product was then purified and dissolved in a hybridization buffer and used as a FISH probe. The Y specific FISH probe hybridized on the male metaphase and interphase cells fixed with methanol: acetic acid on slide show strong signals. We believe this FISH probe has the capacity to be used for sex sperm determination.
2.8-P
40 years of Romanian Bovine cytogenetic studies Nicolae Research and Development Institute for Bovine Bovine cytogenetics in Romania started with 1965. It have already passed 40 years since the first chromosomal studies in cattle were carried out. The early period was devoted to the description of the normal and abnormal caryotype and to the improvement of the cytogenetic methodology by using the chromosome banding techniques. Almost all the chromosomal analysis involving bovine chromosomes as a diagnostic tool in conjunction with reproductive technologies were performed at the Research and Development Institute for Bovine Balotesti. Clinical cytogenetics studies were focused on the bulls of the A. I. In this way, over 2900 bulls from different centers of A. I. have been investigated. The most important investigated bulls belongs to the Romanian Spotted breed, Romanian Black Spotted breed and Brown breed such as several kind of abnormalities were identified. The study of an important number of A. I. bulls have had, both scientific and economic advantages. In the river buffaloes, although several studies have been undertaken, clinical cytogenetics is
relatively recent. Taking into account the role of clinical cytogenentics in the genetic improvements of livestock at national level the official karyotype control of cattle and buffalo breeds have been developed. Much more, in the new context of European Union integration, according with the rules concerning the genetic health of domestic animals, this desideratum became a must.
2.9-P
Genotoxic effect of enrofloxacin on chicken chromosome: a comparative study Dutta St. Aloysius College Enrofloxacin (EFX) is a fluorinated 4- quinolone antibiotic, which is effective against a wide spectrum of gram positive and negative organisms including anaerobic populations. It inhibits the bacterial gyrase and in high concentrations also the functionally related eukaryotic topoisomerase-II, which results in genotoxicity of the test system: chromosomal anomalies in chicken. In treatment with doses 5 (times), 10 , 15 the curative dose of EFX (Curative dose 1ml/ kg of body weight, 1ml contains 1 mg of EFX) for bacterial treatment, it was found that occurrence of the different aberrations are more in WL chicken chromosomes than Dwarf (Dw) chicken (evolved at BAll India Co-ordinated Research on Poultry, JNKVV, Jabalpur). As the chickens are exposed to an excess of drug EFX, because they may take in higher dose through water particularly during summer months, this investigation of the higher doses of the drug will be much use for the dosing during severe infection in poultry industry.
3.1-O
Altered allelic replication timing in microdeleted genome I. Amir, J. Yeshaya, A. Rimon, J. Freedman and M. Shohat Department of Human Genetics, Sackler Faculty of Medicine, Tel Aviv University, Institute of Medical
6th ECC: Abstracts Genetics, Rabin Medical Center, Beilinson Campus, Schneinder Children_s Medical Center Intense research on replication timing reveals a close correlation between replication timing of a DNA segment and its transcriptional activity, nuclear location, and epigenetic features. Many studies indicate alterations in the temporal order of allelic replication of disease-non-specific genes in genomes of individuals displaying genetic instability such as malignancies, trisomies and even X-monosomy (Turner syndrome). The aim of the current study was to assess if a constitutional microdeletion can be detected by changes in allelic replication-timing of genes not related to the deletion considered. Here, we applied the fluorescence in-situ hybridization (FISH) replication assay, using probes for the RB1, SNRPN and ARSA loci, on peripheral blood lymphocytes of control subjects and patients carrying a microdeletion syndrome (Williams syndrome and DiGeorge/Velocardiofacial syndrome). This method enables to follow the replication timing of genes by recording the morphology of the fluorescent signals. Our results show that allelic replication timing of each of the examined genes, in the blood lymphocytes of the patients, was significantly different from that found in the cells of the control subjects. We propose the FISH replication assay as a rapid, simple and relatively inexpensive screening test for the presence of non- specific microdeletions that will help in defining a population of nonsyndromatic individuals with dysmorphism and/or developmental delay and/or mental retardation on the basis of genomic instability. For this population a more accurate analysis will be recommended using advanced molecular methods such as CGH microarrays, which could detect the exact size and location of the deletion/ duplication. Moreover, we suggest that this method, following further studies on amniotic fluid samples, could complement the classical karyotype analysis in prenatal diagnosis.
3.2-O
Up-regulation of the centrosomal protein MARK4 and development of errors in centrosome activity, chromosome segregation and cytokinesis in glioma cell lines
135
Ivana Magnani, Melissa Bellini, Chiara Novielli, Gaia Roversi and Lidia Larizza University of Milan
We landed on MARK4 gene through FISH characterization of chromosome 19q13 rearrangements leading to MARK4 duplication in three glioblastoma cell lines of our series and by aCGH mapped the gene to a Bgain^ region, centromeric to the LOH area in glioma. Bridging the finding that isoform L of MARK4, expressed in human neural progenitors (NHNPs), is upregulated in glioma, to the reported GFP-MARK4 in amplified centrosomes, we addressed the role of MARK4 kinase in the abnormal mitotic processes of human glioma, the most common primary central system neoplasm displaying sustained chromosomal instability. By g-tubulin and pericentrin antibodies we showed in the glioblastoma cell lines characterized by a-CGH a linear correlation between cells with supernumerary centrosomes and the extent of aneuploidy. Interestingly, interphase centrosomes showed a random and/or a cluster distribution, matching the finding in the same cell lines of multiple mitotic and/or bipolar-like spindles, a condition that favours mitotic stability and neoplastic growth, according to a proposed model . By using MARK4 polyclonal antibodies we could detect by immunofluorescence MARK4 in interphase centrosomes, as expected, and also in mitotic centrosomes, in the midbody and nucleoli. Co-labeling with MARK4, g-tubulin and nucleolin antibodies matched the above detections in glioma cell lines. Centrosomal, midbody and nucleolar fractions from the same cell lines confirmed by Western blotting with MARK antibody the observed sub-localizations suggesting a spatial regulation of MARK4 functions and interactions during the cell cycle and/or cytokinesis. To corroborate this hypothesis investigations of MARK4 interactor proteins are in progress, aiming at disclosing possible differences in MARK-signaling cascade in glioma cell lines vs normal progenitors and differentiated counterpart. These and other findings to be achieved by MARK4 knockdown and overexpression in normal glia and glioma cell lines should allow to define whether and how MARK4 contributes to chromosomal instability in glioma.
6th ECC: Abstracts
136
3.1-P
Research Centre for Radiation Medicine
Effect of borax to human chromosome abnormalities
Selective cytogenetic monitoring had been conducted among exposed human groups of high priority in different terms following Chernobyl accident. With help of traditional approaches for estimation of radiation-induced targeted cytogenetic effects it had been established that elevated frequency of specific radiogenic biomarkers had been remained up to now; mean group values were dependendent on character and intensity of initial irradiation and individual values were conditioned by individual susceptibility to identical radiation exposure. In delayed terms following the accident new approaches for evaluating cytogenetic consequences of Chernobyl accident - study of untargeted effects (hidden, delayed, transmissible chromosome instability and bystander effect) had been introduced. To investigate radiation-induced chromosome instability two methods had been used Y provocative mutagenesis assay (dimatyph and bleomycin exposure in vitro to lymphocytes from irradiated persons) and cultivation of lymphocytes from children born to irradiated persons. The obtained data confirmed both adaptive response and increased chromosome sensitivity to the mutagenic exposure in vitro; the transmissible chromosome instability phenomenon in progeny of irradiated parents; the interaction between irradiated in vitro and intact cells (bystander effect) that had been revealed in our proposed model system Y Bmixed human lymphocytes culture^ consisting of cells differing in cytogenetic sex markers. In all exposed groups the differences in the spectrum of chromosome aberrations had been established with chromosome type of aberrations dominating under targeted cytogenetic effects, while chromatid types of aberrations (chromatid breaks and terminal deletions Y cytogenetic indicators of chromosome instability) were mainly induced under untargeted cytogenetic effects.
M. Pongsavee Faculty of Allied Health Sciences, Thammasat University The effect of borax to human chromosome abnormalities was analysed in this study. Borax is a form of boron compound. The chemical name of borax is sodium borate. Borax is toxic for the somatic cells and may cause abnormal human genetic materials. Venous blood from 30 male students in Thammasat University (age 18Y25 years) were collected to do lymphocyte cell culture. This experiment was divided into two groups, the first group was the control group and the second group was the experimental group. The lymphocyte cells in the control group were cultured without borax. The experimental group was divided into four sub-groups. The lymphocyte cells in each experimental sub-groups were cultured with different borax concentration (0.1 mg/ml, 0.15 mg/ml, 0.2 mg/ml and 0.3 mg/ml respectively). Human chromosomes were studied for abnormalities through Giemsa-staining and G-banding. The results show that the number of metaphase chromosomes are reduced when lymphocyte cells are cultured with 0.15 mg/ml (57.22 %), 0.2 mg/ml (50.84%) and 0.3 mg/ml (42.27%) borax concentration. The results show statistically significant difference between control and experimental subgroups (PG0.05). The sister chromatid separation is found in the 0.3 mg/ml borax concentration experimental subgroup. It shows that borax (0.15, 0.2 and 0.3 mg/ml) effect induces cell and human chromosome abnormalities (both numerical and structural abnormalities). Borax may cause human chromosome abnormalities and lead to genetic defect.
3.3-P 3.2-P
Targeted and untargeted cytogenetic effects of radiation in different terms following chernobyl accident M. Pilinskaya, S. Dibskiy, O. Shemetun, Ye. Dibskaya, O. Talan and L. Pedan
Detection of a novel chromosomal translocation and chromosomal instability in patients with recurrent abortions M. Alkhalaf Kuwait University, Faculty of Medicine
6th ECC: Abstracts Objective: We have identified a novel chromosomal translocation associated with recurrent abortion. The aim of this study was to present this translocation and to measure DNA chromosomal instability in cells from these patients. Study design: Chromosomal karyotyping analysis was performed on cultures of peripheral blood lymphocytes by using GTG-banding method. The chromosomal instability of patients and matched controls was tested by measuring the hypersensitivity to the clastogenic effect of the DNA cross-linking agent 1-3-Butadiene diepoxide. Results: The data report a novel chromosomal translocation t(2;10)(p21;p15) in two young women who presented a reproductive history of early recurrent spontaneous abortions (7Y10 weeks). In addition to the abnormal karyotypes in these two patients, cultured patient lymphocytes showed increased chromosomal fragility/instability as compared with normal controls. This chromosomal instability was further enhanced by the DNA clastogenic agent, diepoxybutane (DEB). Conclusion: Although the relationship between this chromosomal translocation and the DNA fragility in these patients is not well understood, our report shows for the first time a link between the presence of this novel chromosomal translocation and a complete early embryonic lethality. Additional studies should be undertaken to identify the affected gene (s) by this translocation and may shed some light about the relationship between this chromosomal translocation and chromosomal instability.
137 lymphocytes after in vitro test irradiation. The cytogenetic study of IR of 105 healthy donors was based on the developed and tested scheme of the experiments, which accounted such radiation cytogenetics positions as dose, stages of cell cycle, postradiation conditions that affect qualitative and quantitative variations in cell radiosensitivity. Providing developed requirements expressed individual variations of cytogenetic parameters were obtained. The number of chromosomal aberrations induced by 1,5 Gy irradiation in G2-stage showed the highest variability (CV=35%) as compared with other cell cycle stages. Irradiation of the same cultures in radiosensitive G1-stage gave considerably less expressed CV - 14 %. Chromatid fragments made up to 95%, chromatid exchanges Y 5% of the total number of radiation-induced aberrations at G2-stage cells. Application of 90th percentile as a cut-off point of normal sensitivity has shown that 12,5% from the examined group had increased chromosomal radiosensitivity. The mean aberration yield for normal sensitivity group was 0,35 0,06 and 0,74 0,07 per cell for sensitive donors. To estimate assays reproducibility the repeated samples on 7 donors were carried out. CV for intra-individual differences was 8% that was considerably less as compared with interindividual variance. The developed and approved scheme of the cytogenetic examinations of healthy donors allowed indicating 12,5% persons from the investigated group with the increased chromosomal sensitivity to radiation and make it possible to determine objectively individuals with increased radiation and cancerogenic risk in post Chernobyl period in Ukraine.
3.4-P
Chromosomal method of human individual radiosensitivity estimation N. Ryabchenko and E. Dyomina
3.5-P
Institute of Experimental Pathology, Oncology and Radiobiology of NAS of Ukraine
Incidence of chromosomal damage in transoceanic air crew assessed by fish analysis. Preliminary results
Chromosomal markers reflecting primary damaging radiation effects can be used to predict human individual radiosensitivity (IR) and to form the contingents with increased radiation and cancer risk. The purpose of the presented study was to investigate IR of healthy donors on the basis of radiationinduced chromosomal damage in peripheral blood
M. J. Prieto, M. Moreno, P. Nava, J. M. Perez Sastre, F. Merelo, R. Dominguez Monpell and R. Herranz Hospital General Universitario Gregorio Maran˜on, Servicio me´dico Iberia
6th ECC: Abstracts
138 The last ICRP 90 recommendations included air crew members as occupational exposed people, there are some controversial publications that suggest the need of risk assessment and cytogenetic analysis of flight personnel, to check the risk of developing cancer. Taking into consideration occupational risk and possible confounding factors, we used fluorescent in situ hybridisation (single colour painting probes for chromosomes 1 and 2 are used combined with a pancentromeric probe) to see the incidence of chromosomal damage in transoceanic air crew. Analysis was carried out according to the proposed modificated PAINT system, extrapolating the yield of translocations scored in the chromosomes analysed to the whole genome. This work is part of a research Project where 2 populations are analysed for traslocations frequency, these are composed of air crew members and its controls matched for age, smoking habits, sex..... In the preliminary results showed here, with 24000 cells scored from 12 air crew members, there is not a significant difference in translocation frequency with other population studies published, and that the increasing frequency is probably due to age.
3.6-P
Constitutional ring 1 chromosome: a case study of the genetic and pathological implications E. Maltby and K. Suvarna Sheffield Children_s Hospital, Northern General Hospital, Sheffield Constitutional ring 1 chromosome: a case study of the genetic and pathological implications. Ring chromosomes can have clinical effect in humans in four ways: 1) by deletion of genes in short or long arms of the chromosome during formation of the ring 2) by instability of the ring during cell division leading to complete loss of the chromosome in some cells during development of the embryo and individual 3) by unmasking imprinted genes by the loss of one of a chromosome pair carrying imprinted regions, due to the ring_s instability. 4) by loss of tumour suppressor genes carried by the unstable ring chromosome, predisposing to specific malignancies. We present a
patient diagnosed with a ring chromosome 1 as a child in 1963; clinical features at diagnosis were short stature, microcephaly and moderate intellectual impairment. She died in 2004 with cirrhotic liver disease following a history of gastric marginal zone B cell non-Hodgkins lymphoma. The patient had a complex pathological history, with heart disease, asymplastic leiomyoma, absent parathyroids, oesophageal varices, osteoporosis and diabetes mellitus. We propose here that the constant loss of the ring in dividing cells affected the viability of organs and tissues and contributed to the pathological problems of the patient. We have also noted that a characteristic acquired chromosomal feature of leiomyoma is a ring 1 chromosome and that 1p and 1q deletions are characteristic acquired abnormalities in non-Hodgkins lymphoma. This indicates that the ring 1 may have predisposed to these neoplasms, in the way that has been demonstrated for some other somatic rings that carry specific tumour suppressor regions. Monosomy for chromosome 1 has been supported by FISH investigations in tumour, heart and lung tissue sections.
3.7-P
Spontaneous chromosome instability in the NBS1-deficient lymphocytes H. Akopyan, N. Markevych and H. Bezkorovajna Institute of Hereditary Pathology of the Academy of Medical Sciences of Ukraine NBS1 protein is involved in the initial processing of DNA double strand breaks and its deficiency is related to increased chromosome instability and clinical features of Nijmegen breakage syndrome (NBS). NBS is prevalent in Slavic populations and characterized by combined immune deficiency and high predisposition to B-lymphoma. Among chromosome abnormalities fragility and multiple rearrangements of chromosomes 7 and 14 are common, but little is known about factors contributing to malignant transformation of the NBS1-deficient lymphocytes. In this work the spontaneous chromosome abnormalities in NBS1-deficient lymphocytes were evaluated with special reference to possible
6th ECC: Abstracts association with cancer. The specific rearrangements involving chromosomes 7 and 14 were observed in 4Y12% of NBS1-deficient cells with particularly high incidence of inv(7)(p13:q35), t(7;14)(q35;q11), t(7;14)(p13;q11), t(7;7)(p13;q35), t(7p13;14q32), del(7)(q35), del(14)(q11). The chromosomes 1, 3, 8 and 9 were also often targeted and most hot spots could not be considered as typical fragile sites. Each 3-d break targeted centromeric or near-centromeric regions; half of them were located in constitutive heterochromatin of chromosomes 9 and 1. A significant rate of polyploidy and premature centromere division (PCD) was also observed in NBS-deficient cells compared with control. The PCD involved either 23Y46 or 3Y20 chromosomes per cell (total and partial PCD respectively) and significantly targeted the members of A and B chromosomal groups compared with control. The rate of total PCD, partial PCD and polyploidy was significantly elevated in the lymphocytes and bone marrow cells of patients with NBS complicated by non-Hodgkin_s lymphoma compared with non-complicated NBS cases. We suggest that association between increased centromeric fragility and PCD appearance in NBS1-deficient lymphocytes is non-random and keeps a great oncogenic potential that could be released under insufficiency of tetraploidy checkpoint.
3.8-P
Evidences for increased level of mosaic aneuploidy involving chromosome 1 in the schizophrenia brain I. Demidova, I. Iourov, S. Vorsanova, A. Kolotii, V. Kravetz, V. Monakchov, I. Soloviev, T. Liehr and Y. Yurov Institute of Pediatrics and Children Surgery, Roszdrav, National Research Center of Mental Health, Russian Academy of Medical Sciences, I, I, Institute of Human Genetics and Anthropology, Jena The search for susceptibility factors for schizophrenia has been enhanced by identification of chromosomal abnormalities, associated with this common brain disorder. Constitutional aneuploidy (loss/gain of whole chromosomes) directly observed in the normal and diseased brain provides a base for extended
139 analysis of a role genomic (chromosomal) instability could play in neuronal variability, complexity and malfunction. Using interphase multiprobe fluorescence in situ hybridization (mFISH) with quantitative FISH (QFISH) and multicolor banding (MCB), we assessed the rate of aneuploidy involving chromosome 1 in the postmortem brain samples (the cortex, Brodmann area 10) of 12 unaffected controls and 12 patients with schizophrenia. We have found that the schizophrenia brain characterized by significantly increased rate of spontaneous mosaic aneuploidy. Mosaic neuronal cell lineages involving chromosome 1 were revealed in two schizophrenia brains with the frequencies of aneuploidy higher than the cut off levels not only in the Brodmann area 10 of the cortex, but also in Brodmann areas 17 and 24, caudatum nucleus and hippocampus. These data is in agreement with the hypothesis that subtle genomic imbalances mediated by genomic (chromosomal) instability may be involved in the pathogenesis of schizophrenia. Supported by INTAS.
3.9-P
Developmental chromosome instability leads to low-grade mosaicism of the normal embryonic and fetal human brain Y. Yurov, I. Iourov, S. Vorsanova, T. Liehr, A. Kolotii, A. Beresheva, I. Demidova, F. Pellestor, S. Kutsev and I. Soloviev National Research Center of Mental Health, Russian Academy of Medical Sciences, Institute of Pediatrics and Children Surgery, Roszdrav, Moscow, Institute of Human Genetics and Anthropology, Jena, Germany, I, I, Institute of Human Genetics, Montpellier, France, Rostov State Medical University, Roszdrav, Rostov-on-Don, Russia Structural variations in the neuronal genome are likely to be one important mechanism for human intellectual diversity and brain disease susceptibility. Large-scale genomic variations due to loss or gain of whole chromosomes (aneuploidy) have been described in cells of the normal and diseased human brain, which are generated from neural stem cells during intrauterine period of life. However, the incidence of
6th ECC: Abstracts
140 aneuploidy in the developing human brain and its impact on the brain development and function are unknown. We surveyed aneuploidy/polyploidy in the human fetal tissues by molecular-cytogenetic techniques at single-cell level. We show here that the human developing brain has mosaic nature being composed of euploid and aneuploid neural cells. Studying over 600,000 neural cells, we have determined the average aneuploidy frequency as 1.25Y1.45% per chromosome with the overall percentage of aneuploidy tending to approach 30Y35%. Furthermore, we found that mosaic chromosome specific aneuploidy can be exclusively confined to the brain. Our data indicates aneuploidization to be an additional pathological mechanism for neuronal genome diversification. These findings highlight the involvement of aneuploidy in the human brain development and suggest an unexpected link between developmental chromosomal instability, intercellural/intertissular genome diversity, human brain diseases, and brain tumorigenesis. Supported by INTAS and AT Children project.
3.10-P
Influence of some detoxification enzyme polymorphisms on cytogenetic biomarkers and its possible repercussion on genotoxic and cancerogenic process N. Bukvic, M. Fanelli, D. Bukvic, F. Susca, A. Ballini, P. Lovreglio, R. Bagnulo, A. Quaraglela, Leonardo Soleo and Guanti Ginevra Universita` degli Studi di Bari Genetic variability in metabolic activities related to some enzymatic pathways may partially explain individual susceptibility to cancer. In several cases the polymorphic variants have been found to confer to the encoded enzymes higher or lower capacity to activate or detoxify the genotoxic compounds such as butadiene (BD). We studied 64 Italian subjects [27 BD-exposed workers (6.4 mg/m3 = very low exposition) Y and 37 controls] using different biomarkers of the genotoxic effect: chromosomal aberrations, sister chromatid exchange (high frequency cells-HFC, proliferation rate index-PRI). Furthermore, the
genotypes of all studied subjects were determined using RFLP-PCR techniques for exon 3 (mEH3/ c.337T9C) and exon 4 (mEH4/c.416A9G) polymorphisms; the subjects were assigned to a specific group based on the microsomal epoxide hydrolase (mEH) activity predicted by their genotype (EPHX1-slow, intermediate, fast). Different models of analysis of variance were constructed to evaluate the variation of some biomarkers related to EPHX1 genotypes, or other factors as smoke and exposure. The studied biomarkers were not able to discriminate between exposed and control individuals but SCE and HFC were influenced by smoking habits. Smokers having fast EPHX1 genotype (association already observed as increased risk for some types of cancer) showed higher SCE frequency (7.61) respect to those presenting intermediate (5.86) or slow (6.65) EPHX1 genotypes. The method for mEH3 genotyping used produced partly erroneous activity classification of the subjects, because of the novel polymorphism in codon 119 G9A (some YH heterozygotes can be falsely classified as HH homozygotes). This problem is evidenced by exon 3 allele frequencies not being in Hardy-Weinberg equilibrium. It seems that an advantage of Bintermediate genotype^, deduction which we made on the first observed results, is not further present when novel polymorphism (c.119) was taken in consideration and after all a correct classification of the subjects has been done.
3.11-P
Aneuploidies can be caused by telomere erosion in human mammary epithelial cells J. Pampalona, D. Soler, M. Martı´n, M. Terradas, A. Genesca` and L. Tusell Universitat Auto`noma de Barcelona Carcinomas derive from epithelial cells accumulating chromosomal reorganization and aneuploidy. Telomere dysfunction is a factor that contributes to the formation of structural chromosome reorganization. Dicentric chromosomes formed from the fusion of uncapped chromosome ends may enter bridgefusion-breakage cycles (BFB), originating the types of chromosomal aberrations observed in tumour cells. Human mammary epithelial cells (HMECs)
6th ECC: Abstracts obtained from normal mammary glands show a proliferate barrier, termed selection, when grown in vitro. Some HMECs can overcome this barrier by spontaneous inactivation of the p16 gene, and go on proliferating with further telomere erosion. Examination of post-selection HMECs demonstrates the presence of abnormal nuclear shapes (nucleoplasmatic bridges, buds and micronucleus) showing evidence of their genomic instability. The frequency of abnormal nuclear shapes in post-selection HMECs increases with population doublings and most usually involves individual chromosomes with critical telomere length. In this study, it has been determined that the probability of a specific chromosome being involved in abnormal nuclear shapes is also influenced by chromosomal architectural factors. Most importantly, this work in binucleated HMECs has allowed us to conclude that aberrant chromosomes entering BFB not only cause structural chromosome reorganizations, but also impede accurate chromosome segregation. Chromosomes with dysfunctional telomeres are those most frequently involved in aneuploidies. The most important mechanism originating telomere-dependent aneuploidies is non-disjunction. Thus, during tumour development, telomere erosion together with the inactivation of certain cell-cycle checkpoints will cause structural and numerical chromosomal instability. As a result of this instability, cells will acquire mutations and gene dose changes necessary to the onset of carcinogenesis.
141 (CPT) and to ionizing radiations in terms of induction of chromosomal aberrations in primary lymphocytes and lymphoblastoid cells of two patients and their relatives. Previous studies performed on lymphoblastoid cells of one of these patients, homozygote for a new APTX mutation, demonstrated the hypersensitivity of AOA1 cells to CPT (5). This result was now confirmed by treating stimulated peripheral lymphocytes with CPT. In response to ionizing radiations, the G0 lymphocytes of normal and heterozygous individuals and of patients showed an identical incidence of aberration-bearing cells but a significant increase of X-ray-induced dicentric chromosomes in APTX-defective cells. In order to understand the basis of this increase, we post-treated the G0 lymphocytes with Ara-C, a drug which modulates the pathway of slow repair increasing the amount of dicentrics; the results confirmed the significant high levels of dicentrics in APTX defective cells. Furthermore we were unable to detect, in AOA1 lymphoblastoid cells, chromosomal hypersensitivity to H2O2, KBrO3, MMS, EMS, drugs which can directly or indirectly lead to DNA single strand breaks. Taken together, these results suggest that aprataxin plays a role in the repair of a subclass of SSBs, which are processed by slow repair machinery. References 1. Sano Y et al. Ann Neurol 55,241Y249, 2004 2. Gueven N et al. Hum Mol Genet 13, 1081Y1093, 2004 3. Clements P et al. DNA Repair 3, 1493Y1502, 2004 4. Luo H et al. Mol Cell Biol 24, 8356Y8365, 2004 5. Mosesso P et al. Cell Mol Life Sci 62, 485Y491, 2005
3.12-P
Cytogenetic evidence of the role of aprataxin in the dna single strand break repair A. De Amicis, M. Piane, G. Pepe, P. Mosesso and L. Chessa Second Faculty of Medicine, La Sapienza University, Tuscia University; Viterbo, Italy Recent evidences show that aprataxin (APTX), the protein mutated in the Ataxia Oculomotor Apraxia type I (AOA1), plays a role in the repair of DNA single strand breaks (SSBs ) (1Y4). We studied the hypersensitivity of AOA1 cells to camptothecin
3.13-P
Telomere length influences radiation sensitivity D. Soler, M. Martı´n, J. Pampalona, M. Terradas, L. Tusell and A. Genesca` Universitat Auto`noma de Barcelona Human individuals often exhibit important differences in their sensitivity to ionising radiation, the basis of which is only now beginning to be understood. Extensive literature links impaired DNA repair with radiation sensitivity, this impairment
6th ECC: Abstracts
142 being due to a lack of correct functioning by many proteins involved in DNA repair pathways and/ or in DNA damage checkpoint responses. Given that ionising radiation is an important and widespread diagnostic and therapeutic tool, it is important to further research those factors and mechanisms underlying individual radiosensitivity. We have analysed human mammary epithelial cells (HMECs) at different population doublings. These cells do not have telomerase activity and their telomeres shorten progressively with each cell division. HMECs at late population doublings are more sensitive to radiation exposures than are those derived from early population doublings. This increased sensitivity is manifested as an increased induction of chromosome aberrations. We have observed that uncapped telomeres in human epithelial cells may join radiationinduced DNA DSBs, thus increasing the radiation sensitivity of cells with dysfunctional telomeres (HMECs at late PD). These results provide strong evidence that telomere function may well be involved in cellular and organism responses to ionising radiation, broadening still further the currently complex and challenging scenario.
(MTHFR) and reduced folate carrier (RFC-1) genes are associated with the risk of a DS offspring in Italy. Others observed association between a methionine synthase (MTR) gene polymorphism and the risk of a DS pregnancy in Italy. The aim of the present study was to evaluate chromosome damage, measured by means of the micronucleus assay, in peripheral lymphocytes of 34 MDS and 35 control mothers, and to correlate it with MTHFR 677C9T and 1298A9C, RFC-1 80G9A and MTR 2756A9G polymorphisms. We observed an increased frequency of BNMN in the MDS group compared to the control group (17.13+8.31° vs 10.28+4.53°; PG0.001), and, in the general population, a correlation between years of age and BNMN frequency (P=0.05). A significant correlation between the frequency of BNMN and the MTHFR 677C9T polymorphism (P=0.038) was also observed. Present results indicate that MDS are more prone to chromosome damage than control mothers, and suggest a contribution of folate metabolizing gene polymorphisms to the baseline frequency of BNMN lymphocytes.
3.15-P 3.14-P
Polymorphisms in folate metabolising genes and micronuclei L. Migliore, Fabio Coppede", Renato Colognato, Francesca Migheli, Valentina Sarli, Alessia Bonelli, Guja Astrea, Stefania Bargagna and Gabriele Siciliano Dept. of Human and Environmental Sciences, University of Pisa, Dept. of Neurosciences, University of Pisa, Pisa, Scientific Institute BStella Maris^, Calambrone (Pisa) We have recently observed an increased frequency of both binucleated micronucleated cells (BNMN) and chromosome malsegregation events in peripheral lymphocytes of mothers of Down syndrome (DS) individuals aged less than 35 years at conception (MDS) in respect to controls. Moreover, in a separate study, we observed that combinations of polymorphisms in the methylenetetrahydrofolate reductase
Bloom syndrome in a child with severe short stature and wilms tumor K. Bodurog˘lu, Y. Alanay, M. Alikas¸ifog˘lu, D. Aktas¸, G. E. Utine and E. Tunc¸bilek Hacettepe University Bloom syndrome (BS) is a rare autosomal recessive chromosomal breakage disorder. The carrier incidence is increased among the Ashkenazi Jewish population. Its incidence in the Turkish population is not known. It is clinically characterized by severe growth retardation, characteristic skin changes and cranio-facial dysmorphic features, immunodeficiency, increased risk of early onset carcinomas and hematological malignancies. Bloom syndrome is considered in the differential diagnosis of severe short stature in childhood. Here we present a 12 years old girl with Bloom syndrome diagnosed and treated for Wilms tumor (WT) ten years ago when she was 2 years old. She received chemo- and radiotherapy for WT after a nephrectomy. In the follow-up period, following a
6th ECC: Abstracts severe pneumonia and impetigo she was diagnosed with hypogammaglobulinemia and treated with IVIG. She is the third child of a consanguineous couple with two healthy siblings. Physical examination revealed severe growth retardation (G3rd centile) with normal mental development. Skin color was dark dispersed hypo- and hyperpigmented areas on the left arm and groin region. Facial skin was dry and hyperemic with increased vascularisation and telengiectasias. Mother described photosensitivity. Both thumbs were proximally placed with clinodactyly in the left fifth finger. Syn-polydactyly in the right foot was also noted along with bilateral sandal gap between first and second toes. She was given the diagnosis of BS following the demonstration of increased SCE (950%). Wilms tumor has been very rarely reported in relationship with BS. Herein, a patient with BS almost 10 years after treatment for WT is described. The delay in diagnosis with special emphasis on considering BS in children with severe short stature are discussed.
143 transurethral bladder resection and 15 healthy bladder controls. In the samples, FISH analysis was performed by using centromer spesific probes for chromosome 3, 7, 8, 11, 17. and 9p21 locus. Results: The most frequently seen chromosomal alterations specific to G1-G2 tumors were deletions of 9p21 (66%) and chromosomes 17 (44%). Polysomy was specific to T1G2-G3(High) ve T2G3(High) carcinomas. A statistically significant difference was seen in the frequency of polysomy between G1G2(low) and G2-G3(High) for chromosomes 3, 7, 8, 11 and 17 (PG0.01). Conclusion: These findings suggest that FISH analysis of bladder washing samples can effectively detect genetic changes of bladder tumors. It might predict genetic progression of these tumors, which might be related to tumor stage, because higher stages of tumors showed a higher incidence of polysomies of chromosomes 3, 7, 8, 11 and 17.
3.17-P 3.16-P
Fish-detected genetic markers on bladder washings from patients with bladder cancer Cilingir, I. Cimen, B. Durak, C. Can, G. Bademci and S. Artan Eskisehir Osmangazi Universty Medical Faculty Department of Medical Genetics Eskisehir-Turkey, Eskisehir Osmangazi Universty Medical Faculty Departments of Urology Eskisehir-Turkey The bladder is the most common site of transitional cell carcinoma (TCC) in the urinary tract. Most patients present with superficial low-grade papillary TCC and the disease can often be controlled with transurethral resection. The tumor recurrence rate may be as high as 70% to 80%. Aim: To determine the potential for the clinical application of interphase FISH technique in the diagnosis and also to compare incidence of nuclei with aneuploidy in different grades of tumors. Methods: The cells were obtained by bladder washing and voided urine from 30 patients with transitional cell carcinoma (TCC) who underwent
CBMN-test as genetic biomarker for the evaluation of environmental health in two population groups of Madrid A. de Leon Rodriguez, C. Villalon Villarroel, M. Pollan, N. Aragones, M. Talavera Yagu¨ez, M. T. Ferro, C. San Roman and J. M. Garcia-Sagredo Medical Genetics, Hospital Universitario Ramon y Cajal, Madrid., Centro Nacional de Epidemiologı´a. Instituto de Salud Carlos III, Madrid Introduction: Genetic biomarkers are used as early predictors of cancer risk. Therefore, they can be used to evaluate the state of environmental health of a population potentially exposed to genotoxic environmental agents. One of those markers is the Citokinesis block micronucleus test (CBMNt). The BioMadrid project tries to evaluate the feasibility to implant a biomonitorization system in big groups of population using 2 areas of Madrid Region. Material and methods: 100 trios (mother, father, and new born) living in the two areas have been recruited. We took peripheral blood samples of mother and father and umbilical cord blood samples
6th ECC: Abstracts
144 from each trio together with an epidemiological interview. The blood samples had been cultivated following the CBMN-t protocol during 68 h, adding Cytochalasin-B 24 hours before the end of the culture. The analysis scored the frequency of MN in 1000 binucleated cells, the cellular proliferation index, the chromatin bridges and nuclear buds. Results and conclusions The rates of the MN in binucleated cells in area A were 4,04° (newborns), 6,74° (mothers), and 6,17° (fathers). The rates of MN in area B were 3,85° (newborns), 6,32° (mothers), and 6,13° (fathers). These figures fit within the normal ranks and significantly correlate the rate of MN of each new born with their parents. All the data collected with the MN test are being correlated with the data corresponding to the epidemiological interview elaborated in parallel by the Bio-Madrid project and with the analytical results of heavy metals, organochlorated compounds and polycyclic aromatic hydrocarbons.
individuals. The frequency of deleted GSTM1 and GSTT1 genotypes, and the frequency of Ile/Ile (wild type), Ile/Val (heterozygous variant) and Val/Val (homozygous variant) CYP1A1 genotypes was determined using PCR method. CA frequency was assessed after mitomycin C [0.05 mg/ml] treatment of peripheral blood lymphocyte cultures during 24 hrs at G0 phase of cell cycle. The group of individuals with null alleles for both GSTM1 and GSTT1 showed significantly (pG0.01) higher level of mitomycin C induced CA (29%) than the group with non-null genotype (for both GSTM1 and GSTT1) (24%). The difference in the number of CA induced by mitomycin C between wild type CYP1A1 group (Ile/Ile) and heterozygotes (Ile/Val) was not observed. There were not Val/Val persons in our sample. Thus, our results indicate that null genotype of both GSTM1 and GSTT1 is associated with increased level of chromosome aberrations in lymphocytes and the CYP1A1 genotype does not influence the level of mitomycin C induced chromosome aberrations.
3.18-P
Effect of polymorphisms of xenobiotic metabolizing enzymes on human lymphocytes sensitivity to mutagen exposure
3.19-P
Nikitina, S. A. Grigorieva, N. V. Kosyakova, L. D. Katosova, V. I. Platonova, E. S. Voronina, Iu. A. Revazova and A. N. Chebotarev
O. Giray, E. Bora, B. Bora Makay, A. Ulgenalp, G. Kose, O. Anal and D. Ercal
Research Center for Medical Genetics, A.N. Sysin Institute of Human Ecology and Environmental Hygiene
Immunodeficiency - Centromeric instability- Facial anomalies syndrome (OMIM 242860), is an inherited immunodeficiency syndrome with variable degree of mental/motor retardation and dysmorphic facial features. Here we present a 5-year-old case with flat- triangular- asymmetric face, bilateral onychodysplasia of hallux and joint laxity with cubitus valgus and mild thoracic scoliosis in addition to humoral immunodeficiency. Cytogenetic investigation revealed a 46,XX karyotype and centromeric instability of chromosomes 1, 9 and 16. Although this syndrome is known to be inherited as an autosomal recessive trait, the presence of similar findings in the proband_s maternal grandmother raise the possibility of autosomal dominant disease with low penetrance.
It is well known that elevated level of chromosome aberrations (CA) in peripheral blood lymphocytes has been linked to cancer predisposition. On the other hand polymorphisms of the genes encoding phase I and phase II xenobiotic metabolizing enzymes have been shown to be associated with increased risk of cancer. We assessed the effect of gene polymorphisms of CYP1A1 (phase I) and GSTT1, GSTM1 (phase II) on the frequency of aberrant metaphases induced by mitomycin C in peripheral lymphocytes of 47 healthy non-smoking
Centromeric instability of a immunodeficient girl: a case report
Dokuz Eylul University
6th ECC: Abstracts
3.20-P
Genotoxicity of carbon monoxide in patients with acute carbon monoxide intoxication Tarik, Zeynep Ocak, Hasan Dogan and Uzkeser Mustafa Faculty of Medicine, Ataturk University, Numune State Hospital, Ahmet Yesilyurt, Sahin Aslan, Mevlit Ikbal Exposure to toxic gazes which can induce serious health effects can occur in the working as well as in general environment, including home. It was evaluated for genotoxicity in cultured peripheral blood lymphocytes of patients with carbon monoxide intoxication (M/F: 10/9). Sister chromatid exchange was determined after acute carbon monoxide intoxication. With carbon monoxide intoxication, the frequencies of sister chromatid exchange was significantly increased (p: 0.001) compared to control groups, suggesting that carbon monoxide has moderate genotoxic potential in patients with carbon monoxide intoxication.
3.21-P
Aging induced DNA hypomethylation effects on cell division and genome stability N. Cucu, Burlibasa Liliana, Mioara Matei, Turcu Elena, Camelia Birsan, G. I. Prada, G. L. Radu and F. Ciocoiu Faculty of Biology, CFR2 General Hospital, Dept. of Genetics, Ana Aslan International Academy of Antiaging, National Institute of Biological Sciences, Bio-Analysis Dept, Ana Aslan National Institute of Gerontology and Geriatrics ACE and MTHFR polymorphisms, genomic DNA methylation level, as well as cell division patterns have been studied in six elderly (60 plus years), adult (30Y45 years), and young (18Y30 years) groups, as follows: one young group with controlled sportive life, one young group with uncontrolled lifestyle, two
145 adult groups with and without health problems, and two elderly groups, with vs. without significant pathology. The comparative screening was focused on the metabolism of the one carbon methyl group (SAM/SAH ratio) linked with the genome instability due to genomic DNA hypomethylation. The results pointed out a pronounced global demethylation in the elderly, which explained the altered cell division pattern characterized by frequent PCDs (premature chromosome dissociations) and the associated radial chromosomal morphology, as compared with the control, young sportive group. These features have been identified also in the young subjects with cancer or under antiviral and hormonal therapy as well as in the adult cancer bearing patients. The genotyping of angiotensin catabolizing enzyme (ACE) and methylene tetrahydrofolate reductase (MTHFR) genes, as well as HPLC evaluation and methylation sensible restriction analysis of the global DNA methylation level, provided interesting information about the molecular events we suggest to be involved in drawing up of vulnerability hallmarks development.
3.22-P
Effect of polymorphisms of xenobiotic metabolizing enzymes on human lymphocytes sensitivity to mutagen exposure V. A. Nikitina, S. A. Grigorieva, N. V. Kosyakova, L. D. Katosova, V. I. Platonova, E. S. Voronina, Iu. A. Revazova and A. N. Chebotarev Research Centre for Medical Genetics Russian Academy of Medical Sciences, A.N. Sysin Institute of Human Ecology and Environmental Hygiene, Russian Academy of Medical Sciences It is well known that elevated level of chromosome aberrations (CA) in peripheral blood lymphocytes has been linked to cancer predisposition. On the other hand polymorphisms of the genes encoding phase I and phase II xenobiotic metabolizing enzymes have been shown to be associated with increased risk of cancer. We assessed the effect of gene polymorphisms of CYP1A1 (phase I) and GSTT1, GSTM1 (phase II) on the frequency of aberrant metaphases induced by
6th ECC: Abstracts
146 mitomycin C in peripheral lymphocytes of 47 healthy non-smoking individuals. The frequency of deleted GSTM1 and GSTT1 genotypes, and the frequency of Ile/Ile (wild type), Ile/Val (heterozygous variant) and Val/Val (homozygous variant) CYP1A1 genotypes was determined using PCR method. CA frequency was assessed after mitomycin C [0.05 mg/ml] treatment of peripheral blood lymphocyte cultures during 24 hrs at G0 phase of cell cycle. The group of individuals with null alleles for both GSTM1 and GSTT1 showed significantly (pG0.01) higher level of mitomycin C induced CA (29%) than the group with non-null genotype (for both GSTM1 and GSTT1) (24%). The difference in the number of CA induced by mitomycin C between wild type CYP1A1 group (Ile/Ile) and heterozygotes (Ile/Val) was not observed. There were not Val/Val persons in our sample. Thus, our results indicate that null genotype of both GSTM1 and GSTT1 is associated with increased level of chromosome aberrations in lymphocytes and the CYP1A1 genotype does not influence the level of mitomycin C induced chromosome aberrations. Acknowledgments: RFBR No. 05-04-49271
4.1-O
Comprehensive analysis of human oocytes and 1st polar bodies by comparative genomic hybridisation (CGH) J. D. A. Delhanty, E. Fragouli, A. Mantzouratou, D. Wells, P. Serhal and M. J. W. Faed University College London, Yale University, ACU, University College Hospitals, Dundee University Comparative genomic hybridisation (CGH) analysis allows the number of copies of each and every chromosome to be determined from a single cell without risk of loss of material. We have used CGH to detect aneuploidy in a series of donated oocytes and corresponding 1st polar bodies (PBs) from 82 women of average age 33.2 yrs. The great majority of couples were undergoing IVF, with male factor the most frequent reason. Results to date have been obtained from 221 oocyte-PB complexes (eggs), with an aneuploidy rate of 20.8%. Abnormalities affected
all chromosomes except 7 & 14 but most frequently the X and then chromosomes 21, 22, followed by 8, 12 & 20. Three structural anomalies were detected. Mechanisms involved whole chromosome nondisjunction, unbalanced chromatid pre-division, chromosome breakage and, rarely, germinal mosaicism. The larger autosomes, numbers 1 to 12, were affected solely by whole chromosome non-disjunction but unaffected by chromatid anomalies. This finding is thought to reflect the role of crossing over in holding paired bivalents together, since larger chromosomes have more points of crossing over. Smaller chromosomes with few crossovers are more likely to separate early, in turn predisposing them to chromatid anomalies. However, the X chromosome is clearly a special case; eight of the siteen X chromosome anomalies were seen in just three patients, age range 18Y42. At least half of were chromatid anomalies. It is clear that age-independent mechanisms are operating in some of the younger women, suggesting a possible link with infertility. We have shown that, with rare exceptions, analysis of the 1st PB will reliably predict the chromosome status of the corresponding oocyte, paving the way for clinical application and for research into mechanisms controlling meiosis. Once the chromosome status of the oocyte has been predicted by PB analysis, the oocyte itself may be used for microarray identification of differential gene expression in aneuploid eggs.
4.2-O
Human reciprocal translocations: approximation to their segregation behavior using sperm FISH analysis E. Anton, F. Vidal and J. Blanco Unitat de Biologia CelIlular Reciprocal translocations (rcp) are the most common structural chromosome reorganizations in humans. Segregation studies in rcp carriers have reported very divergent results, which have been classically attributed to particular cytogenetic characteristics of each rearrangement. To gain knowledge about segregation behavior of rcp, segregation analyses were performed in 14 rcp carriers using sperm FISH. Carriers were
6th ECC: Abstracts selected for presenting different cytogenetic characteristics and thus diversity in tetravalent pairing geometries. A customized combination of probes labeled with different fluorochromes was chosen for each case to identify all the segregation products. Percentages of Alt, Adj I, Adj II and 3:1 segregation products were evaluated for every patient. Interindividual differences were assessed using an analysis of hierarchical conglomerates. Results displayed a major cluster of 12 individuals who presented a scaled production of Alt (43.9%), Adj I (31.4%), Adj II (16.5%) and 3:1 (7.3%) segregation modes. Intracluster differences did not correlated either with the length of the translocated segments or with the length of the interstitial segments. Two carriers were grouped in a second cluster characterized by the nearly absence of gametes from Adj II and 3:1 segregation (59.3% Alt, 36.3% Adj I, 0.8% Adj II, 2.4% 3:1). This result was attributed to the very unusual configuration adopted by those rearrangements with extremely short translocated segments and presence of centromeric heterochromatin in the center of the tetravalent. These features would favor the behavior of the tetravalent as two independent bivalents at Anaphase I. Despite the variability of the rcp analyzed, most of them displayed a similar meiotic behavior with a main production of gametes bearing an alternate content. Our results point out to a far more homogeneous behavior than the described in the literature suggesting that part of the variability reported could be influenced by other factors such as the use of different methodological procedures.
4.1-P
The direct characterisation of breakpoints: a new approach for the segregation analysis of paracentric inversions in human sperm S. Bhatt, K. Moradkhani, K. Mrasek, J. Puechberty, G. Lefort, P. Sarda, S. Hamamah, T. Liehr and F. Pellestor INSERM U847, Institute of Human Genetics and Anthropology, Jena, Medical Genetics, CHU Montpellier, Department of Medical Genetics, CHU Montpellier, Department of Reproduction
147 Biology, CHU Montpellier, University of Montpellier I, France Chromosomal inversions are one of the most common rearrangements found in human. To date, the segregation studies have been performed either by human sperm/hamster oocyte method or FISH technique. In the present study, we report the sperm FISH analysis of two paracentric inversions of chromosome 14 and chromosome 5, based on the direct breakpoint identification by the use of BACs spanning the inversion breakpoints.Sperm analysis was performed by multicolor FISH. Total of 7670 and 4807 spermatozoa were scored for inv(14) and inv(5) respectively. The breakpoints for inv(14) case were found to be in 14q23.2 and 14q32.13. The breakpoints for inv(5) case were found to be in 5q13.3 and 5q33.1.The breakpoints for both inversions were found to be in G light region. The inverted segment length for inv(14) was 31 Mb and 29% of the total length of the chromosome was involved in the inverted segment. The frequency of sperm harbouring normal, inverted, deleted, duplicated chromosome 14 was found to be 49.62%, 46.66%, 3.43% and 0.29% respectively. The inverted segment length for inv(5) was 75 Mb and 42% of the total length of the chromosome was involved in the inverted segment. The frequency of sperm harbouring normal, inverted, deleted, duplicated chromosome 5 was found to be 45.64%, 44.67%, 8.73%, 0.96% respectively. This study shows that the breakpoint characterisation could be an efficient approach for segregation analysis of paracentric inversion. Using the BACs spanning the breakpoints, the percentage of normal, inverted, duplicated deficiency and deleted segregation product could be accurately estimated.
4.2-P
Study of some epigenetic mechanisms involved in chromatin dynamics during animal cytodifferentiation L. Burlibasa, Natalia Cucu, Rozalia Motoc, Ana Maria Niculescu and Lucian Gavrila Faculty of Biology Our studies were focused on molecular architecture of chromatin during gametogenesis. The dynamics of
6th ECC: Abstracts
148 chromatin during meiosis are significantly different than that encountered in mitotic cells. Using transmission electron microscopy (TEM), immunohistochemistry technique and molecular investigations, some peculiar aspects of chromatin organization and evolution in oogenesis and spermatogenesis of crested newt Triturus cristatus were investigated. We focused our investigations on the dynamics of chromatin structure after treatment with trichostatin A (TSA), a histone deacetylase inhibitor. Ultrastructural and molecular analysis of the new testicular tissue after TSA treatment indicated a major chromatin remodelling in sperm nuclei, evidenced by chromatin decompactation and the absence of sperm-specific proteins. Thus, histone deacetylation could be interpreted as an early signal of histone replacement by highly basic sperm-specific proteins a process tightly linked to nuclear condensation. The analysis of the electrophoretic profiles of DNA restricted with MspI/HpaII isoschisomere enzymes showed a global DNA demethylation in the TSA-incubated testicular tissue. Thus suggests close connection between the chemical modification of histones and variation in the DNA methylation level. ChIP assay has been used to study the presence of 5methyl cytosine and chemical modification of histones (H2A ubiquitinated and H4 hyperacetylated) at the level of ribosomal cistron promotor in previtelogenic and vitelogenic oocytes and sperm nuclei. Modulation of the chromatin structure during gametogenesis requires changed patterns of histone proteins and histone modifications which contribute to restructuring of chromatin. Some of these epigenetic modifications are involved in genomic imprinting.
4.3-P
Meiotic segregation in sperm of a male carrier of a t(X;18)(q11;p11.1) inherited from his mother A. Perrin, N. Douet-Guilbert, M. J. Le Bris, G. Keromnes, M. L. Langlois, P. Barrie`re, F. Morel and M. De Braekeleer Faculte´ de Me´decine & CHU, CHU, Laboratoire de Kerlann, Vannes, CHU Nantes Balanced reciprocal translocations are the most common structural abnormalities, most of them
involving two autosomes and a few a gonosome (X or Y chromosome) and an autosome. These rearrangements are generally without phenotypic consequences but are usually associated with infertility and/or a higher risk of chromosomal imbalances among offspring. This 26 year-old man was first seen because of a 3 year history of primary infertility. He had been found to have a translocation, t(X;18)(q11;p11.1), inherited from his mother when he was 9 year-old. Semen analysis showed a very severe oligoasthenoteratozoospermia with 0.4 million spermatozoa/ml, including 95% of immobile sperm and 90% of abnormal forms. Three-color FISH was performed on a semen sample using the specific alphoid probe of chromosome 18 (D18Z1), the 18p and Xq/Yq subtelomere probes. A total of 447 spermatozoa were analyzed. The alternate segregation pattern, leading to a normal or balanced chromosomal equipement, was found in 54.36% of the spermatozoa studied. The frequencies of adjacent 1, adjacent 2, 3:1 segregation and diploidy (or 4:0 segregation) were 8.2%, 5.14%, 22.37% and 2.01%, respectively. Given that half the spermatozoa had a normal or balanced chromosomal equipment, intracytoplasmic sperm injection (ICSI) was proposed to the couple. A normal 46,XY boy was born following the first attempt. Balanced reciprocal translocations between an autosome and the X chromosome leads to important disruption in human spermatogenesis because the derivative X chromosome may be interfering with the sexual vesicle which is involved in meiotic segregation. Almost all the males with an X;autosome translocation have azoospermia. The man reported here had very severe oligoasthenoteratozoospermia and is the first in whom meiotic segregation pattern was analyzed. This case further emphasizes the interest of performing FISH studies in infertile males with a chromosomal translocation to give them a personalized risk assessment of unbalanced spermatozoa.
4.4-P
Meiotic segregation analysis in cows carriers of t(1;29) robertsonian translocation A. Bonnet-Garnier, H. M. Berland,
6th ECC: Abstracts
J. F. Beckers, S. Lacaze, A. Pinton, M. Yerle and A. Ducos UMR INRA-ENVT 444 Ge´ne´tique Cellulaire, De´partement de Physiologie Animale, Universite´ de Lie´ge, MIDATEST Robertsonian translocations are frequent structural chromosomal abnormalities in human and cattle. Heterozygote carriers of Robertsonian translocations have generally a normal phenotype but show variable decrease in fertility. In Human, studies of the male meiotic segregation using FISH techniques find a majority of balanced spermatozoa (range from 60 to 96.6%). The proportion of unbalanced products of the segregation is higher for female compared to male but the number of oocytes analysed so far remains limited (from 30 to 100). In cattle, the presence of the well known t(1;29), offers a model to study the meiotic segregation in female carrier of a Robertsonian translocation. The aim of our project is thus to assess the rates of unbalanced and balanced oocytes in four cows, to examine an eventual inter-individual variation and to compare these values with those obtained in bulls carriers of the same translocation. The four cows were superstimulated and subjected to ovum pick up twenty times. All cumulus-oocyte complexes were matured in vitro then treated to obtain metaphase spreads of oocytes II. Dual colours whole chromosome painting probes for BTA1 and 29 were hybridized on oocytes preparations. To date, a total of 615 oocytes have been punctured, 569 matured in vitro and 444 oocytes successfully spread. Among these last, 166 oocytes have been analysed after FISH treatment: 135 (81,3%) are balanced including 64 translocated and 71 normal, 25 are diploid (15%), 6 unbalanced (3.7%). The percentage of balanced oocytes is lower than the average proportion of balanced spermatozoa (97.1 %) observed for two heterozygous bulls (5425 and 2702 sperm nuclei were scored). This difference is essentially due to a high rate of diploid oocytes (0.04% of diploid spermatozoa). These preliminary results should be confirmed and will be discussed when all the oocytes will be analysed.
4.5-P
Meiotic studies in an azoospermic (Y;14) translocated boar
149
A. Pinton, I. Raymond Letron, H. M. Berland, N. Bonnet, A. Calgaro, A. Garnier Bonnet, M. Yerle and A. Ducos INRA, ENVT Y-autosomal translocations are very rare in humans (about 1 in 2000 at birth) and few studies report the analysis of the meiotic behaviour of this kind of chromosomal rearrangement. We report the case of a Y-14 translocation in pig identified in an azoospermic boar. Classical and molecular cytogenetic analyses allowed us to define the rearrangement as a t(Y;14) (q10;q11). Histological analysis revealed a meiotic arrest at the pachytene stage of the first meiotic division, with abnormal seminiferous tubules contents and a hyperplasia of the Leydig cells. Meiotic pairing analyses were carried out using immunocytological and FISH approaches. The aim of these studies was to analyze the meiotic behaviour of the quadrivalent through the detection of the synaptonemal complexes proteins (SCP3 and SCP1), the centromeres and the gH2AX histone variant. The immunolocalization of these proteins combined with FISH, revealed the presence of gH2AX large signals on the quadrivalents. In the spermatocytes analyzed, gH2AX seemed to be confined to the X and Y chromosomes parts but spreading of the gH2AX signals was also observed in autosomal parts. In addition, Cot-1 DNA FISH combined with immunolocalization of gH2AX led us confirm the transcriptional silencing of the g H2AX positive domains. Our results suggest that the accumulation of the gH2AX correlated with a transcription silencing of autosomal parts of the quadrivalent could be responsible for the inactivation of genes on chromosome 14 that are crucial for the meiotic division, leading to a spermatogenesis arrest. Gene expression analysis of candidate genes on this chromosome will be carried out to verify our hypothesis.
4.6-P
Sperm DNA integrity assessment in an infertile 9qh+++ carrier A. Garcı´a-Peiro´, Maria Oliver-Bonet, Joaquima Navarro, Carlos Abad, Miriam Guitart and Jordi Benet
150 Universitat Auto`noma de Barcelona, Corporacio´ Sanita`ria Parc Taulı´ Heterochromatin polymorphisms have been found to be frequent among infertile population but the possible mechanism involved has not been established yet. Furthermore, heterochromatin polymorphisms are considered a normal variation in human population. However, alteration types are found at different levels of the spermatogenesis in some carriers. Differences in the constitutive heterochromatin length could be related to alterations in meiotic processes such as synapsis or recombination. At a different level, sperm DNA fragmentation and alterations in the chromatin packaging are also known to play a role in fertility. Apoptosis and maturation defects are processes that can result in DNA fragmentation and halt of spermiogenesis. We have analysed the extension of DNA damage in an oligoasthenoteratozoospermic man carrier of heterochromatin polymorphism 9qh+++ using TUNEL assay FACS analysis, SCSA and SCD test. Results were expressed as DNA fragmentation index (DFI) for TUNEL (77, 81%), SCSA (42,82%) and SCD test (87%) and high DNA stainable (HDS) for SCSA (14,66%). Moderate (34,71%) and high (43,10%) DNA fragmentation populations were detected by TUNEL. Immature cell population (HDS) also showed DNA fragmentation. Fragility sperm necks of unknown origin were noticed as morphological finding. Abnormal length of the pericentromeric heterochromatin block and alterations in meiotic processes could be related with apoptotic mechanisms activation. Moreover, morphological abnormalities like neck fragility may be consequence of deregulated genes involved in maturation process witch are involved with DNA fragmentation activity such as topoisomerases. Acknowledgements: This study was supported by Fondo Investigacio´n Sanitaria (Madrid) (project PI051834) and Generalitat de Catalunya (project 2005 SGR 00495).
4.7-P
Asynapsis and abnormal recombination in an infertile man carrier of a 9qh+++ polymorphism
6th ECC: Abstracts
M. Oliver-Bonet, Joaquima Navarro, Agustı´n Garcı´a-Peiro´, Carlos Abad, Miriam Guitart and Jordi Benet Universitat Auto`noma de Barcelona, Corporacio´ Sanita`ria Parc Taulı´ Presence of large heterochromatin regions on chromosome 9 has been described as a polymorphic variant among human population. Although the effects of such a polymorphism on the phenotype are unnoticeable, several reports on male infertility suggest a link between chromosomal polymorphisms and infertility. It has been proposed that differences in length due to morphological variations at heterochromatic regions between two homologous chromosomes may difficult synapsis, delaying or even preventing it. We present the case of a 9qh+++ infertile male patient. Results obtained add data to the literature to support a relationship between this polymorphic variant and the infertility observed in men carrying this heterochromatin polymorphism. Meiotic analyses on pachytene cells were performed using immunofluorescence technologies. Synaptic defects were found in 92% of the analyzed pachytenes. Synaptic abnormalities included asynapsis at 9qh+++ region, asynapsis affecting other than chromosome 9 synaptonemal complex (SC), SC fragmentation and association between autosomal SCs and sex body. Complete synapsis (possibly achieved by heterosynapsis) of the 9qh+++ region was found in 8% of the analyzed pachytenes. Recombination analysis showed an average number of 38 MLH1 foci per nuclei. This represents a decrease respect the average number found in controls. Aneuploidy analysis performed on decondensed sperm heads showed an increase in all chromosomes tested (X, Y and 18). Sperm aneuploidy rates for chromosomes X, Y, XY and 18 were 1.3%, 1.1%, 1.4% and 0.9%, respectively. Results obtained indicate the presence of meiotic disturbances at both synaptic and recombination levels that may cause the reduction observed in both sperm number and quality. The low number of recombination foci observed could be related to the aneuploidy frequencies found in sperm. Acknowledgements: This study was supported by FIS (PI051834) and Generalitat de Catalunya (2005 SGR 00495).
6th ECC: Abstracts
4.8-P
151 hence result in oligoasthenoteratozoospermia and male infertility.
Male factor infertility asssociated with a nonrobertsonian translocation t(8;13)(p11;p11)
4.9-P
J. F. Cuzzi, L. C. Veiga, I. Gomy, D. Gusma˜o, L. A. F. Laureano, S. A. Santos, Y. T. D. A. Nobre, T. Bovo and L. Martelli
Chromatin ageing and FISH efficiency in human oocytes, arrested zygotes and polar bodies
School of Medicine of Ribeirao Preto - University of Sao Paulo
R. Zhivkova, I. Vatev, S. Delimitreva and D. Toncheva
Chromosomal rearrangements are implicated in reproductive failure in males, with a significantly higher rate of cytogenetic anomalies observed in azoospermic (13.7%) than in oligospermic males (4.6%) and a higher frequency of sex chromosomal abnormalities. Among the most common chromosomal rearrangements in male factor infertility is Robertsonian and reciprocal translocations involving acrocentric chromosomes, which are generally associated with the lowest spermogram values. In the present study, we report an unusual reciprocal translocation between chromosomes 8 and 13 t(8;13) found in two brothers with oligoasthenoteratozoospermia without any clinical manifestation other than primary infertility. We performed GTG and spectral (SKY) karyotypes for the definition of the chromosomal translocation. We observed the same reciprocal translocation in both patients 46,XY,t(8;13)(p11;p11). It suggests an inherited translocation however we didn_t have contact to their parents. To our knowledge, these two patients are the first case of reciprocal translocation t(8;13) associated with male factor infertility. The infertility in men with autosomal aberrations may be due to the physical contact of unpaired autosomal material with sex chromosomes, which leads to spermatogenic arrest. Some authors suggested that chromosome pairing during meiosis could be very sensitive to chromosome translocations, thus making matching between homologous chromosomes difficult and defects in segregation during spermatogenesis might lead to oligozoospermia. Moreover epigenetic gene expression mechanisms are also important in causing chromosomal instability. In conclusion, the reported translocation is associated with a normal phenotype but may have a strong impact on the spermatogenesis process during meiotic division and
Medical University - Sofia, Dept. of Biology, Medical University - Sofia, Dept. of Medical Genetics Fifty-four human unfertilized oocytes, 34 arrested human zygotes and 15 polar bodies were undergone to FISH-analysis. The cells were obtained after IVF Y ET procedure in the IVF Center BTechnobios^, Medical University - Sofia. Unfertilized oocytes and arrested bipronuclear zygotes were considered and fixed for analysis 48Y52 h after their in vitro insemination. Two types of oocyte metaphases were selected: 40 chromosome spreads and 14 oocytes with premature sperm chromosome condensation (PCC). The slides were Giemsa stained for previous estimation and discolored prior to be hybridized for strict chromosome identification. Seven first polar bodies (1PB) and 8 second PBs were isolated during cell processing for cytogenetic analysis. FISH in two rounds was applied using two sets of probes Y centromere probe for chromosome 18, locus-specific for chromosome 21 at the first step and X centromere and Y locus-specific at the second round. Simultaneous hybridization of centromere and locus-specific probes was successful in metaphases with good chromosomal morphology and in pronuclei with dispersed chromatin. The same FISH success was registered in 2PBs with dispersed chromatin. In cells with condensed and/or fragmented metaphases and pronuclei only FISH signals for centromere probes were detected. Oocytes with PCC displayed the same pattern of FISH success related to the different level of chromatin condensation in two chromatin groups: lack of hybridization was related to the poor morphology in oocyte metaphases. Successful FISH for both centromere and locus-specific probes was registered in the sperm chromatin (PCC). FISH analysis of 1PBs was unsuccessful for the locus-
6th ECC: Abstracts
152 specific probes and only centromere signals were obtained. In highly condensed chromatin FISH was unsuccessful. Our results displayed the role of chromatin condensation and fragmentation on the FISH efficiency and the significance of chromatin ageing during cell culture before fixation.
4.10-P
Segregation analysis in two human male translocation carriers Benet, M. Oliver-Bonet, M. Costa and J. Navarro Unitat de Biologia CelIlular i Gene`tica Me`dica, Facultat de Medicina. Universitat Auto`noma de Barcelona Carriers of translocations have an increased risk of Carriers of translocations have an increased risk of having reproductive failures due to the production of unbalanced gametes. The unbalanced gametes arise from the segregation of the quadrivalent formed by the chromosomes involved in the reorganisation during spermatogenesis. Meiotic segregation patterns were analysed in two carriers of reciprocal translocation. One carrier, 35 years of age, had a karyotype 46,XY,t(6;17)(q21;q25) and was ascertained because his wife had spontaneous abortions. The other patient, 38 years of age, had a karyotype 46,XY, t(8;18)(q11;p11) and was ascertained for primary infertility. Semen samples were fixed and sperm heads were decondensed by DDT treatment. In situ hybridisation analysis of the t(6;17) has been performed using a probe for the centromeric region of chromosome 6 (Spectrum Green), a (1:1) combination of two specific probes for the centromeric region of chromosome 17 (Spectrum Orange and Spectrum Green) and a telomeric probe for 17q (Spectrum Orange). In situ hybridisation analysis of the t(8;18) has been performed using two probes for the centromeric region of chromosomes 8 and 18 (Spectrum Orange and Aqua, respectively) and a telomeric probe for 18p (Spectrum Green). Results of the segregation analysis are as follow, for the t(6;17) carrier, a total of 1082 decondensed sperm nuclei has been analysed. The frequencies of alternate, adjacent I, adjacent II, 3:1 and others segregations were 50.7%, 37.1%, 5.9%, 4.7% and 1.6% respectively.
For the t(8;18) carrier, a total of 3520 decondensed sperm nuclei has been analysed. The frequencies of alternate, adjacent I, adjacent II, 3:1 and others segregations were 60.6%, 13.5%, 8.4%, 13.2% and 4.3%, respectively. The estimated risks of unbalanced offspring, due to quadrivalent segregation, produced by these carriers are 49.3% and 39.4% respectively. We acknowledge the financial support given by Ministerio de Sanidad (FIS, PI05-1835) and Generalitat de Catalunya (2005 SGR-00495)
4.11-P
Balanced premature separation of sister chromatids and ICSI results F. Vialard, E. Mokaddem, I. Hammoud, D. Molina Gomes, M. Bergere, M. Bailly, R. Lombroso and J. Selva CHI Poissy St Germain Unbalanced premature separation of sister chromatids (U-PSSC) is a major cause of embryo aneuploidy linked to women age. In all the reports of preconceptionnal aneuploidy screening, balanced-PSSC (B-PSSC) are never considered as first polar body (PB1) abnormalities, but are frequently observed. Usually, they are considered as technical artefacts, linked to in-vitro aging. In this study, we retrospectively evaluated the B-PSSC incidence in polar bodies and its influence on ICSI results. Patients: 70 patients were included in a PCD program for recurrent implantation failure (RIF group, n=25), for women age up to 36 years old (AMA group, n=29) or for both indications (AMA+RIF group, n=16). Methods: First polar body was biopsied after zona pellucida laser. FISH was performed with Multivysion PB kit analysing chromosomes 13, 16, 18, 21 and 22. Retrospectively, the inter chromatid distance (ICD) was evaluated using, for each chromosome, the diameter of its specific probes signals as size unit. Results: 1514 chromosomes, from 340 polar bodies, were analyzed. ICD was correlated with women age (pG0.0001, z=9.468), and was 1.40, 1.99 and 2.32 respectively for aged less than 34 years, between 34 to 38 years, and more than 38
6th ECC: Abstracts years. According to ICD distribution and to literature, B-PSSC was considered when chromatids were separated by more than the diameter of 2 signals. BPSSC incidence was identical for normal (72%) and abnormal polar bodies (67%). The frequency of BPSSC was significantly lower (pG0.0001) in RIF group (55%) than in AMA group (81%). Furthermore, PB1 with only one chromosome affected by a B-PSSC were more frequent (p=0.0001) in RIF group (54%) than in AMA group (26%). ICSI results were not influenced by B-PSSC. Discussion: These results suggest that B-PSSC is not a criteria of oocyte bad quality since it has no incidence on ICSI results, at least until day2 development. As U-PSSC, it was correlated to women age, and might be a witness of cohesin alteration.
153 the same kit, showing non-reproducibility of the technique in about 1% of cases. When the 2 kits mapped the same locus and gave different results (11/31), the imbalance detected was considered as a false positive reflecting the sensitivity of the probe to a polymorphism. From the 48 imbalances detected by the P036 kit and confirmed by P070, 7 were not verified by FISH analysis. From the 7 FISH/MLPA and 7 P036/P070 discrepancies, 6 imbalances were detected in one parent of the patient and therefore were not considered to be phenotype related. Real time PCR was performed on the 8 discordant samples left. Aberrant copy number detected by quantitative PCR confirmed MLPA analysis against FISH findings for 6 of these patients. MLPA is a sensitive, cost-effective technique for screening which results should always be validate by another cytogenetic or molecular method.
5.1-O
Evaluation of MLPA in routine diagnostics for the detection of subtelomeric rearrangements in 1040 patients with idiopathic mental retardation Delahaye, Azzedine Aboura, Julie Rousseau, Brigitte Benzacken, Jacques Elion, Alain Verloes and Se´verine Drunat Department of genetics, Robert Debre´ University Hospital, AP-HP Previous studies show that subtelomeric rearrangements are responsible for 5 % of unexplained mental retardation (MR). We screened 1041 non selected patients with idiopathic MR for subtelomeric aberrations by a multi-step strategy consisting in 1) analysis with the P036 MLPA kit assay (MRC-Holland), 2) confirmation with the P070 kit, 3) verification by conventional FISH analysis. 79 rearrangements were detected by the P036 kit (7.6%). 48 (61%) of them were confirmed by the P070 probes panel. 30 of this confirmed rearrangements were verified by FISH analysis and 10 are still under cytogenetic investigations. Then, we focused on discrepancies between the P036 and P070 or, MLPA and FISH results. From the 31 rearrangements detected by the P036 kit, 13 could not be found again in a second experiment with
5.2-O
6q24 duplication and transient neonatal diabetes: a possible differential diagnosis with beckwithwiedemann syndrome? Andreucci, S. Toni, R. Ciccone, M. De Gregori, L. Giunti, I. Sani, S. Guarducci, M. Genuardi, O. Zuffardi and S. Giglio Medical Genetics, Department of Clinical Pathophysiology, University of Florence and AOU Meyer, Florence, Regional Centre for Juvenile Diabetes, AOU Meyer, Florence, General Biology and Medical Genetics, University of Pavia, Pavia Paternal uniparental disomy of chromosome 6 (UPD6) is an important cause of transient neonatal diabetes (TND) and macroglossia. We observed a female patient born with macroglossia who had 2 episodes of transient hyperglycaemia in the neonatal period and with a negative test result for UPD6. The patient developed asymmetry of lower limbs, with the left limb more developed than the right one, and a hyperplasia of the left kidney upon follow-up. Detailed investigation on family history (not available earlier) disclosed the presence of diabetes and an undefined rearrangement of chromosome 6 in two
6th ECC: Abstracts
154 first cousins of the proband_s father. Karyotype analysis on the proband_s lymphocytes was normal. We therefore carried out array-CGH analysis: this method revealed the presence of a 2 Mb duplication in 6q [dup(6)(q24.2q24.3)]. The same duplication was present in the unaffected father. This duplication seems to be responsible for the development of a clinical phenotype that has similarities with the Beckwith-Wiedemann syndrome (BWS). At birth, BWS children have macroglossia and TND, characterized by impaired insulin response to glucose but normal response to glucagon (Valerio et al., 2004). Duplications of chromosome 6q have been observed in some cases of TND and the duplicated region on 6q usually undergoes maternal imprinting. This could explain why the proband_s father and paternal uncle, both of whom should have inherited the duplicated chromosome from their mothers, did not manifest any symptoms of the condition. Only one other familial case has been reported in literature.
brothers - one der(10)t(10;12)(qter;pter) (parental study on-going) - one der(Y)t(X;Y)(qter;pter) de novo - one deletion 17qter, which is probably a polymorphism because it was observed only with the SALSA P036 kit and is inherited from a normal father, - five de novo deletions (1pter, 2qter, 11qter, 16pter and 22qter) and eight deletions for which parental study is either on-going or at least one of the parents is unavailable (6qter in 2 cases, 7qter, 9qter, 15q11-12,17qter, 19pter and 22qter). 34 unbalanced abnormalities (2.6%) could not been confirmed by FISH : - 24 were observed only with one of the two MLPA kits, - one deletion 6qter - nine were duplications for which FISH is often uninformative. Further analysis for these unbalances are going to be performed (parental study, QMPSF, microsatellites, Bac_s...) to determine whether they are polymorphisms, artefacts or clinically significant. In summary, the MLPA method appears to be reliable and efficient for the screening of patients with unexplained mental retardation to select those needing a complementary study of telomeres.
5.1-P
Screening for subtelomeric rearrangements with MLPA in 934 patients with unexplained mental retardation P. Kleinfinger, M. Montagnon, V. Koubi, M. Nouchy and A. Bazin Laboratoire Pasteur-Cerba MLPA (multiplex ligation-dependant probe amplification) has proven to be a reliable, fast and cheap methodology to detect unbalanced subtelomeric abnormalities occurring in 1.4% to 16% of patients with mental retardation. Since 2005, 998 patients with mental retardation have been studied in our lab. All of them had a conventional karyotype at the 400Y450 band level. Some of them had FISH for detection of the most frequent microdeletions. 64 had an abnormal karyotype (6.4%). MLPA was performed for the 934 retarded patients with normal karyotype using first the SALSA P036B human telomere kit and the SALSA P70 to confirm abnormal results. Eighteen unbalanced subtelomeric rearrangements (1.9%) were detected and confirmed by FISH: - one der(18)t(1;18)(qter;qter)mat in two
5.2-P
MLPA analysis and clinical description of 1p subtelomeric deletion V. Bica, E. Neagu, L. Barbarii, E. Tomescu, L. Sandu, C. Skrypnik, G. Motei, N. Stanemir and Y. Nanciu IOMC Prof. Dr. Alfred Rusescu, DNA Laboratory National Institute of Legal Medicine Bucharest, Genetics Department - University of Medicine Oradea The MLPA (multiplex ligation-dependent probe amplification) technique permits the detection of copy number changes of subtelomeric DNA sequences for both arms of every chromosome in a single assay. We report a 10-year-old girl with moderate psychomotor delay, overweight, small deeply set eyes, bulbous nose, small hands and feet, short neck. The G-banded karyotype of the patient was 46,XX. Further investigation with molecular analysis excluded Prader-Willi syndrome. However, subtelomere analysis, done by MLPA, revealed abnormal findings consistent with a deletion of the subtelomeric region
6th ECC: Abstracts of chromosome 1p. The breakpoints of our patient appeared to be identical with the breakpoints of the patients reported in literature. Subtelomeric rearrangements significantly contribute to idiopathic mental retardation and result in several mental retardation syndromes. Acknowledgements: CNCSIS Research Program - Romania, Institut fu¨r Klinische Genetik Olgahospital Y Germany.
5.3-P
Detection of subtelomeric chromosomal imbalances in prenatal diagnosis of fetal malformations J. Bruguera, A. Sa´nchez, C. Morales, I. Madrigal, E. Margarit, N. Clusellas, M.J. Rubio, M. Papiol, A. Borrell and A. Soler Fundacio´ Clı´nic, Servei de Bioquı´mica i Gene`tica Molecular, Hospital Clı´nic, CIBERER U-726, S, Servei Medicina Fetal, Hospital Clı´nic The chromosomal abnormalities ascertained by conventional cytogenetics contribute to the etiology of part of the fetal malformations, but a majority of them show a normal karyotype, and in a significant proportion the presence of a submicroscopic imbalance may probably explain the abnormal phenotype. The aim of this study is the diagnosis and characterization of cryptic subtelomeric chromosomal abnormalities in a series of pregnancies in which ultrasound examination discloses major fetal malformations. Since January 2006, we have collected 71 amniotic fluid samples from pregnancies in which fetuses present different phenotypic abnormalities and show a normal karyotype. The main fetal malformations are ventriculomegaly, complex cardiopathy, diaphragmatic hernia and skeletal anomalies, and/or intrauterine fetal growth retardation. MLPA (multiplex ligation-dependent probe amplification) subtelomere assay using the P036B kit (MRC-Holland) was performed on fetal DNA obtained from cultured amniocytes. Investigation revealed 11 cases that present subtelomeric imbalances. These submicroscopic chromosomal anomalies include deletions and/or duplications of chromosomes 3, 9, 13, 15, 20, 22 and X. To exclude
155 false positives we performed MLPA technique using the complementary kit P070 (MRC-Holland). This analysis confirmed 1 case (deletion of 3pter and duplication of 13qter). These imbalances will be confirmed and characterized by FISH. This investigation and future results will help us to establish the incidence of this kind of submicroscopic anomalies within the study group and a genotype-fetal phenotype correlation. Supported by the grant PI05/0096 to A.S. from Fondo de Investigaciones Sanitarias, Ministerio de Sanidad y Consumo, Spain.
5.4-P
Complex and cryptic CCR (2q) in a girl with facial and developmental abnormalities Fuster Carme, Santos Monica, Madrigal Ines, Gonza´lez-Meneses Antonio, Rodrı´guez-Criado German and Mila` Monstserrat Unitat de Biologia Cel&lular i Gene`tica Me`dica. Facultat de Medicina. Universitat Auto`noma de Barcelona. E-08193. Spain., Servei de Bioquı´mica i Gene`tica Molecular. Hospital Clı´nic de Barcelona. Spain., Unidad de Dismorfologı´a. Hospital Virgen del Rocı´o de Sevilla. Spain Complex chromosomal rearrangements (CCRs) are extremely rare and the majority of patients have been ascertained by the presence of an abnormal phenotype of fertility problems. The characterisation of the breakpoints involved in any chromosomal reorganisation, including CCRs, is necessary in order to establish a correct phenotype-genotype correlation and to identify genes implicated in specific clinical disorders. Here, we report the case of a six-year-old girl with a de novo 46,XX,der(2) karyotype, having phenotypical abnormalities. Combinations of molecular cytogenetic techniques (HR-CGH, MLPA and specially BACs) were used in order to identify the derivative chromosome since conventional banding techniques were not of sufficient resolution to delineate the exact chromosomal reorganisation. HR-CGH identified a gain involving part of the 2q arm (2q34q37.2), and MLPA showed a terminal 2q deletion that was not detected by HR-CGH. Terminal 2q deletion was later confirmed by FISH using a 2q
6th ECC: Abstracts
156 subtelomeric probe. Subsequently, the use of eight BAC clones allowed for the accurate characterisation of a complex and cryptic CCR in this patient. CCR was caused by at least 8 breakpoints located on the long arm of chromosome 2. The CCR present in our patient involved 2q37.3 partial monosomy, 2q34q36.3 and 21q37.2 partial trisomies and 2q37.1 partial hexasomy. The patient showed some of the typical clinical features associated with 2q37 deletion, mainly facial and developmental abnormalities, and no remarkable phenotypical impact related with the gain of 2q34q37.2 was noted. This report represents new evidence of the important role of molecular techniques to detect and resolve cryptic chromosomal abnormalities in order to establish accurate associations between specific chromosome regions and phenotype alterations. This work was supported by SAF 2003-03894 and FIS PI04-1126.
5.5-P
MLPA for detection of cryptic subtelomeric rearrangements in mental retardation patients-cases report C. Skrypnyk, M. Bembea, C. Jurca, V. Filip, E. Neagu, D. Iancu, A. Constantinescu, L. Barbarii and C. Rusu University of Oradea, Faculty of Medicine and Pharmacy, Genetics Department, Romania, University of Oradea, Faculty of Medicine and Pharmacy, Pediatric Unit, Romania, National Legal Medicine Institute, Genetic Unit, Molecular Laboratory, Bucharest, Romania, University of Medicine and Pharmacy, Genetic Unit, Iasi, Romania Introduction: Subtelomeric regions are gene-rich and deletion or duplication of these chromosomal regions are a significant cause of idiopathic moderate to severe mental retardation with figures varying from 5 to 10%. MLPA (multiplex ligation-dependent probe amplification) was shown to be a reliable method to screen subtelomeric chromosomal rearrangements. Objective: To evaluate the prevalence of subtelomeric rearrangements in a group of idiopathic mental retardation patients.
Material and methods: Using the consensus criteria (mental retardation or developmental delay, dysmorphic features, congenital malformation and/or familial history of mental retardation) we selected 10 patients and included them in a national project which use MLPA technique for screening the subtelomeric rearrangements. All selected patients were evaluated by clinical geneticists and standard clinical assessments were performed. All patients had a normal G banded karyotype at approximatively 500 bands. MLPA was performed using two sets of subtelomeric probes Salsa P036B and P070. Results: Among 10 patients tested two subtelomeric deletion were identified. They were deletion 1p36 and deletion 7p21, previously unidentified by conventional cytogenetic technique. One patient had a deletion 15q11.1 identified only with the P036B kit and considered as polymorphism. Discussions: The deletions are clinically relevant, the patients_ phenotype being concordant with the chromosomal deletions. Subtelomeric FISH studies will be performed to confirm the deletions. To elucidate the polymorphism on 15q11.1 MLPA will be reperformed with ME028. To establish the origin of these rearrangements MLPA studies will be performed for the parents of positive patients. Preliminary the MLPA test is helpful to find out the etiology in patients with idiopathic mental retardation.
5.6-P
Introduction of MLPA into a diagnostic cytogenetics laboratory: service evaluation and review of findings Mitchell, D. Massie, C. Clark, D. Stevenson and J. C. S. Dean Department of Medical Genetics, NHS Grampian Over the last two years multiplex ligation-dependent probe amplification (MLPA) technology has been incorporated into the NHS Grampian cytogenetics service. This high resolution PCR-based technique for the detection of genomic imbalance uses probe sets to test multiple loci simultaneously, and is now in routine diagnostic use for the detection of subtelomeric rearrangements. The SALSA P036B
6th ECC: Abstracts subtelomere kit (MRC Holland) was initially validated using 17 samples with known normal and abnormal karyotypes. This was followed by a comparative screen of 48 patient samples that had previously undergone subtelomeric FISH screening. To date, a further 35 diagnostic referrals have been screened using this assay. Of 71 successful MLPA samples, 3 patients have been identified with copy number changes (4.2%), all dysmorphic children with suspected subtelomere imbalance or microdeletion. MLPA studies indicated apparent loss of 9q material in one case, gain of Xp/Yp sequences in the second, and 18q loss with Xp/Yp gain in the third. Results of ongoing follow-up and family studies will be presented. Moving on from the success of MLPA telomere testing, a large-scale validation of the SALSA P023B DiGeorge/VCFS probe mix was performed with a view to replacing the conventional method of testing by FISH. The test confirmed all known 22q11.2 deletion cases, previously ascertained by FISH, and in addition refined a known deletion to a 1.5 Mb variant. This is not in diagnostic use at present. Although some optimisation is still required in our laboratory, MLPA is concluded to be a reliable and cost-efficient alternative to FISH for detection of subtelomeric copy number changes and submicroscopic deletions, and its high throughput is of significant value in the diagnostic cytogenetics laboratory.
5.7-P
Comparison of FISH and MLPA techniques in detection of chromosomal rearrangements S. Artan, M. H. Muslumanoglu, M. Ozdemir, B. Durak, O. Cilingir, G. Bademci, E. Tepeli, ¨ znur and N. Tekin R. Kalkan, M. O Eskisehir Osmangazi University Medical Faculty Department of Medical Genetics, Eskisehir Osmangazi University Medical Faculty Department of Pediatrics Eskisehir / Turkey The need to detect clinically significant microdeletions, cryptic rearrangements and segmental aneuploidies beyond the range of light microscopy demands the development of new cost-efficient, sensitive, and robust analytical techniques. Although
157 FISH detects these rearrangements, it is expensive and labor-intensive. Multiplex ligation-dependent probe amplification (MLPA) is a new technique for measuring sequence dosage, allowing large number of samples to be processed simultaneously and thus significantly reducing laboratory work. We have assessed its performance for the detection of subtelomeric rearrangements by comparing the results of FISH assay in three different families. Family 1: A case was referred to our clinic because of multiple congenital anomalies. The karyotype of the proband was revealed as 46,XY,10p-. Monosomy 10p and trisomy 10q were diagnosed by both of the techniques (FISH and MLPA). This unbalanced karyotype was from pat inv(10) diagnosed by FISH. Family 2: Normal chromosome constitutions were seen in two cousins with severe mental retardation and multiple congenital anomalies. Loss of chromosome 5p subtelomeric region and trisomy of subtelomeric 20p were diagnosed by both of the techniques. The unbalanced karyotypes were originated from mat(5p;20p). The breakpoint on chromosome 5 was distal to cri du chat critical region. Family 3: Two sibs were referred to our clinic because of severe mental retardation and agitation. Their karyotypes were normal but FISH and MLPA analyses showed subtelomeric 22q region deletion and subtelomeric 6q trisomy in both sibs. Mother has a normal karyotype whereas t(6;22),+6q was revealed in father with normal phenotype. The extra subtelomeric 6q material was diagnosed by repeatedFISH analysis but no duplication was revealed by MLPA assay. Conclusion: Concordance between MLPA and FISH results showed that MLPA can be considered a quick, sensitive, cost-effective, and easy method to screen for subtelomeric rearrangements, but still further studies are necessary for dose imbalances because no FISH-detected trisomy 6q could be diagnosed by MLPA assay.
5.8-P
Screerining subtelomeric rearrangements with MLPA Kuskucu, M. Kuskucu, S. Yilmaz, S. Hacihanefioglu and A. Yu¨ksel
6th ECC: Abstracts
158 Cerrahpasa School of Medicine, Department of Medical Biology, Genomed LTD, Cerrahpasa School of Medicine, Department of Medical Genetics Determination of gene dosage has many implications in genetic studies. Numerous methods are available for detecting deletions of a few base pairs or very large deletions, but difficulties arise in detecting deletions of a few kilobases. Multiplex ligation-dependent probe amplification (MLPA) is a new technique for measuring sequence dosage, allowing large number of samples to be processed simultaneously and thus significantly reducing laboratory work. In the past few years, this method is used for screening subtelomeric rearrangements of mental retardation cases.The cause of MR in up to 50% of patients remains unexplained. Cryptic rearrangements involving the subtelomeric regions of chromosomes have emerged as an important cause of MR. Subtelomeric rearrangements are not visible by conventional cytogenetic analysis, and they are belived to be responsible for 5Y7% of idiopathic mental retardations. Because of standardization, results of MLPA tests are not reproducible in high accuracy. The most important problem is DNA amount. For standardization of MLPA and screening of subtelomeric deletion we used RealTime PCR quantitation of DNA sample and MLPA mix p070. In this study we tested 20 patients with idiopathic MR, dysmorphic fatures, and/or familial history, who showed a normal karyotype and 4 control DNA samples. We found subtelomeric deletions in three patients, 5p, 18q and 4p respectively. We conclude that combination of quantification of DNA with RealTime-PCR is very useful method for standardization of MLPA results. We could collect accurate and reproducible results. This combination would be cost effective, useful, robust and accurate tool for screening of subtelomeric deletions in large number of samples for decision of FISH.
Hospital Virgen del Camino A 29 year-old woman carrying a twin-pregnancy was referred to our Genetics Department at 8th week of gestation for prenatal counselling, given her partner_s family history of mental retardation. He had two brothers and five sisters, three of whom Yone male and two females- showed moderate mental disabilities. He also referred other family members on his father_s side with developmental delay and/or nonspecific behavioural problems. The family came from a small and highly inbred town. Conventional karyotype and molecular analysis for Fragile-X syndrome, performed on one affected male, were normal, and therefore, fetal risk was initially estimated on the basis of an autosomal recessive disorder. However, given the highly remarkable family history for mental disabilities, subtelomeric screening using MLPA (SALSA PO70 and PO36) was subsequently carried out. A 20qtel duplication was detected and FISH analysis demonstrated an unbalanced subtelomeric translocation between chromosomes 14 and 20: ish der(14)t(14;20)(qterj;qter+). Karyotype and FISH studies of the patient_s partner for this subtelomeric regions (ToTelVysion Vial 7 and 15), showed a t(14;20) balanced translocation. After informing the couple, an amniocentesis was performed. FISH studies of the subtelomeric regions 14q/20q on uncultured amniocytes showed a normal dosage for both regions. Karyotypes on cultured amniocytes were normal (46, XX) and the hybridization on the metaphase spread, showed that neither of them had inherited the familial subtelomeric translocation: 46,XX, ish(14qtel,20qtel)X2. Further investigations of the family showed that the unbalanced translocation was also present in the mentally disabled sisters. Conclusion: in a pregnancy at risk for a known subtelomeric rearrangement, FISH on uncultured amniocytes can be successfully used for a fast and accurate diagnosis.
5.9-P
FISH analysis on uncultured amniocytes in a pregnancy at risk for a subtelomeric rearrangement Pe´rez-Juana, M. Artigas-Lo´pez, S. Moreno Laguna, A. Valiente Martin, A. Alonso Sanchez and M. A. Ramos-Arroyo
5.10-P
A new microdeletion syndrome within the 22q11.2 region Moncla Anne, Missirian Chantal, Cosse Carole and Philip Nicole
6th ECC: Abstracts Departement de Genetique Medicale, Service d_Ocologie Pediatrique Few cases of 22q11.23 deletions, distal to the 3 Mb VCFS/DGS critical region have been reported. Beside the presence of CHD in some patients, the clinical presentation is different from the well-known VCFS/ DGS phenotype. Notably, one case harbouring a deletion extending distally and including the SMARCB1 developed an rhabdoid tumour. We report two new patients presenting rhabdoid tumours. Patient 1 was diagnosed at birth with a severe CHD (double outlet right ventricle with transposition of great arteries) and underwent cardiac surgery at 5 months of age. He was noted to be hypotonic with delayed motor skills. At 14 months, an intracranial tumour of the left ventricle was diagnosed. The histology showed a malignant tumour with features of atypical teratoid/rhabdoid tumour. Patient 2 was investigated at 4 years of age for developmental delay. He subsequently developed a rhabdoid tumour of the kidney stage III at age 7. On examination, both patients had subtle facial changes. Patient 1 had a cytogenetically visible inversion of chromosome 22. FISH studies using 16 markers, demonstrated inversion of genes proximal to 22q11.23, associated with a distal 0.9Y1.8 Mb deletion encompassing BCR locus. Patient 2 had a pure 3Mb deletion extending from proximal clone RP11-379N11 and distal RP11-20P18 suggesting that the recombination event occurred between LCRs 4 and 7. We compared the phenotype of our patients with the other patients with atypical deletions reported in the literature. Since it is known that the 22q11.2 region contains several LCR, different recombination events between these loci can give rise to distinct and non-overlapping deletions. Patients with a distal 22q11.2 deletion must not be considered as VCFS variants and require different clinical assessment and follow-up. T The status of the SMARCB1 locus, since patients hemizygous for this locus are at risk of developing rhabdoid tumors.
159
Moncla Anne, Missirian Chantal, Bottani Armand, B. Chabrol, Lambert Jean Claude, Villard Laurent and Philip Nicole Departement de Genetique Medicale, Service de Genetique Geneve, Service de Neurope´diatrie, Hopital Timone Enfants Marseille, Service de Genetique Me´dicale, Nice, Unite de Recherche INSERM, 491, Faculte´ de Me´decine de Marseillle We have identified four patients with a distinctive phenotype combining mental retardation, microcephaly, atypical autism behavioural phenotype with over breathing, hypoplasia of corpus callosum and similar facial dysmorphism with macrostomia, myopia and clubbing and tapering fingers. Two patients have an interstitial deletion of chromosome 18, del(18) (q21.2q22.1). These patients have a phenotype that is very similar to the phenotype of the patient reported by Pitt and Hopskins [1978] with mental retardation, wide mouth and intermittent over breathing and the patient described as affected by an atypical form of Rett syndrome and a similar deletion reported by Gustavsson and al [1999]. The clinical phenotype of this condition overlaps with other well defined entities such as Rett and Angelman syndromes. All patients are sporadic cases, suggesting a contiguous gene syndrome or a dominant single gene disorder located at 18q21.2q22.1.
6.1-O
EQA in Europe
5.11-P
B. Quellhorst-Pawley, Rod Howell, Oliver Bartsch, Nicole Dastugue, Martine Doco-Fenzy, Brigitte Faas, Giovanna Floridia, Karsten Held, Carmen Ramos, Marta Rodriguez de Alba, Kalle Simola, Francisco Sole-Ristol, Domenica Taruscio, Joris Vermeesch and Ros Hastings
Delineation of a new syndromic form of autism reminiscent of Pitt-Hopkins syndrome and identification of a locus at 18q21.2-q22.1
Oxford Radcliffe Hospital NHS Trust, Universitaet Mainz, Hopital Purpan, CHU Reims, University Medical Centre, Instituto Superiore di Sanita, Fertility Centre, Fundacion Jimenez Diaz, Tampere University Hospital, Hospital del Mar, Instituto
6th ECC: Abstracts
160 Superiore di Sanita, Katholic University Leuven, Oxford Radcliffe Hospital NHS Trust Cytogenetic EQA schemes are currently available in seven European Countries: Finland, France, Germany, Italy, The Netherlands, Spain and the UK. The Czech Republic is in the process of setting up a Haematological scheme. Most National schemes offer constitutional pre- and postnatal in addition to haematological EQA - except for Finland, where only constitutional EQA is available. EQA schemes vary in scope, offering between two and ten different diseases/tissues. However, less than half of the cytogenetic laboratories in Europe currently take part in EQA As part of Eurogentest Network of Excellence, a Forum of the Cytogenetic Scheme Organisers in Europe was formed in 2005 to work towards harmonisation and accreditation of Cytogenetic EQA schemes throughout Europe - currently only the UK scheme is accredited. A Cytogenetic European Quality Assessment Scheme (CEQA) was devised in the same year to compliment and support the existing National schemes and to offer EQA where no National schemes were available. In 2006 the Forum agreed a generic EQA format and marking criteria and CEQA ran its first web based pilot EQA. Participation was by invitation only with 19 laboratories from 18 countries submitting results. Seven laboratories took part in EQA for the first time. Report submissions could be made in seven languages and were assessed by members of the Eurogentest Forum of EQA Organisers. The pilot involved Amniotic Fluid and Blood EQA and did identify some poor performance. Phase one of CEQA was successful and well received, generating a wide interest amongst European laboratories. A second pilot is planned for the autumn of 2007. This pilot will offer the same EQAs but will expand its participation to an estimated 50 laboratories. After the second pilot, the scheme will be open to all laboratories and will, in time, expand the number of EQAs available.
6.1-P
An integrated approach to the production of complete computerised audit trails in the cytogenetics laboratory
E. R. Levy, C. Dixon and E. J. Maher South East Scotland Cytogenetics Service Compliance with accreditation bodies and good laboratory practice requires the ability to reproduce audit trail information on all samples processed and reported. The scope of information required to do this is wide and includes such items as original referral cards, protocols for processing the sample, reagents, materials and equipment used, temperature charts, analysis sheets and reports. Whilst laboratories accredited to CPA (UK) Ltd standards are required to produce this information the process relies on gathering the information from various different sources, which are currently held in paper records. This is often laborious, and requires laboratory staff to be recording high levels of information as part of sample processing. We describe a novel solution to this problem by forming a laboratory audit trail based on electronically held Standard Operating Procedures (SOPs). These SOPs contain details of reagents, materials and equipment used, for which records are held electronically. This approach allows a complete audit trail of any particular sample to be generated automatically by the click of a single button. As a result of the implementation of sophisticated batch control procedures quality management tasks are performed more efficiently. Laboratory staff are relieved of the duty of recording audit trail information for individual samples and thus more able to complete laboratory tasks effectively. A typical audit trail per sample can be generated in less than a minute. A typical report is up to 25 pages long and encompasses all scanned documentation, digital karyotype images, temperature records and equipment maintenance records.
6.2-P
Correlation among results of frequently applied cytogenetic tests S. Haveric, S. Ibrulj, A. Haveric and A. Rahmanovic Institute for Genetic Engineering and Biotechnology, School of Medicine, University of Sarajevo, Cekalusa 90, 71 000 Sarajevo, Bosnia and Herzegovina, Institute for Genetic Engineering
6th ECC: Abstracts and Biotechnology, Kemalbegova 10, 71 000 Sarajevo, Bosnia and Herzegovina Cytogenetic tests on human lymphocyte cultures are frequently applied for testing genotoxicity of chemical agents. They are often used as complement or substitute to each other. Aim of this study was to evaluate the correlation of chromosome aberration analysis, the micronucleus test and the sister chromatid exchange assay. Peripheral blood was cultivated 72 hours for the micronucleus cytokinesis-block assay and the sister chromatid exchange assay and 48 and 72 hours for chromosome aberration analysis. The test substance Oxazepam was added to the cultures at the beginning of the cultivation period. The Pearson correlation coefficient was applied to determine correlation among the results of the different cytogenetic tests. Statistically significant positive correlation was found for the frequencies of chromosome aberrations and binuclear cells with micronuclei.
161 the chromosome abnormality and is a major improvement on conventional distribution of slides or images where the inclusion of additional test material inevitably reveals the answer. Reports are made on line by the laboratory, allowing for verification by senior staff prior to final submission. For the European EQA, CEQA, submissions can be made in several languages. Assessments also take place on line, with assessors having Bread only^ access to the submissions as well as the ability to draft the Individual Laboratory Reports (ILR) on line. This overcomes geographic limitations and improves the turn around time of an EQA. Since 2005, five pilot online EQAs have been run by UK NEQAS and CEQA, involving eight cases. These were followed by a further seven EQAs involving 14 cases in constitutional and oncology cytogenetics. A total of 85 laboratories from 28 countries across the world have participated in the online EQA. 15 laboratories have had a single poor performance in the seven online EQAs and five laboratories from the CEQA pilot.
6.3-P
External quality assessment via the internet R. J. Hastings, Bettina Quellhorst-Pawley and Rod Howell Oxford Radcliffe Hospitals NHS Trust With more than 700 diagnostic laboratories offering cytogenetic tests there is a growing need for EQA in Europe. As laboratories become more aware of the need to become accredited, access to EQA schemes becomes critical. An on line EQA, including a scheme management system, has been developed through the Eurogentest Network of Excellence and piloted by UK NEQAS for Clinical Cytogenetics (an accredited EQA scheme) and the new European EQA scheme, CEQA (Cytogenetic European Quality Assessment). The online EQA mimics the diagnostic situation in a laboratory. Images are provided for analysis; these can be evaluated online or downloaded to an image analysis system. This system overcomes some of the limitations of other forms of EQA as it allows the participant to choose appropriate follow-up tests (for example, FISH) to elucidate
6.4-P
Expression variability in sexual chromosomal mosaicisms C. Pe´rez, R. Miro´ and A. Plaja Departament de Citogene´tica. Centre Inmunolo`gic de Catalunya, Departament de Biologia Cellular, Fisiologia i Immnunologia. Facultat de Medicina. Universitat auto`noma de Barcelona., Unitat de Gene`tica. Hospital Materno-Infantil de la Vall d_Hebron
Chromosomal mosaicism occurs when different cells within an individual, who has developed from a single fertilized egg, have a different chromosomal makeup. Generally, chromosomal mosaicism involves an aneuploid cell line with a normal cell line. X and Y are the chromosomes more frequently involved in chromosomal mosaicism. The clinical outcome of a fetus with a prenatal diagnosis of chromosomal mosaicism is strongly dependent on the specific chromosome involved and the number of aneuploid cells in both the placenta and the fetus.
6th ECC: Abstracts
162 However, the true level and distribution of aneuploid cells in all tissues cannot be accurately assessed with any current prenatal procedure. In the present study we have evaluated nine patients and reviewed five cases reported in the literature with sexual chromosomal mosaicism in several tissues. Samples analyzed included cultured/uncultured amniotic fluid, cultured/uncultured peripheral blood and buccal smear. Laboratory techniques included G-banded conventional cytogenetic studies, Fluorescence in situ Hybridization (FISH) and Quantitative FluorescentPolymerase Chain Reaction (QF-PCR). We have found an extreme variability in the distribution of mosaicism depending of the tissues analyzed and the techniques performed. Some patients with no evidence of mosaicism in cultured tissues showed mosaicism in uncultured tissues and vice versa. Clinical features were also extreme variable. Conclusions: Our data demonstrate the need of including several tissues of different embryologic origin to achieve a more realistic evaluation of the complexity of chromosomal mosaicism. Using both, conventional and molecular cytogenetic techniques, increases the number of chromosomal mosaics detected. Careful evaluation of all results is needed, since they are frequently discordant due to differences in the type of cells analysed and sample size. Blood sample based studies may not reflect the real incidence of mosaicism in relevant tissues, such us nervous tissue. Buccal smear FISH studies results may be more appropriate.
reporting any patient results. In the process of getting ISO 15189 accreditation, we performed validation of qualitative interphase FISH for clinical evaluation of hematologic disorders. FISH assays using 30 DNA probes, intended to detect fusion genes, translocations with variant partners, gene amplification and deletions were validated in our laboratory. The validation consisted of: 1. familiarization with the probe characteristics, 2. assessment of the analytical specificity (percentage of signals at the expected target locus), 3. determination of the analytical sensitivity (percentage of metaphases and interphase nuclei with the expected normal signal pattern among cells that meet any of the expected signal patterns in normal subjects), 4. establishment of normal cut-off for different levels of cells counted (statistical analysis based on the greatest number of false positive cells in normal specimens using a binominal distribution), 5. estimation of inter-observer variation and 6. setting up standard operating procedure for each assay. According to the data, the specificity of all probes reached the value of 99%. No cross-hybridization was observed in any assay. In 50% of the probes the sensitivity was identical or higher than that provided by the manufacturer whereas in the other 50% it was slightly lower. All but one of the probes reached the threshold of 95% sensitivity, required for clinical FISH assays in hematologic disorders, including detection of residual disease. The normal cut-off for 100 and 200 cells to be scored ranged from 2 to 12% (average 6%) and 1Y11% (average 4%) respectively.
6.5-P
Validation of interphase fluorescence in situ hybridization (FISH) testing in hematologic disorders Iakovaki, E. Gourgouveli, D. Pantou and G. Bardi
6.6-P
A strategy to avoid maternal contamination as a major cause of diagnostic errors in prenatal diagnosis of aneuploidy
BioAnalytica-GenoType S.A.
Miny, N. Bu¨rki, N. Bo¨sch, M. Plasilova, S. Tercanli and K. Heinimann
FISH is considered as an important adjunct to karyotypic and molecular analysis in the evaluation of chromosome aberrations associated with hematologic disorders. The majority of DNA probes, however, are not for in vitro diagnostic use. According to the International Standards for Quality Assurance, validation of any assay is required before
Division of Medical Genetics, Women_s Hospital, Kantonsspital Liestal, University Women_s Hospital, Basel The contamination of chorionic villi or amniotic fluid cell cultures with maternal cells is a rare but persisting major cause of diagnostic errors in prenatal diagnosis.
6th ECC: Abstracts Microsatellite comparison is a fast and reliable measure of prevention and routinely applied in prenatal genetic testing of monogenic conditions. The use of this safeguard in cytogenetic testing is inconsistent. We have defined formal criteria to identify cases believed to be at increased risk for maternal cell contamination (MCC) and consequently prompted microsatellite testing in routine prenatal chromosome analyses from chorionic villi and amniotic fluid cells for all samples with a 46,XX chromosome count. The criteria include the inability to completely remove all mucus and material of undetermined origin from definitely identified villi according to the subjective jugdement of experienced operators during examination under a dissection microcope. For amniotic fluid samples gross blood contamination or inclusion of tissue fragments as well as coagula were considered critical. In addition cases with a yield of less than 10 colonies from a single culture or significantly prolonged (+3 SD) culture time were subject to microsatellite testing. Presently 96 microsatellite comparisons were performed among close to 2500 consecutive cases (approximately 79/ 1500 chorionic villi and 17/1000 amniotic fluid samples). A significant maternal contamination was diagnosed in one culture from chorionic villi meeting the criteria outlined above. In three further cases having a very small sample size in common the morphological confirmation of villous material was not possible but a culture was set up following special requests by the clinicians. A maternal origin of the cultured cells was confirmed in all cases. The individual diagnostic implications as well as general cost benefit considerations will be presented in detail.
7.1-O
Combination of different genomic approaches to define a candidate deleted gene in AML ´ lvarez, J. Suela, C. Largo, B. Ferreira, S. A M. Robledo, A. Gonza´lez-Neira, M. J. Calasanz and J. C. Cigudosa CNIO, Universidad de Navarra Introduction: Acute myeloid leukemia patients with complex karyotype are characterized by presenting more than three cytogenetic aberrations and an
163 adverse outcome. Recently, array-CGH studies over this population showed discrete losses at chromosome 17, including TP53 and NF1 genes. Material & Methods: Among a series of 120 de novo AML, we have conducted DNA profiling analysis using a high density oligonucleotide-based arrayCGH. Cases with deletions in chromosome 17 were selected for the study. We used FISH probes to measure copy number status in TP53 and NF1 genes. We analyzed selected cases with the Illumina Infinum 300 k SNP plattform looking for regions of loss of heterozygosity (LOH). Finally, we sequenced those cases for the exons 4Y9 of the TP53 gene. Results: After array-CGH screening of 120 AML, we detected 7 cases that showed DNA copy number aberrations involving chromosome 17. Aberrations in chromosome 17 were cryptic deletions affecting the regions 17p13.1 (including TP53 gene) or 17q11.2 (including NF1 gene). We observed that all our seven samples displayed losses involving NF1. Only two of them showed concomitant loss of TP53. FISH confirmed arrayCGH data. After conducting LOH analysis using array-SNP, only one case showed LOH affecting the TP53 genomic region. Mutation analysis showed two harboured mutations: one case had lost the wild type allele of TP53 and the other was heterozygous for the mutation. Discussion: We confirmed the existence of recurrent cryptic deletions in the area of 17q11.2, targeting the gene NF1. The minimum deleted region in 17q11 covered 1.5 Mb. Only one case with deletion or UPiD in TP53 showed mutations in the gene, suggesting that TP53 may not be the principal target in de novo AML. Therefore, we think our genetic data support the proposed role of NF1 as the main target in rearrangements of chromosome 17 in de novo AML, based up on previous reports, which set NF1 as a leukemogenic agent when mutated or haploinsufficient.
7.2-O
Multiple novel genes are deregulated by IGH@ in B cell precursor acute lymphoblastic leukaemia including five members of the CEBP gene family L. J. Russell, T. Akasaka, T. Balasas, R. Siebert, M. J. S. Dyer and C. J. Harrison
6th ECC: Abstracts
164 University of Southampton, University of Leicester, University Hospital Schleswig-Holstein Chromosomal translocations lead to oncogene activation in a significant number of haematological malignancies. Those involving the immunoglobulin heavy chain locus, IGH@, at chromosome band 14q32 are frequently observed in B cell malignant proliferation. A small number have been described in B-cell precursor acute lymphoblastic leukaemia (BCP-ALL). However, their biological and clinical significance is currently unknown. Detailed fluorescence in situ hybridisation (FISH) and molecular studies were carried out on a series of BCP-ALL patients with chromosomal abnormalities involving 14q32. Novel and recurrent translocations affecting different chromosomes were highlighted. Refined FISH mapping identified putative IGH@ partner genes at, or flanking, the translocation breakpoints involving chromosomes 6, 7, 8, 10, 11, 14, 17, 19, and 20. Four translocations: two previously reported, t(14;19)(q32;q13), t(8;14)(q11;q32), and two novel, t(14;14)(q11;q32)/inv(14)(q11q32) and t(14;20)(q32;q13), were identified. Molecular analyses showed that these translocations involved four different members of the CAATT enhancer binding protein (CEBP) gene family: CEBPA (19q13, n=9), CEBPD (8q11, n=8), CEBPE (14q11, n=3) and CEBPB (20q13, n=2). One patient with a t(14;19) (q32;q13) was observed to involve the fifth family member CEBPG (19q13, n=1). Breakpoints were located within the 3¶ untranslated region (UTR) of CEBPA and either 3¶ UTR or 5¶ of CEBPE, whereas breakpoints in 8q11 were õ30 kb centromeric of CEBPD. Where material was available, over-expression of target genes was shown by quantitative real-time PCR. Overall, this study has demonstrated that IGH@ has multiple partners in BCP-ALL. It has indicated for the first time that transcriptional upregulation of CEBP gene family members, by juxtaposition to IGH@, is important in BCP-ALL: a mechanism in complete contrast to that involving CEPBA in acute myeloid leukaemia.
Karen L. Howarth, Katherine A. Blood, Juliet C. Beavis, YiiLeng Chua, BeeLing Ng and Paul A. W. Edwards University of Cambridge, Sanger Institute We know very little about the many chromosome translocations in the common epithelial cancers. There has been a tendency to dimiss them as merely resulting in loss of tumour suppressor genes. However, some of them could create fusion genes as seen in leukaemias and sarcomas: there is no hard evidence against this (Mitelman et al. Nat Genet 2004;36:331), and we have described recurrent translocations breaking in NRG1 in 6% breast cancers (Huang HE et al. Cancer Res 2004;64:6840) and Tomlins et al. (Science 2005;310:644) found rearrangements that fuse ETS family genes in most prostate cancers. We have now analysed all the chromosome translocation breakpoints in three breast cancer cell lines, HCC1187, HCC1806, and ZR-7530, using array painting, i.e. hybridizing flow-sorted chromosomes to DNA microarrays. All breakpoints were mapped to 1 Mb resolution, then selected breakpoints were mapped to 2 kb resolution using custom oligonucleotide arrays. The breakpoints selected were mainly in reciprocal/balanced translocations, which may be more likely to carry gene fusions than unbalanced rearangements. We found that there were many more balanced translocations than we expected: a total of 8 reciprocal translocations and a further 5 translocations balanced for at least one chromosome. SKY analysis had detected only five reciprocal translocationsVthe additional ones involved fragments too small to see by SKY, or were obscured by additional rearrangement. Furthermore, many of the balanced breakpoints when mapped to õ2 kb were in genes that could be targets of oncogenic translocation, including for example p300. Two selected translocations were shown to result in fusion transcripts. These results strongly support the view that common epithelial cancers have chromosome rearrangements that create gene fusions.
7.3-O
Array painting shows a number of balanced translocations that target cancer-relevant genes in breast cancer cell lines
7.4-O
MLPA analysis of neuroblastoma tumours
6th ECC: Abstracts
Andrea Elliott, Angela Baker, Julian Board, Deb Tweddle, Andy Curtis and Nick Bown Institute of Human Genetics, Northern Institute for Cancer Research Genomic copy number abnormalities (CNAs) in neuroblastoma tumours are biologically and clinically significant. In particular, amplification of MYCN is used to stratify treatment intensity, while other regions (including 1p, 17q, 11q) are of research interest. These CNAs can be detected by interphase FISH (time-consuming and occasionally hard to interpret) or CGH (time-consuming and expensive). MLPA (multiplex ligationdependent probe amplification) allows for CNAs to be assessed at multiple loci after a single PCR reaction. We used the MRC-Holland kit P161/162 to investigate DNAs from 54 primary neuroblastoma tumours, and compared the results to iFISH. PCR products were separated by capillary electrophoresis (ABI3130) and results analysed by Genemarker software. For MYCN amplification, FISH vs MLPA could be compared in all 54 tumours: there was 100% concordance between the two techniques (15 amplified, 39 not). 1p36 FISH data was available in 41 cases; 10 showed deletion, 8 showed Fimbalance_ with relative loss of 1p36, 23 showed no loss. MLPA correctly identified 16/18 cases of 1p loss but could not distinguish between deletion and imbalance. Two discrepant cases (1p deletion by FISH, normal result by MLPA) could not be resolved. In 12 cases, 1p status was unclear by FISH but readily classifiable from MLPA results. For 17q, unambiguous FISH results were available for only 23/ 54 tumours by FISH analysis but in 53/54 tumours by MLPA. MLPA could readily distinguish between gain of whole chromosome 17, unbalanced gain of 17q and balanced (normal) 17 status. The MLPA kits also allow for detection of deletions of 3p, 9p and 11q: these were identified in 8, 5 and 14 cases respectively. In addition to providing clear results in a higher proportion of cases, analysis by MLPA allowed for striking reductions in both analysis time and cost-per-test compared to FISH.
165
7.1-P
Fluorescence in situ hybridization study of TEL/AML1 fusion and co-existence of multiple subclones at diagnosis of acute lymphoblastic leukemia in Greek paediatric patients A. Divane, M. Baka, D. Bouhoutsou, A. Pourtsidis, M. Varvoutsi, D. Doganis, K. Koronioti, S. Velaeti and H. Kosmidis Locus Medicus, Diagnostic Centre, Oncology, Aglaia Kyriakou Children Hospital The TEL/AML1 fusion is the most common genetic abnormality being detected in about 25% of cases in childhood acute lymphoblastic leukemia (ALL). Moreover, the presence of subclones may have a crucial role in the evolution of ALL and their association with the different stages of the disease will make them reliable markers for optimum disease management. We carried out FISH studies on bone marrow cells from 22 consecutive paediatric patients with ALL during 1 year from a single Oncology unit for the presence of the TEL/AML1 fusion gene by using a dual color DNA probe specific for the AML1 and TEL genes. The frequency of TEL/AML1 fusion was 23% in our sample. Five patients were positive for the TEL/AML1 fusion at diagnosis. Three of them had more than one subclones. One patient had a triple TEL/AML1 fusion. Double TEL/AML1 fusion, lack of TEL signal, extra AML1 signals were additional FISH abnormalities. The explanation for these additional FISH findings is a) a duplication of chromosomal complement, b) a deletion of 12 p arm and c) polysomies of chromosome 21. We also found one patient (4,5%) with specific amplification of AML1 gene. We conclude that the presence of subclones in patients with TEL/AML1+ suggest extensive clonal evolution by the time of diagnosis. Utilizing FISH to distinguish subclones of TEL/ AML1 fusion could prove to have important prognostic implications. Further evaluation of the significance regarding the presence of multiple TEL/ AML1 fusions should be performed through longterm follow up studies.
6th ECC: Abstracts
166
7.2-P
Combination of morphology and FISH analysis in voided urine samples for increased sensitivity of bladder cancer detection in cytologic-negative specimens M. Daniely, R. Rona, T. Kaplan, S. Olsfanger, L. Elboim, A. Friberger, D. Kidron, S. Lew and I. Leibovitch BioView Ltd, Cytology Unit, Pathology Department, Sapir Medical Center, Meir Hospital, Kfar-Saba, Israel, BioView Ltd, BioView Ltd, Pathology Department, Sapir Medical Center, Meir Hospital, Kfar-Saba, Israel, Urology Department, Sapir Medical Center, Meir Hospital, Kfar-Saba, Israel Transitional Cell Carcinoma (TCC) of the bladder is a common malignancy with 50%Y75% recurrence rate. Detection and monitoring of TCC is done by cystoscopy. Urine cytology performed in adjunct to cystoscopy suffers from low sensitivity. Bladder tumor initiation and progression are accompanied by chromosomal instability, detectable by FISH. In the present study, we evaluated a combined analysis approach that involves cytological and FISH analysis for detecting cancer cells in voided urine samples. For this purpose, we utilized an automated scanning station (Duet, BioView Ltd, Rehovot, Israel). 132 patients suspected for having TCC and with a negative urine cytology result, were tested. Portions from the same samples were evaluated by combined analysis of morphology and FISH. Samples were stained in Giemsa and scanned automatically for atypical or suspicious cells. Then, the slides were destained and hybridized with the UroVysion probe (Vysis, Downers Grove, Il). The system re-located the target cells found in the morphology scan and analyzed them for genetic abnormalities. A case was regarded positive when at least one cell, abnormal in both aspects: morphology and FISH, was found. Patients were evaluated concomitantly by cytoscopy and biopsy if indicated. Overall, 51 samples were positive by combined analysis. Out of these, 10 were concurrently confirmed by biopsy. 12 more samples were found to be anticipative-positive in a follow-up of up to one year. The rest of the 29 positive patients
are still being followed-up by periodic cystoscopies. All 81 negative samples were negative by concurrent cystoscopy and remained negative for a period of up to 2 years. Our results show that the combination of cytology and FISH for the presence of TCC cells in voided urine samples is a powerful tool providing 100% sensitivity. This test may offer a new scheme for bladder cancer management: patients with negative combined analysis results may skip cystoscopy while patients with positive results should be followed-up carefully.
7.3-P
Non-invasive bladder cancer detection by M-FISH on urine samples: Slovenian experience N. Kokalj Vokac, T. Hajdinjak, A. Zagorac, A. Erjavec Skerget, R. Kavalar and K. Kisner Teaching Hospital Maribor Bladder cancer is the fifth most common cancer in adults. Because of the high recurrence rate (up to 70%) non invasive tumor markers are necessary for patient monitoring. In this study we investigate the value of M-FISH on cells of voided urine for detection the bladder cancer. Urine samples from 153 patients suspicious for bladder cancer were analyzed in the study. Cells were isolated from urine before cytoscopy or biopsy histological examination. Commercial kit (UroVysion) containing hybridization probes for chromosome 3, 7, 17 and 9p21 was used. At least 25 morphologically abnormal cells or all present cells on the slides were analyzed. FISH result was obtained in 123 cases. Overall sensitivity was 75% and specificity was 96,2%. 5 cases were false positive and 5 cases were false negative. Results were correlated to biopsy histological examination. Distribution of FISH positive cases after histopathological classification correspond to: 7 low grade and 13 high grade tumors. Positive FISH results correlate to tumor stage: 6 Ta, 4T1, 6 T2 and 4T3. In 5 false negative cases, 3 of them were TaG1, 1 TaG2 and 1 TaG3. The sensitivity and specificity of our FISH results is quite high compared to the literature because of different criteria in interpretation of interphase FISH results in different
6th ECC: Abstracts laboratories. To our opinion the important issue is, cases with low number of available cells from voided urine sample should be interpreted with caution. Evaluation of positive cells which do not rich the criteria for the FISH positive result should be taken into account as borderline cases, minimizing the false negative result and increasing the sensitivity of the test. The very important factor is also interpretation of interphase FISH on the morphologically abnormal cells, which must be done by experienced observer.
7.4-P
Investigation of TEL/AML1 and BCR/ ABL fusion genes in patients affected by acute lymphoblastic leukaemia using cytogenetic method and interphase in situ hybridization S. Rahmani, P. Mehdipour, A. Aghazadeh and H. Dolatkhah Tabriz University of Medical Sciences, Tehran University of Medical Sciences A total of sixty patients affected with acute lymphoblastic leukaemia (ALL), including thirty children and thirty adults were studied by the conventional cytogenetics and fluorescence in situ hybridization (FISH) techniques. The TEL, AML1, ABL, and BCR probes were applied on interphase cells prepared from bone marrow samples. The signal distribution and the presence of the fused genes, together with the clinical features were statistically analysed. The age ranged from 16 to 42 years (mean 23T7.3) in adults and 2 to 15 years (mean 6.9T3.9) in children. In children 46% had an abnormal FISH pattern, including 23% having fused ABL/AML1, 3% and 7% with deletion and gain in TEL gene respectively; 3% and 10% having deletion and gain in AML1 gene, respectively. In adults, out of eight (27%) patients had abnormal FISH pattern, of those only 3% presented the fused TEL/AML1 gene, and the distribution of signal patterns was the same as found in children. A direct correlation were also found between the presence of fused TEL/AML1 genes and decreased WBC (PG0.05), however this was not significant in adults. The adults with more than 50000 WBC had a significantly lower survival period
167 (PG0.05). Our results indicate that the combination of conventional karyotyping and molecular cytogenetics (FISH), and a long time follow up study could provide clinicians useful information leading more effective therapeutic management for the ALL patients.
7.5-P
Random aneuploidy in lymphoma at different disease stages A. Amiel, L. Goldberg-Bittman, M. Yukla and M. Fejgin MEIR Medical Center The aneuploidy-cancer theory proposes that cancer is caused by an abnormal dosage of thousands of normal genes. This abnormal dosage of genes is generated by the gain or loss of specific chromosomes or segments of chromosomes, also known as aneuploidy. According to this theory, carcinogenesis is initiated by random aneuploidy, which can either be induced by carcinogenesis or may arise spontaneously. The aim of this study was to establish the rate of random aneuploidy in different stages of lymphoma : Diagnosis, treatment, remission and relapse. Methods: Random aneuploidy was assessed by FISH technique with a satellite probes for chromosome 9 (orange) and for chromosome 18 (green). Individuals in matched ages served as controls. The aneuploidy rate was determined by the number of FISH signals: 1 signal (monosomy), 2 signals (disomy) 3 signals and more (trisomy and more). A cell was considered triploid when 3 signals for both chromosomes 9 (orange) and 18 (green) were seen. Results: Random aneuploidy (including triploidy) was higher in all stages of lymphoma disease compared to control group pG0.001. In the different study groups there was significant difference in the triploidy rate between diagnosis (higher rate) versus treatment, diagnosis (higher rate) versus remission and remission (higher rate) versus treatment, pG0.05. Conclusion: Triploidy clones appear during the establishment of the disease (diagnosis) and to diminish during treatment and remission, in contrast
6th ECC: Abstracts
168 to the other random aneuploidy parameters, that remained high during all stages of the disease.
7.7-P
Post - HSCT follow up using FISH technique and STR genetic markers 7.6-P
Disruption and translocation of the mll gene to the chromosome 19p13.3 accompanied by the insertion of 12p12.3-p11.1 to the 11p15-11.1 chromosome in a patient with therapy related acute myeloid leukem A. Lazaridou, S. Mavroudi, A. Nikitidou, P. Salamourtzi and K. Zervas Cancer Hospital of Thessaloniki Greece Abnormalities at 11q23 are seen throughout different hematological diseases and usually reflect a variety of mechanisms of disruption of the MLL gene. Also, rearrangements at the chromosome 11p15 where the NUP98 gene lies and its fusion with 19 different gene partners have been reported in AML and MDS forming a group carrying some distinct clinical features. The most common is t(7;11)(p15;p15) involving genes of the HOXA cluster and are found mainly in de novo leukemias. We here report an adult patient with breast cancer and therapy related myelodysplastic syndrome. After a short period she developed acute myelomonocytic leukemia. Conventional karyotype showed a complex translocation involving chromosomes 11, 12 and 19. Chromosome 11 was disrupted in both the p and the q arms. We used M-FISH and m-band techniques to further analyzed the breakpoints involved in these translocations. The 11q23.1 chromosome was translocated to the 19p13.3 band while the 12p12.3-11.1 was inserted to the 11p15-11.1 chromosome band. By FISH the MLL gene was disrupted and fused to the 19p13.3 chromosome band. To our knowledge this is the first report of a patient with secondary myeloid leukemia carrying two important chromosome rearrangements involving both the short and the long arm of the chromosome 11. Also, the involvement of chromosome 12p in an unbalance translocation with the 11p15 band is unusual and the possible fusion of the NUP98 gene to a novel partner on chromosome 12p has to be further examined.
A. D. Krstic, O. Stojkovic, M. Guc-Scekic, D. Vujic, D. Jeftic and T. Varljen Mother and Child Health Care Institute of Serbia, Belgrade, Serbia, Institute of Forensic Medicine, School of Medicine Belgrade, University of Belgrade, Belgrade, Serbia, Faculty of Biology, University of Belgrade, Belgrade, Serbia Monitoring of chimerism after HSCT is important in order to assess acceptance or rejection of bone marrow grafts and to intervenue with appropriate therapy. Chimerism in sex-mismatched transplantations can be analyzed by using interphase fluorescent in situ hibridization with the specific probes for the sex chromosomes (XY-FISH) with 1% quantitative sensitivity when 500 cells are scored. Short tandem repeats (STRs) provide an exellent tool for bone marrow transplant monitoring, because of their high degree of polymorphism and relatively short length. The length and number of repeats within an STR vary considerably from individual to individual making them highly informative for identity testing which can be used to distinguish donor and recipient cells. In this work we present results after one year of following chimerism in our group of patients who underwent the allogeneic HSCT by related donors. Our aim is to establish the protocol for monitoring chimerism in our pediatric patients, to determine the optimal interval between two analyses and to compare the quantification accuracy and reproducibility of the two techniques: FISH and STR-PCR.
7.8-P
Case report: Acute myeloid leukaemia with t(6;9)(p23;q34) detected by routine cytogenetic procedure D. Jakiu¯niene˙ Biomedical Research Center Case report: Acute myeloid leukaemia with t(6;9)(p23;q34) detected by routine cytogenetic
6th ECC: Abstracts procedure D. Jakiuˆniene˙, MD Biomedical research center, Vilnius, Lithuania BBiomedical research center^ is a private laboratory, which is the first to have started in 2004 and up to now successfully performing karyotyping from bone marrow cells. The center collaborates with the largest hospitals of Lithuania, takes part in an international project with BCentral European Leukaemia Study Group^ (Austria). We would like to present the case report about translocation t(6;9)(p23;q34) for the first time detected in our laboratory. This translocation is associated with acute myeloid leukaemia (AML). This is quite a rare rearrangement of a small size which may be over looked by routine cytogenetic procedure. It is often found out that the patients have been influenced by toxic factors. Case: The patient is a 44 year-old woman with preliminary diagnosis of myeloid leukaemia. The manifestation of disease was detected in Dec 2006. According to performed investigations, the leukaemia was classified as AML FAB M2. There are interesting data from the anamnesis: a woman has worked for 25 years in the TV factory, where she could have possibly faced high range of toxic materials. Method: Bone marrow cells have been cultured according to standard procedure. The karyotype was analysed on G-banded slides applying the computerised karyotyping system BLUCIA^. Results: Translocation t(6;9) (p23;q34) has been detected as the sole karyotypic abnormality. Disscusion: The translocation results in a fusion of DEK and Can genes. There is some evidence about correlation between resulting DEK-CAN gene and destroing mRNA export and inhibition of nuclear protein import. A lot of toxic environmental materials are known which could possibly affect the stemcells of bone marrow and induce the cancerogenesis. There is not enough proof to confirm that mentioned translocation is caused by the particular toxic agent.
169 Institute of Genetics, University of Bucharest-Institute of Genetics, University of Bucharest-Institute of Genetics, Fundeni Clinical Institute-Departament of Hematology and Bone Marrow Transplantation, University of Bucharest-Institute of Genetics The chromosomal aberrations of the peripheral blood represent the first biomarker which proved to be associated to the risk of cancerogenesis. The present paper aims to identify the epigenetic and cytogenetic aberrations, cytostatically induced at the human genome level. Lymphocyte cultures from two Hodgkin_s disease patients, treated following the ABVD (doxorubicin, bleomycin, vinchristin, dacarbasine) scheme Y in vivo model Y and doxorubicin treated lymphocyte cultures from healthy subjects, in vitro model, were used. The cytogenetic analysis has involved the morphological changes of the metaphase chromosomes and their frequencies in dynamics, at cumulative doses, for the in vivo model, and micronuclei (MN) evidencing, at different doxorubicin concentrations, for the in vitro model. In dynamics, an increase of the chromosomal aberrations with the number of the chemotherapy cycles were evidenced, the most frequent aberrations being the pcds (premature centromere divison) and the chromosomal attractions, 14.6% and 16.8% for the first subject and, respectively, 26.3% and 10.7%, for the second subject. For the in vitro model, an increase of the MN_s frequency was noticed, directly correlated with the doxorubicin dose and the time of the exposure (maximum at 0.1 mM, 72 hrs, 15 MN / 500 mononucleate cells). As for the epigenetic effect, an imbalance of the global methylation with a global hypermethylation tendency induced by the ABVD cure, was noticed.
7.10-P 7.9-P
The reactivity of human genome to chemotherapy V. Teleanu, M. Usurelu, D. Cimponeriu, P. Apostol, I. Radu, D. Moiceanu and L. Gavrila Fundeni Clinical Institute-Departament of Hematology and Bone Marrow Transplantation, University of Bucharest-Institute of Genetics, University of Bucharest-
Unusual chromosome translocation t(4;7) in the PDGFRA locus (4q12) with deletion of the PDGFRB gene in a patient with secondary Myelodysplastic syndrome S. Mavroudi, A. Nikitidou, A. Mouzakiti, C. H. Kourousis, K. Zervas and A. Lazaridou Cancer Hospital of Thessaloniki
6th ECC: Abstracts
170 We describe a 67 years patient with breast cancer and therapy related Myelodysplastic Syndrome (MDS) two years after chemotherapy. There was no presence of hyperhosinofilia or hepatosplenomegaly and the disease was very aggressive. The patient died three months after she was diagnosed with MDS. The conventional karyotype initially was abnormal with deletion of chromosome 7, deletion of chromosome 5q and additional copies of marker chromosome 4. Multicolor fluorescence in situ hybridization (M-FISH) and Multicolor banding (m-BAND) showed that chromome 7 was not completely lost but a part of the q arm was inserted into the chromosome 7 to the band 4q12 where is located the gene PDGRa with tyrosine kinase activity. At the same time there was deletion of chromosome 5 to the band q11.1 and an unbalance translocation between 5 and 19 chromosomes. Fluorescence in situ hybridization (FISH) analysis revealed respectively heterozygous deletion of the PDGFRb gene while there was not deletion of other genes with tyrosine kinase activity such as ABL, ETV6 and FGFR3. The analysis of a number of metaphases showed the presence of multiple copies of the t(4;7) translocation and/or fragments of chromosome 4 carrying the part of rearranged chromosome 7. In the recent literature a cryptic deletion of the 4q12 region and the formation of a hybrid protein FLP1L/PDGFRA has been found in patients with hyperhosinophilic syndrome without rearrangements of other tyrosine kinase proteins and these patients have been treated with imatinib mesylated. In our case it seems that the presence of multiple copies and multiple breaks of the band 4q12 together with the presence of other chromosome abnormalities produced an aggressive disease and the exact mechanism is not known and the molecular abnormality that is involved in the pathogenesis of the disease has to be further clarified.
CLL is uniquely characterized by the existence of subsets of patients expressing stereotyped immunoglobulins. We report results of cytogenetic analysis in three subsets of CLL patients (among a cohort of 220 patients) who carried stereotyped immunoglobulins: (i) Subset#1, IGHV4-34/IGKV2-30: 8 patients (M:4/F:4), Dm age: 48 years, Rai 0-II: 8/8, CD38+: 0/8, SIgG+: 8/ 8, mutated IGHV genes: 8/8, disease progression: 2/ 8 (ii) Subset#2, IGHV1-5/IGKV1-39(1D-39): 5 patients (M:2/F:3), Dm age: 57 years, Rai 0-II: 3/5, CD38+: 4/5, SIgG+: 0/5, mutated IGHV genes: 0/5, disease progression: 4/5 (iii) Subset#3 IGHV4-39/ IGKV1-39(1D-39): 4 patients (M:2/F:2), Dm age: 64 years, Rai 0-II: 4/4, CD38+: 3/4, SIgG+: 4/4, mutated IGHV genes: 0/4, disease progression: 2/4. Classical cytogenetic analysis of peripheral blood mononuclear cells revealed: (i) Subset#1: normal karyotype, 7/ 8 patients/ 46, XX, del(13)(q12q14), one patient, (ii) Subset#2: normal karyotype, 4/5 patients/ 46, XX,del(6)(q21q27), one patient, (iii) Subset#3: normal karyotype, 2/4 patients / trisomy 12: 2/4 patients. Interphase FISH analysis was performed using four commercially available probes: (i) chromosome 12 satellite probe, direct green (QBiogene); (ii) 13q14: D13S319/D13S25 spectrum orange DNA probe (Vysis); (iii) 11q22.3 (ATM)/Alphasatellite 11 cocktail probe (dual-color direct labelled (QBiogene); (iv) 17p13: p53 spectrum orange DNA probe (Vysis). FISH analysis revealed: (i) Subset#1: deletion 13q14, 5/8 patients, (ii) Subset#2 deletion 13q14, one patient/ trisomy 12, one patient, (iii) Subset#3: trisomy 12, 3/4 patients. In conclusion, deletion 13q14 and trisomy 12 were recurrently identified in, respectively, subset#1 and #3 patients. Stereotyped cytogenetic findings in patients with IgG-isotype switch and stereotyped immunoglobulin sequences allude to the important role of antigen in the development and evolution of the leukemic clone.
7.11-P
Stereotyped cytogenetic findings in subsets of patients with chronic lymphocytic leukemia (CLL) expressing IgG-switched stereotyped receptors
7.12-P
A. Athanasiadou, K. Stamatopoulos, M. Gaitatzi, N. Stavroyianni, R. Saloum, A. Anagnostopoulos and A. Fassas
N. Nadal, J. L. Stephan, J. Cornillon, P. Flandrin, B. Regeffe and L. Campos
G. Papanicolaou Hospital
AML1 rearrangments observed in acute myeloblastic leukemia after bone marrow transplantation
Laboratoire d_hematologie, CHU Hoˆpital Nord, 42055 Saint-Etienne, France, Service d_oncologie
6th ECC: Abstracts
171
pediatrique, ICL, 42270 Saint-Priest-en-Jarez, France, Service d_hematologie, ICL, 42270 Saint-Priest-en-Jarez, France
D. Usurelu, D. Cimponeriu, P. Apostol, I. Radu and L. Gavrila
AML1 gene is one of the most frequent targets of chromosomal rearrangements in acute leukemia. Most commonly these rearrangements include the t(8;21)(q22;q22) in AML-M2, the t(12;21)(p13;q22) in B-cell ALL and the t(3;21)(q26;q22) in therapyrelated AML/MDS (t-AML/MDS). In addition, AML1 has also been described with many other rare partners, predominantly in t-AML/MDS. These rare breakpoints were mostly associated with Topoisomerase Inhibitors (TI) treatments. We report two patients diagnosed with AML-M2 who relapsed after treatment with chemotherapy (aracytine and TI) followed by bone marrow transplantation because of unfavorable prognostic factors. Patient 1: A 9-year old boy with a normal karyotype and an internal tandem duplication of the FLT3 gene detected by molecular analyses at diagnosis. He received aracytine, mithoxanthrone and amsacrine before he underwent a matched sibling (sister) allogenic transplant in December 2004. He relapsed in June 2006. Cytogenetics showed, at relapse, a clonal t(1;21)(p22;q22). FISH analyses confirmed AML1 implication in this translocation. Patient 2: A 51-year-old woman with a complex karyotype. Chromosomes 5 and 7 were implicated but not 21q22. The patient was treated with aracytine and idarubicine and underwent, in August 2006, an autologous peripheral-blood-stem-cell transplantation. She relapsed in November 2006. Cytogenetics showed a clonal t(17;21)(q11.2;q22). FISH analyses showed a deletion of AML1. In both cases, FISH analyses confirmed the absence of AML1 rearrangement at diagnosis. This suggests that the treatment caused and did not select a preexisting rearrangement. It is difficult to ascertain if those AML1 rearrangements are associated with a relapse of the disease or correspond to new therapy-induced leukemia.
One of the most important mutagen agents in developing different types of cancer is now the ionizing radiation. So, in this study, we are focusing our analysis on subjects who are working in a potentially mutagen environment (working with an ionizing accelerator for X, gamma and beta rays). We have analyzed eleven subjects: one control and ten workers in that eventual mutagen environment. Starting from the peripheral blood collected from those subjects we have made both classical chromosomal slides Giemsa stained and fluorescent ones by FISH technique. After the classical cytogenetic analysis (100 well Y spread metaphases/ subject) we have determined that there were not any important chromosomal modifications, the only one present being PCD (premature centromere division) with a frequency of 5Y11%. Counting on the fact that this PCD was present even in the control in 2% frequency and that in the field literature is considered normal to have 7Y8% of PCD, we have concluded that the percentage we_ve obtained for the analyzed subjects is normal and it is not due to the effect of the working environment. The most important target for ionizing radiation is the chromosomal end Y the telomere, so we have tested also from this point of view the eventual effect of ionizing radiation by FISH technique using the All Human Telomere Probe kit. Comparing the frequency of the telomeric signals obtained from the control (98%Y100 %/ metaphase) to those from that subjects (91%Y 96%/ metaphase), we found that the differences can not be considered significant. Corroborating all the obtained data, we can conclude that for our ten analyzed subject there are not obvious chromosomal modification determined by the fact that they are working with a radiation source.
7.13-P
7.14-P
Cytogenetic analysis of the human genome reactivity to the potentially mutagen environment represented by ionizing radiation
Chromosome deletions in myeloid malignancies not only remove tumor suppressor genes but may also up-regulate oncogenes
University of Bucharest-Institute of Genetics
6th ECC: Abstracts
172
L. J. Campbell and R. N. MacKinnon St Vincent_s Hospital Melbourne Deletion of chromosome 20 is a common abnormality in myelodysplastic syndromes (MDS), myeloproliferative disorders (MPD) and is observed in 1Y2% acute myeloid leukemias (AML). The common deleted region of 20q has been narrowed to overlapping areas of 2.7 and 2.6 Mb in MPD and MDS/ AML respectively and a candidate tumor suppressor gene (TSG) Y L3MBTL Y described. In MDS and AML with complex karyotypes, monosomy 20 is frequently reported. We identified 44 cases of AML or MDS with monosomy 20 for study using M-FISH and mBAND (Metasystems) to investigate the incidence of a novel dic(17;20) that we had previously described. In the course of this investigation, M-FISH showed that true monosomy of 20 was not seen in any of the 44 cases. There were segments of the second copy of chromosome 20 present in marker chromosomes or additions or insertions. Three cases contained double minute-like chromosome markers and, in all three cases, the markers were shown to consist predominantly of 20q11.2 sequences. mBAND was used to identify the fragments of chromosome 20 in these complex karyotypes. In all cases but one, the region of 20q proximal to the common deleted region was retained in at least two copies. BAC clones were used to define the proximal and distal borders of the retained region and showed amplification of up to 10 copies of the retained region in 16 cases studied. Amplification of genetic sequences suggests the presence of an oncogene. The location of an amplified sequence in the retained segment of a deleted chromosome provides support for a hypothesis that the deletion is contributing to the pathogenesis of the disorder by not only removing a TSG but also by up-regulating an oncogene on the same chromosome.
7.15-P
A new ABL1 fusion partner in B cell acute lymphoblastic leukemia E. De Braekeleer, N. Douet-Guilbert, M. J. Le Bris, F. Morel and M. De Braekeleer Faculte´ de Me´decine & CHU
Fusion of ABL1 and BCR genes is the product of the Philadelphia chromosome translocation. The formation of this fusion gene induces a new protein having an enhanced tyrosine kinase activity compared to the wild type ABL tyrosine kinase and leading to an abnormal signal of cellular proliferation. Few partner genes are known to fuse with ABL1; they are ETV6, NUP214 and EML1. We report here the case of a 11-year-old boy having a precursor B-cell acute lymphoblastic leukemia (B-ALL) associated with a t(1;9)(q24;q34). This patient was sequentially screened by fluorescence in situ hybridization (FISH) using BCR/ABL1 and TEL/AML1 probes. No fusion signals were observed, but three signals corresponding to the ABL1 probe were observed, one on the normal chromosome 9, one on the der(9) and one on the der(1), indicating the t(1;9) with rearrangement of ABL1. FISH using BAC clones was performed to map the breakpoint on chromosome 1, a split signal was obtained for clone RP11-232M22. This clone, located in band 1q24.2, contains the following two genes: RCSD1 and MPLZ1. The RCSD1 gene codes a protein kinase substrate CapZIP. This protein is phosphorylated when cells are exposed to various cellular stresses which activate the kinase cascade. Moreover, RCSD1 protein interacts with the actin-capping protein CapZ and would function as a Bcap^, stopping the fixation or the loss of actin monomers at the extremities and influencing the size of actin filaments. The MPLZ1 gene (Myelin Protein Zero-Like 1) codes a 43 kDa hyperphosphorylated membrane glycoprotein that has a specific and near stoichiometric association with a Protein Tyrosine Phosphatase (PTPN11), a positive transducer of growth factor signal. The probable formation of one of this two fusion genes, ABL1-RCSD1 or ABL1-MPZL1, could affect cell function regulation and be an important step in leukemogenesis.
7.16-P
No strong association between HER-2/ neu protein overexpression and gene amplification in high-grade urothelial carcinomas V. Caner, N. Sen Turk, F. Duzcan, N. L. Satiroglu Tufan, E. C. Kelten, S. Zencir, Y. Dodurga, H. Bagci and S. E. Duzcan
6th ECC: Abstracts Pamukkale University School of Medicine, Dept. of Medical Biology, Pamukkale University School of Medicine, Dept.of Pathology The generation of urothelial carcinoma is caused by the accumulation of various molecular changes, as in most malignancies. HER-2/neu is one of the most frequently amplified oncogenes in high-grade urothelial carcinoma. The aim of this study was to evaluate HER-2/neu protein overexpression with immunohistochemistry (IHC) and gene amplification with fluorescent in situ hybridization (FISH) and real-time quantitative PCR. Chromosome 17 polysomy was also assessed with FISH. This study was conducted with paraffin-embedded samples of high-grade urothelial carcinoma obtained from 36 patients. A score 3+ was seen in 10 tumors (27.2%) and of 2+ in 12 tumors (33.3%). HER-2/neu gene amplification was observed in 3 of 27 (11.1%) tumors by FISH and in 8 of 36 (22.2%) tumors by the PCR. Complete concordance between FISH and the PCR was seen in 8 (88.8%) out of the samples scored as 2+, while the concordance between FISH and the PCR was found in 85.7% of all samples scored as 3+. Nine (33.3%) tumors including FISH positive tumors were polysomic for chromosome 17 copy number. The results indicated that there was no association between HER-2/neu overexpression and gene amplification in the carcinomas, and polysomy 17 was higher in the carcinomas with HER-2/neu overexpression.
7.17-P
Severe aplastic anemia (SAA) due to chromosome 21 acquired chromosome anomaly and haploinsufficiency of RUNX1 gene E. Maserati, R. Valli, B. Pressato, F. Patitucci, F. Lo Curto, F. Bonetti, M. Zecca and F. Pasquali Biologia Generale e Genetica Medica, Dipartimento di Scienze Biomediche Sperimentali e Cliniche, Universita` dell_Insubria, Varese, Italy, Oncoematologia Pediatrica, Universita` di Pavia, Fondazione IRCCS Policlinico S. Matteo, Pavia, Italy The finding of clonal chromosome anomalies in the bone marrow of patients with aplasia or hypoplasia is
173 relevant for differential diagnosis from myelodysplastic and myeproliferative diseases, with implications also for therapy. We report a 7-year-old child in whom a clonal complex anomaly of chromosome 21 was acquired in the marrow, not indicating a dysplastic or neoplastic process, but yielding to the SAA. Chromosome analysis and fluorescent in situ hibridization (FISH) on interphase nuclei with centromere-specific probes for chromosomes 7 and 8 were performed on bone marrow at diagnosis. Monosomy 7 and trisomy 8 were excluded by FISH. The chromosome analysis showed the presence of an acquired structural anomaly of chromosome 21 in two cells out of 26, and the clone dimension increased in repeated analyses in the following years. The abnormal chromosome 21 was longer than normal with a banding pattern difficult to interpret. Chromosome 21 painting gave a signal covering the whole abnormal chromosome. FISH was subsequently performed with several BACs covering the region 21q21.3-21q22.3, and with probes identifying the fusion RUNX1/ETO, to define the supposed duplication. The results showed that the chromosome portion 21q22.2-q22.3 was duplicated but also inverted and that a deletion was present as well. This deletion included most of the gene RUNX1, except the first exon. The monitoring of the abnormal clone was then done by FISH on interphase nuclei with the BAC RP11-2235K24, mapping inside the deleted region, showing 32 to 50% abnormal cells during the course of the disease. The expression of RUNX1 was studied on RNA from bone marrow cells by quantitative real-time PCR and compared with age-matched normal subjects. This test was performed when 40% of marrow cells were abnormal, and, as expected, the gene was hypoexpressed. So, in the patient here reported the SAA is due to the haploinsufficiency of RUNX1 caused, in turn, by the clonal marrow chromosome anomaly.
7.18-P
Molecular cytogenetic study of complex chromosomal rearrangements in adult patients with acute myeloid leukemia (AML) L. Babicka, Z. Zemanova, J. Brezinova, S. Ransdorfova, L. Pavlistova, M. Siskova, J. Maaloufova, J. Cermak and K. Michalova
6th ECC: Abstracts
174 General Faculty Hospital and 1st Medical Faculty, Institute of Hematology and Blood Transfusion, I Acquired cytogenetic aberrations are detected in 55Y70% of newly diagnosed AML and some of them are associated with specific disease subtype and distinct therapeutic and prognostic implications. Complex chromosomal rearrangements (CCR) are found in 10Y15% of patients and predict unfavorable clinical course. The aim of this study was a comprehensive analysis of CCR found in bone marrow cells of patients with AML at diagnosis by molecular cytogenetic methods and to evaluate frequency of recurrent chromosomal breakpoints and their specificity. We analyzed complex chromosomal rearrangements in 58 adult patients with AML using G-banding, FISH with locus-specific and centromeric probes, multicolor FISH and/or multicolor banding. The majority of structural abnormalities were unbalanced. In 50 patients (86%) loss or rearrangements of chromosome 5, 7 and/or 11 were proved. Deletion of critical regions 5q31 was determined in 35 (60,3%) and deletion 7q31 in 16 (27,5%) patients. Aberration of MLL gene was found in 11 cases (19%). The most frequent numerical change was trisomy 8 and recurrent breakpoints repeatedly affected were found to be 5q13, 5q33, 7q31, 10p12, 11q23, 12p13, 17p11 and 21q22. Median of overall survival was only 3 months. The results demonstrate the very high instability of the genome of malignant cells on chromosomal level. Precise identifications of acquired aberrations and delineation of breakpoints in bone marrow cells of patients with AML at the time of diagnosis could lead to a better understanding of genetic events during leukemogenesis as well as serve as a guide for further molecular studies of genes involved in evolution and progression of leukemia. From clinical point of view CCR in this cohort were associated with rather poor prognosis and response to antileukemic treatment. This study was supported by grants MSM LC535, MSM 0021620808, IGA NR/9227-3.
7.19-P
Molecular cytogenetic mapping of the chromosome 3 rearrangements in patients with hematological malignancies
J. Brezinova, Z. Zemanova, L. Babicka, J. Melichercikova, L. Houskova, J. Tajtlova, J. Cermak, M. Siskova and K. Michalova Institute of Hematology and Blood Transfusion, General Faculty Hospital and 1st Medical Faculty The aim of this study was the precise identification of chromosome 3 rearrangements in bone marrow cells by means of various molecular cytogenetic techniques. Multicolor banding technique (mBAND) of chromosome 3 was carried out in 40 patients at diagnosis, thirty with myeloid and ten with lymphoid malignancies to confirm aberrations obtained by G-banding. Abnormalities were categorized into five groups: a) reciprocal translocation (4 cases, myeloid only), b) non-reciprocal translocation (19 myeloid, 6 lymphoid) c) inversion (2 cases, myeloid only), d) insertion (1myeloid, 1 lymphoid), e) duplication (2 myeloid, 1 lymphoid). In all cases they occurred together with other chromosomal abnormalities. Accurate determination of the breakpoints by mBAND technique revealed large heterogeneity: on the short arm 3p24.2 was the most frequent one, proved in myeloid malignancies only (6). Common breakpoints for both myeloid and lymphoid malignancies were 3p12 on the short arm and 3q26.1-3q26.3 region on the long arm. In 15 patients (12 myeloid, 3 lymphoid) rearrangements of chromosome 3 were accompanied with 3p or 3q deletion. In 9 myeloid and 1 lymphoid malignancies deletions of the telomeric 3p region were proved using TelVysion 3p probe, telomeric 3q region was deleted in 2 patients with lymphoid malignancies only. As the most of published studies were done by conventional cytogenetic techniques on G-banded chromosomes, cryptic deletions could be easily overlooked. In our study high sensitivity of mBAND and FISH techniques increased radically the number of patients with 3p deletions and contributed to more refined determinations of the breakpoints. Systematic molecular cytogenetic studies that reveal cryptic rearrangements provide novel information about genes possibly involved in cancerogenesis. This study was supported by scientific programs MZO 00023736 and MSM LC535.
7.20-P
Cytogenetics of oral tumors
6th ECC: Abstracts
E. Manor and L. Bodner Genetic Institute and Department of OMF Surgery Soroka University Medical Center, Ben Gurion Univesity of the Negev, Beer Sheva, Israel Background: The characterizarion of oral tumors, based on histopathology, staging and grading, may not be specific in many cases, thus many tumor types might be included in the same diagnostic group and as a consequence some lesions will be either undefined or misdiagnosed. Cytogenetic analysis is an important diagnostic and prognostic tool in malignant tumors. Cytogenetic findings of oral solid tumors are rare. Here we present cytogenetic results of of 23 cases of oral tumors. Methods: Fresh tissue specimens were minsed and cultured. Cells were fixed after 5-7 days of culture and analyzed following standart procedures. Fifteentwenty five metaphases were analyzed. Results: Twenty three tumors were analysed; 8 malignant (4 squamous cell carcinoma, 1 Merkell cell carcinoma, 1 Ewing sarcoma, 1 rhabomyosarcoma and 1 myofibrosarcoma) and 15 benign (1 keratocyst, 3 pleomorphic adenoma, 2 central giant cell granuloma, 2 solitary fibrous tumor, 1 granular cell tumor, 1 angiomyoma,1 fibroma, 2 lipoma 1 hemangiopericytoma and 1 ameloblastoma). Among the malignant tumors, the squamous cell carcinoma and myofibrosarcoma showed normal karyotype, while the Merkel cell carcinoma, Ewing sarcoma and rhabdomyosarcoma showed multiple and complex chromosomal changes. Among the benign tumors, pleomorphic adenoma, lipoma, fibroma, central giant cell granuloma, ameloblastoma, hemangiopericytoma and solitary fibrous tumor showed abnormal clones with either few or multiple chromosomal changes. The cytogenetic differences between malignant and benign tumors and its significance will be disccused. Conclusions: Cytogenetic analysis is recommended as a complementary diagnostic and prognostic tool in oral tumors. It can stregthen our understanding of the tumorogensis process of these lesions.
7.21-P
Co-existence of TEL/AML1 and MLL mutation in B-cell precursor (BCP)-ALL: Evidence discloses a new subclass of BCP YALL
175
P. AmareKadam, G. Raje, A. Pais and S. Banavali Tata Memorial Hospital TEL/AML1, a low risk group of B-ALL is always debatable issue regarding its origin and dependant on additional mutation events for leukemogenesis. We report seven cases of BCP-ALL with co-existence of TEL/AML1 and MLL mutation. One case disclosed a new MLL translocation variant t(6;11)(p21;q23) with 5¶ MLL deletion. TEL/AML1 & MLL translocation clone size suggested origin of TEL/AML1 in embryonic or infant stage followed by progression to leukemia later by acquisition of MLL mutation, TEL loss, TEL/AML1 duplication. Another case of TEL/AML1 duplication had Southern MLL rearrangement. Five cases with TEL/AML1 clone size 960%, had MLL allelic deletion (MAD) of clone size 15-66% which was indicative of MAD as a secondary event. Clinical outcome appeared to have favorable prognosis. In conclusion, our data provides first evidence of a subclass of TEL/AML1MLL mutation in childhood BCP-ALL which invites investigation in large series from different populations to focus upon biology and prognostic significance.
7.22-P
Characterization of TEL,AML1 & MLL mutations and clinicopathological significance in a large cohort (700 cases) of acute lymphoblastic leukemia A. Pais, P. Amare Kadam, G. Raje, S. Banavali, H. Jain, S. Kabre, B. Arora, P. Parikh, S. Gujral and S. Ashok Kumar Tata Memorial Hospital In ALL patho-biology of TEL/AML1 (T/A) and MLL is controversial issue due to varied pattern of TEL/AML1 and MLL mutations. Development of critical secondary genetic events apart from primary are currently believed to be pivotal for leukemogenesis in MLL and T/A positive cases. To investigate primary and secondary mutational events of TEL,
6th ECC: Abstracts
176 AML1 & MLL and check their clinico-hematopathological significance large, consecutive series of pediatric/ young adults (700) of age group 3 months-25 years were investigated by metaphaseand interphase-FISH. Our study showed MLL gene rearrangements in 8.3 % of cases with identification of varied structural aberrations apart from standard translocations in ALL. Incidence of TEL/AML1 (18%) seen in our study of pediatric B-ALL, matched to the frequencies shown by reported series. High frequency of additional genetic changes (88%) such as homologue TEL loss, supplementary copies of AML1, loss of residual 3¶ AML1 and duplication of T/A (der(21) were detected in T/A+ve cases. Most striking feature was that the strong association of CD13 & CD33 with TA positive cases from reported literature was not observed in our study. New alterations of AML1 gene besides +AML1 in T/A negative cases were identified as translocations, insertions and amplifications. Our study demonstrated a significant association of MLL, TEL/AML1 mutations with age, immunophenotype, WBC, blast percentage and clinical outcome. Our study supports the evidence that TEL/AML1 is a very initial event and requires lineage specific secondary events for leukemogenesis. Low frequency of CD13 & CD33 markers in TA positive cases in our study seems to be a population difference. The clinico-hematopathological correlation will explore and identify different prognostic subgroups and will help understand the biological process of TEL/AML1 & MLL leukemogenesis.
7.23-P
Chronic Lympocytic Leukemia with t(11;14) as a unique aberration. The usefulness of fish technique S. Kokkinou, K. Tzanidakis, H. Alafaki, A. Lindou, G. Floropoulou, K. Pavlou, R. Hatzikyriakou, A. Haralambopoulou and G. Drosos Sismanoglion General Hospital of Athens The chromosomal abnormality t(11;14)(q13;q32)is most commonly associated with mantle cell lympho-
mas. Its presence in B-CLL is rare. This report is referred to 2 patients with CLL,carrying a t(11;14). PATIENTS and METHODS: A female patient 64 years of age and a male 49 y, are suffering from BCLL(CD5+,CD23+)the last 6 years. They got no treatment until one year ago, when the famale pt developed a lymphocytic infiltration of both breasts and died, and the male pt presented high leukocytosis, and extremely low value of IgG immunoglobulin. Peripheral blood lymphocytes and bone marrow cells were cultured using standard techniques. The cells were stained with GTG trypsin banding technique. Up to 30 metaphases were analyzed. FISH was performed on cytogenetic preparations accordingly to the manufacturers guidelines(VYSIS). The used probes were LSI IGH/CCND1 which detect the juxtaposition of the IGH locus and the Cyclin D1gene and IGH/CCND1 XT. This translocation results in the upregulation of oncogenes due to the juxtaposition of IGH enhancers with these oncogenes. Two hundred cells from each pt and from each probe were counted. The cut-off of our lab is 13%. RESULTS: The karyotypes looked normal.No trisomy 12or del13q14 was observed. With FISH there was no translocation with IGH/CCND1but there were cells carrying the translocation using the IGH/CCND1/MYEOV probe, which contains sequences that extend from a point telomeric to FGF4 through the CCND1 and MYEOV genes and ends proximally at a locus õ390 kb centromeric to MYEOV. CONCLUSIONS: This report confirms:(1)The rearrangement of IGH/CCND1/MYEOV genes in B-CLL, which is not a common finding. (2) The overexpression of these genes is associated with cell proliferation (Cyclin D1,MYEOV), progression, expansion and aggressiveness of the disease. (3) These 2 pts are the only who have this molecular cytogenetic finding among 61 B-CLL pts studied with a similar way the last 9 years. Further studies with more patients are required to be established a new subgroup of B-CLL patients.
7.24-P
Chromosomal aberrations in oral solitary fibrous tumor L. Bodner and E. Manor
6th ECC: Abstracts Soroka University Medical Center Chromosomal aberrations in oral solitary fibrous tumor Lipa Bodner*, Esther Manor Department of Oral & Maxillofacial Surgery and Genetic Institute Soroka University Medical Center and Faculty of Health Sciences, Ben Gurion Univesity of the Negev, Beer Sheva, Israel Background: Solitary fibrous tumor (SFT) is a spindle Y cell neoplasm of mesenchymal origin that occurs most frequently within the pleural cavity in adults, but has also been found in a wide variety of sites outside the thorax. Oral SFT is considered very rare. Most cytogenetic findings are from pleural and some from extrapleural lesions. Here we present the results of cytogenetic studies in a case of oral SFT. To our knowledge no cytogenetic results of oral SFT have been reported. Methods: A 43-year-old male presented with a chief complaint of a painless mass in the right cheek of several month_s duration. Physical examination revealed a well defined submucosal mass involving the right cheek. Axial CT scan, revealed a soft tissue mass. During the surgical procedure, a well-demarcated mass was found just under the normal oral mucosa. Tissue specimens were tested by histopathology, immunohistochemistry and cytogenetic analysis. Results: Microscopic examination revealed a patternless architecture with combination of hypercellular and hypocellular areas. Immunohistochemically, the tumor cells were strongly positive for vimentin, CD-34, CD-99, BCL-2 and less than 1% positive for K-67, but were negative for desmin, S-100, keratin and actin. Twenty metaphases were analyzed cytogenetically. Cytogenetic examination revealed complex translocations with a karyotype 46; XY [15] / 46; XY t(1;17;18)(p13; q11.2; q21) [5]. Conclusions: Cytogenetic analysis is recommended as a complementary diagnostic and prognostic tool in oral solid tumors. It can strengthen our understanding of the tumorogensis process of these lesions.
177
A. Duran, J. F. Barquinero, M. R. Caballı´n, M. Ribas and L. Barrios Autonomous University of Barcelona, Hosp. Sant Pau. Barcelona After an exposure to ionising radiation, the analysis of induced chromosome aberrations is the most widely accepted method in quantitative analysis. Whereas dicentric chromosomes yield decreases with post-irradiation time, translocations yield seems to be more stable. A follow-up study on the persistence of different types of chromosome aberrations was carried out. The lymphoblastoid cell line Jurkat, was irradiated at 0.2, 2 and 4 Gy of X-rays. After irradiation, the cultures were maintained for three weeks and samples were harvested at different times. Chromosome aberrations were detected using two FISH techniques: painting of chromosomes 1, 4 and 11, to assess the persistence of translocations and dicentrics, and mFISH to evaluate the complexity of induced aberrations and the involvement of each chromosome. In the first sample obtained after irradiation (48 h), the frequencies (100) of dicentrics were 0.64T0.26, 8.35T1.27 and 20.99T2.08 at 0.2, 2 and 4Gy respectively. These frequencies decreased clearly in the successive samples until values near zero. The frequencies (100) of translocations were 0.32T0.18, 7.77T1.23 and 24.69T2.25 respectively. At 0.2 and 2Gy these frequencies were relatively constant until the last sample, whilst at 4Gy there was an initial steeped decrease in the first samples followed by a slight decrease in the last ones. By m-FISH, the relative involvement of each chromosome in aberrations was not concordant between the first and the last sample. The most extreme case was chromosome 7, less involved than expected in chromosome aberrations in the first sample and overinvolved in the last one. The frequency of complex aberrations at 2Gy decreased from 0.24 to 0.02 from the initial to the last sample. At 4Gy this decrease was more pronounced, from 0.44 to 0.01.
7.26-P 7.25-P
Study on the persistence of radio-induced chromosome aberrations in a Lymphoblastoid cell line, using fish
Evaluation of incomplete and complete aberrations induced by bleomycin in human lymphocytes, using pan-telomeric and pan-centromeric probes
6th ECC: Abstracts
178
L. Benkhaled, M. R. Caballı´n, L. Barrios and J. F. Barquinero
M. Mestres, L. Benkhaled, M. R. Caballı´n, L. Barrios, M. Ribas and J. F. Barquinero
Autonomous University of Barcelona
Autonomous University of Barcelona, Hosp. Sant Pau, Barcelona
Bleomycin (BLM) is a glycopeptide used in chemotherapy protocols, and is considered a radiomimetic compound. Previous studies in human lymphocytes showed that the cell distribution of BLM-induced dicentrics was over-dispersed, similarly to the observed for high-LET radiation. In CHE cells, it has been reported that BLM induces a higher proportion of incomplete (ICE) vs complete (CE) chromosome elements, when compared with high-LET radiation. The objective of the present study was to evaluate the induction of ICE and CE by different concentrations of BLM (30, 60, 90 and 120 mg/mL) in human lymphocytes. FISH technique using pan-centromeric and pantelomeric probes has been applied to detect true ICE. Multicentrics have been considered as CE. Chromosomes without telomeric signal at the end of one or both arms, and acentric fragments without telomeric signal at the end of one arm have been considered as ICE. The frequency of dicentric equivalents (di+2tri+3tetracentrics), increases with BLM concentration (0.34T0.21, 0.67T0.18, 1.25T0.25 and 1.46T0.23 at 30, 60, 90 and 120 mg/mL). Moreover, in all BLM concentrations the distribution of dicentric equivalents was over-dispersed. The ratio of total ICE to multicentrics was 0.26 (98/383). The over-dispersed dicentric cell distribution observed is similar to the described for high LET radiation, but on the contrary the ratio ICE/ multicentrics is similar to the one described for low LET radiation. A 40% of the 846 acentric fragments were ace (j,j). This percentage is higher than the described for any type of ionising radiation (about a 15%), indicating that this type of aberration could be a characteristic signature of the clastogenic effect of BLM.
For radioprotection purposes it is considered that photons of different energies have a similar effect, although some studies indicate that the relative biological effectiveness (RBE) increases as the energy decreases. For this reason, the low energy mammography X-rays (26Y30 kV) could be more hazardous than assumed. The RBE can be estimated by the analysis of chromosome aberrations. High LET radiation induces more complex and incomplete chromosome aberrations than low LET. If low energy X-rays have a higher RBE, increased frequencies of these aberrations should be expected. The purpose of the present study was to evaluate the incidence of complex and incomplete chromosome aberrations after irradiation with X-rays of different energies (30, 80 and 120 kV). For each energy, complex aberrations were evaluated by m-FISH in samples irradiated at 2 Gy. Incomplete aberrations were scored by FISH using pantelomeric and pancentromeric probes in samples irradiated at 2, 4 and 6 Gy. The percentage of complex aberrations increased as X-ray energy decreased (0.02, 0.06 and 0.19 at 120, 80 and 30 kV respectively). The ratio incomplete/ complete aberrations for 80 and 120 kV were 0.37 y 0.38, lower than the 0.59 observed for 30 kV. The results obtained in the present study, indicate that X-rays used in screening mammography (30 kV) induce ten times more complex and 1.5 more incomplete chromosome aberrations than X-rays of higher energies (120 kV). This could be related with the different energy deposition pattern of 30 kV X-rays. Acknowledgements: This work received financial support from the BConsejo de Seguridad Nuclear^ (CSN-E-978/04). The investiga-
Acknowledgements: This work received financial support from the
tors comprise a group of investigation of the Generalitat de
BConsejo de Seguridad Nuclear^ (CSN-E-978/04). The investiga-
Catalunya (2005 SGR 00164).
tors comprise a group of investigation of the Generalitat de Catalunya (2005 SGR 00164).
7.27-P
7.28-P
Chromosome aberrations induced by mammography x-rays, analysed by fish techniques
Evolution of chromosome aberrations through the G2-checkpoint of the cell cycle division pathway
6th ECC: Abstracts
P. Rodriguez, L. Barrios, M. R. Caballı´n, M. Ribas and J. F. Barquinero Autonomous University of Barcelona, Hosp. Sant Pau, Barcelona It is well established that exposure to ionizing radiation induces DNA lesions causing arrest or delay in cell cycle progression. This extra time is required for the processing and repair DNA before cells enter in S or mitotic phase. To study the evolution of chromosome aberrations through the G2 checkpoint of the cell cycle division, peripheral blood samples were exposed to 1 and 3 Gy of Co60 g-rays and treated with Calyculin A, an inductor of premature chromosome condensation. Cells in G2 and M-phase were consecutively analyzed using three different cytogenetic techniques: 1) Fluorescence-plus-Giemsa staining (FPG), to discriminate the cell cycle phase, to score the number of chromosome fragments per cell and to detect dicentric, acentric and ring chromosomes at Mphase; 2) FISH using pantelomeric and pancentromeric PNA probes to detect dicentric, acentric and ring chromosomes in G2-phase, and complete and incomplete aberrations in both G2 and M-phase; and 3) mFISH to detect simple and complex exchange chromosome aberrations in both G2 and M phases. In the FPG study, a total of 376 G2 and 668 M-phase cells were analyzed. From these cells, 291 G2 and 559 M-phase cells were analyzed by PNA probes. By m-FISH, 179 G2 and 299 M-phase cells were analyzed. For 1 and 3 Gy, an important increase of extra chromosome elements were observed in G2-phase respect to Mphase (p¡0.01). By PNA-FISH, a significant reduction of the number of unrejoined break-free ends was observed in M in comparison to G2 phase (p¡0.01). However, the frequencies of misrepaired aberrations (dic(+,+), ace(+,+) and rings) were similar at both phases. The mFISH study showed that the frequency of complex aberrations in G2 and M-phase cells was similar. The results obtained seem to indicate the G2 checkpoint mainly prevents the progression of cells with incomplete aberrations.
179
M. Caballı´n, M. Xuncla`, J. F. Barquinero, J. Craven-Bartle, M. Ribas, J. M. de Vega and L. Barrios Autonomous University of Barcelona, Hosp. Sant Pau, Barcelona Ionising radiation induces lesions in DNA directly, and indirectly through free radicals. Amifostine, is a drug administrated during the treatment of some types of cancer because reduces undesirable lateral effects of radiotherapy like mucositis or xerostomia. Amifostine have also the capacity to scavenge free radicals. The aim of the present study was to test how different concentrations of amifostine affects the frequency of dicentrics plus rings induced by in vitro irradiations. Peripheral blood of two healthy individuals was irradiated with g-rays at 0, 1, 2, 4, 6 and 8 Gy in the presence of amifostine at the concentrations: 0, 47, 235, 470 and 4700 mM. Dicentrics plus ring (dic+r) frequencies were obtained from the analysis of 28.060 first division solid stained metaphases. Without irradiation, no changes in the frequency of dic+r were observed at any amifostine concentration. At 1 Gy no differences in the frequency of dic+r were observed for any concentration of amifostine. For the rest of the doses (from 2 to 8 Gy), the frequency of dic+r decreased as the concentration of amifostine increased. With 4.700 mM of amifostine, the frequency of dic+r for all the doses was significantly lower than without amifostine. After amifostine administration in standard radiotherapy protocols, its concentration in plasma is about 50 mM. In our study, at the concentration of 47 mM there was a slightly decrease in the frequency of dic+r, only significant at 6 Gy. Acknowledgements: Financial support from the Spanish Ministerio de Sanidad y Consumo (PI030480). The investigators are part of SGR recognized by the Generalitat de Catalunya (2005 SGR 00164).
7.30-P 7.29-P
Amifostine reduces the frequency of in vitro radio-induced chromosome aberrations
Concomitant amifostine during radiotherapy reduces the cytogenetic damage in head and neck cancer patients
6th ECC: Abstracts
180
L. Barrios, M. Xuncla`, J. F. Barquinero, J. Craven-Bartle, M. Ribas, J. M. de Vega and M. R. Caballı´n
J. Barquinero, M. Xunxla`, M. R. Caballı´n, J. Craven-Bartle, M. Ribas, J. M. de Vega and L. Barrios
Autonomous University of Barcelona, Hosp. Sant Pau, Barcelona
Autonomous University of Barcelona, Hosp. Sant Pau, Barcelona
Ionizing radiation induces DNA damage directly and indirectly through free radicals. The analysis of chromosome aberrations, such as dicentrics, is considered the best method in quantitative studies. Amifostine reduces undesirable effects of radiotherapy, like mucositis and xerostomia, and scavenges radiation-induced reactive radicals. The aim of the present study was to evaluate if the administration of amifostine during radiotherapy diminishes the frequency of chromosome aberrations in lymphocytes of head and neck cancer patients. Peripheral blood samples from 16 head and neck cancer patients have been studied. During radiotherapy six patients received concomitant amifostine (AF+) whilst ten did not (AFj). Radiotherapy comprises a basic treatment and a boost treatment characteristic for each patient. In the basic treatment, some patients received additional supraclavicular fossa irradiation (SCF+). The frequency of dicentric plus ring (dic+r) chromosomes in solid stained metaphases was analysed. The frequency of dic+r was lower in the AF+ patients group when compared with the AFj group (0.30T0.05 vs 0.42T0.09 after the basic treatment and 0.43T0.10 vs 0.48T0.09 at the end of the complete treatment). This was also true at the end of the basic treatment for SCF+ patients (0.36T0.05 in AF+ vs 0.74T0.38 in AFj), and for SCFj patients (0.18T0.01 in AF+ vs 0.34T0.05 in AFj). Conclusion: Amifostine protects peripheral blood lymphocytes from head and neck cancer patients, reducing the frequency of chromosome aberrations induced by radiotherapy.
Chromosome aberrations can be detected many years after exposures to ionising radiation. Their persistence depends on factors like initial dose, if the exposure affects only part of the body and the aberration type. The aim of the present study was to evaluate the persistence of stable (translocations) and unstable (dicentrics) aberrations, analysing their frequency in head and neck cancer patients, at the end of radiotherapy and 1, 4 and 12 months later. The chromosome aberrations from lymphocytes of ten head and neck cancer patients have been studied. In the basic treatment two patients received additional supraclavicular fossa irradiation (SCF+). Eight patients received an additional boost treatment. FISH techniques were applied to score dicentrics and translocations. At the end of radiotherapy, the frequencies of dicentrics and translocations were 0.15T0.03 and 0.16T0.03 respectively. One month later the frequencies were higher (0.17T0.03 and 0.20T0.04, respectively). After that, both frequencies decreased, reaching at 12 months a 42 and 44% of the frequencies observed 1 month after therapy (0.07T0.01 and 0.09T0.01, respectively). When the irradiation of SCF was considered, 12 months after radiotherapy the remaining frequencies of translocations were 31.8% (SCF+) and 48.4% (SCFj) of the frequencies observed 1 month after radiotherapy. Our results indicate that for fractionated radiotherapy, the frequencies of translocations and dicentrics decrease similarly. In spite of the interindividual variability (30 to 90% of reduction), in general individuals showing higher frequencies 1 month after therapy had a higher decrease.
Acknowledgements: Financial support from the Spanish Ministerio de
Acknowledgements: Financial support from the Spanish Ministerio
Sanidad y Consumo (PI030480). The investigators are part of SGR
de Sanidad y Consumo (PI030480). The investigators are part of
recognized by the Generalitat de Catalunya (2005 SGR 00164).
SGR recognized by the Generalitat de Catalunya (2005 SGR 00164).
7.31-P
7.32-P
Follow-up study on the persistence of chromosome aberrations induced by radiotherapy in lymphocytes of head and neck cancer patients
AML 1(RUNX 1) amplification in a group of paediatrics patients with B acute lymphoblastic leukaemia: as a preliminary study
6th ECC: Abstracts
M. Pe´rez Iribarne, M. Salido, E. Tuset, A. Catala`, B. Espinet, A. Aguayo and F. Sole´ Hospital Sant Joan de De´u, Hospital del Mar
AML-1(RUNX1) amplification in a group of paediatrics patients with B acute lymphoblastic leukaemia: as a preliminary study. M Mar Pe´rez1, M Salido2, E Tuset3, A Catala`3, B Espinet2, A Aguayo1, F Sole´2 1Seccio´ Gene`tica, 3Servei Hematologia. Hospital Sant Joan de Deu. Esplugues (Barcelona). Spain. 2Laboratori de Citogene`tica i Biologia Molecular. Servei de Patologia. Hospital del Mar. Barcelona. Spain Introduction: AML1 gene amplification has been reported in children with B cells precursors of acute lymphoblastic leukaemia (BCP-ALL). The similarity in the clinic and biologic features of these cases, points to be an emerging molecular cytogenetic subgroup of BCP-ALL. Patients and Methods: We have analyzed the incidence of AML1 gene amplification, on patients diagnosed of BCP-ALL in our institution, from January 2002 to December 2006 (n=88). We included only the cases that showed a karyotype with a marker chromosome or numerical abnormalities not characterized by G-banding (n=7). Patients were diagnosed and classified according EGIL-B classification; all cases were Common-BALL (6 high risks and 1 very high risk). Conventional chromosome banding studies were performed and karyotyped (ISCN, 1995). FISH to detect AML1 amplification was performed using a specific probe for TEL/AML1 fusion gene (Vysis, Abbot). Results: FISH analysis revealed tandem AML1 amplification in form of marker chromosome in two of seven patients. These two cases presented a high level amplification of AML1. In one case we detected extra copies of AML1, due to a partial duplication of long arm of chromosome 21, although this is a phenomenon in BCP-ALL none related with true AML1 amplification. All cases got complete remission and only one case relapsed. Conclusion:The presence of a marker chromosome in a karyotype of children with BCP-ALL must make us think about the possibility of an amplification of AML1 that could be easily discarded applying FISH techniques.
181
7.33-P
Clonal chromosome anomalies in congenital amegakaryocytic thrombocytopenia (CAMT, OMIM #604498) F. Pasquali, B. Pressato, F. Patitucci, R. Valli, M. Zecca, C. Morerio, P. Noris, C. Panarello, F. Locatelli and E. Maserati Dipartimento di Scienze Biomediche Sperimentali e Cliniche - Universita` dell’Insubria, Varese, Italy, Oncoematologia Pediatrica, Universita` di Pavia, IRCCS Policlinico S. Matteo, Pavia, Italy, Ematologia ed Oncologia Pediatrica, IRCCS Istituto G. Gaslini, Genova, Italy, IRCCS Policlinico S. Matteo, Universita` di Pavia, Pavia, Italy Congenital amegakaryocytic thrombocytopenia (CAMT) is a bone marrow (BM) autosomal recessive disorder characterized by absent or reduced megakaryocytes, low platelet count and progressive pancytopenia. It is caused by mutations of the gene MPL, coding for the thrombopoietin receptor. We report 5 Italian patients with CAMT, from unrelated families, with MPL mutations. Chromosome analyses and fluorescent in situ hybridisation (FISH) with centromere-specific probes for chromosomes 7 and 8 were repeatedly performed on BM. In all cases no anomalies were found at diagnosis. In two patients a clone with monosomy 7, and one with trisomy 8, respectively, were found in subsequent controls. Chromosome anomalies were reported in the BM of two CAMT cases (Steele et al. 2005; King et al. 2005), and it was a monosomy 7 in one. In our cohort of five patients, clonal anomalies were found in two: one monosomy 7 and one trisomy 8, the latter not being constitutional. So, we conclude that clonal chromosome changes are often acquired in the BM of CAMT patients, and anomalies typical of myelodysplastic syndromes (MDS) seem to be frequent. Although in the literature only one patient with CAMT and MDS is reported, without cytogenetic data (King et al. 2005), we suggest two alternatives. The development of a MDS could be expected in CAMT, although the short expectancy of life and the therapy by hematopoietic stem cell transplantation prevented to demonstrate it: the clonal anomalies might herald the dysplastic process. Alternatively,
6th ECC: Abstracts
182 MPL mutations may cause karyotype instability, leading to abnormal clones characterized by chromosome changes typical of MDS: this is the case also of other diseases with BM dysfunction as Shwachman syndrome, FPD/AML, Fanconi_s anemia, other congenital neutropenias. Probably the abnormal clone may then remain quiescent in the BM, but a MDS risk might be related to its expansion. In any case, cytogenetic monitoring of BM is required in CAMT.
in 3/8 cases. Present data locate the more centromeric breakpoint within 21q22.11. Further delineation is in progress.
7.35-P
High resolution Oligo array CGH analysis of challenging samples S. Song and J. Collins
7.34-P
FISH analysis of chromosome 21 pseudo dicentric markers in hematopoietic malignancy F. Viguie´, A. Aboura, J. Van Den Akker, M. Guesnu, F. Dreyfus and D. Bouscary Assistance Publique Hoˆpitaux de Paris/ University Paris 5, APHP, Hoˆpital R. Debre´, APHP, Hoˆpital St Antoine, APHP, Hoˆpital Cochin We report 8 patients with acute myeloid leukemia (4 cases), myelodysplasia (3 cases) or acute lymphocytic leukemia (1 case), expressing the same karyotypic entity, i.e. one or multiple extra chromosome 21 pseudo dicentric derivative(s), namely psudic(21) (q22), constituted by an inverted duplication from 21q22 to 21pter which leads to segmental chromosome 21 amplification. The number of copies varied from 1 to 7 per cell. Two cases expressed psudic(21) amplification as sole abnormality, others had either one associated rearrangement (5q-, +8, 20q-) or a complex karyotype. The structure of the psudic(21) was obviously similar in all cases except one which showed one marker with interstitial amplification considered as homogeneous staining region. It is argued that psudic(21) confers a selective advantage to cancer cells as the copies number tends to increase. To delineate the common amplified region we tested by FISH analysis a set of BAC/PAC probes spanning from 21q11.2 to 21q22.2. Breakpoint appeared as quite variable from case to case. AML1 locus could be excluded from the common region as it was lost by the psudic(21)
Agilent Technologies Inc In recent years, array-based Comparative Genomic Hybridization (aCGH) has been refined to determine chromosomal changes at progressively higher resolutions. This evolving technology is, however, somewhat hampered by the large amounts of input DNA required Y a minimum of 150,000 copies of a human genome, or 0.5 mg, are generally needed to process one aCGH microarray. The GenomePlex Whole Genome Amplification (WGA) kit provides a rapid method for processing biological samples of limited quantity, expanding the application of aCGH technology to analysis of nanogram quantities of DNA. Furthermore, this global exponential amplification method enables researchers to representatively amplify genomic DNA from samples that have been fragmented to an average size of less than 1 kb. This feature may enable CGH analysis of formalin-fixed, paraffin-embedded samples that were previously thought to be unusable due to their limited amounts of DNA and high level of degradation. The data presented in this poster demonstrate the high quality data that can be generated using Agilent_s high density oligo aCGH microarrays in combination with Sigma_s GenomePlex WGA kit. Firstly, WGA lowers the required minimum amount of starting DNA to as little as 10 ng. In addition, the ability to amplify low molecular weight DNA, less than 0.5Y1 kb in size, is demonstrated. Finally, we compare the performance of the GenomePlex WGA method to that of a Phi29-based isothermal amplification method in generating high quality aCGH data on Agilent microarrays. All aCGH testing has shown GenomePlex amplified material to behave comparably to larger quantities of purified genomic DNA.
6th ECC: Abstracts
7.36-P
The use of FISH to confirm morphologic solid tumour diagnoses B. Roland University of Calgary Genetic information has become important to pathologists for the diagnosis of solid tumours, particularly lymphomas and sarcomas. The value of conventional cytogenetics has been demonstrated, but the contribution of FISH analysis in making a diagnosis is less clear. The goal of this study was to determine the proportion of tumours submitted by pathologists in which FISH results confirmed a suspected diagnosis. The study included all 240 solid tumour samples that had FISH analysis performed between 2003 and 2006. The samples comprised 97 cultured tumours (20 of which were lymph nodes), 66 touch preparations, and 77 paraffin-embedded tissue samples. FISH analysis was performed in one cytogenetics laboratory in a tertiary care centre, usually at the request of the referring pathologist. FISH analysis alone was performed on the majority of specimens, but 16 also had full karyotype analysis. Two or more FISH probes were requested in 58 (24.2%) cases, 45 of which were lymphomas. The final diagnoses were lymphoma in 135 (56.3%), other hematolymphoid malignancies in 22 (9.2%), sarcoma in 57 (23.8%), and other tumours in 26 (10.8%). The FISH result was considered to be confirmatory if an abnormal result established or supported a suspected diagnosis. Overall, 102 (42.5%) cases had confirmation of the diagnosis as a result of the FISH information. FISH established the diagnosis in 45.9% of lymphomas, 40.9% of other hematolymphoid malignancies, 50.9% of sarcomas, and 7.7% of other tumours. In conclusion, FISH analysis requested by pathologists resulted in a high rate of confirmation of solid tumour diagnoses.
7.37-P
Non-random genetic abnormalities in recurrent oligodendrocytic tumours: the utility of interphase fluorescence in situ hybridization (I-FISH)
183
Z. Zemanova, K. Michalova, L. Babicka, S. Ransdorfova, F. Kramar, P. Hrabal and P. Kozler General Faculty Hospital and 1st Faculty of Medicine, Charles University, Prague , Institute of Hematology and Blood Transfusion, Prague, Department of Neurosurgery, Central Military Hospital and 1st Faculty of Medicine, Charles University, Prague, Department of Pathology, Central Military Hospital, Prague In oligodendroglial brain tumours, deletions of short arms of chromosome 1 and the long arms of chromosome 19 has been shown to predict better prognosis and chemosensitivity as compared to astrocytomas. Therefore, the correct diagnosis of these genetic alterations in tumours of oligodendroglial origin is particularly important. For detection of deletions of 1p36 and/or 19q13.3 in oligodendroglial cells we used dual-color interphase fluorescence in situ hybridization (I-FISH) with locus-specific DNA probes (Abbott Vysisi). I-FISH was performed on isolated whole cell nuclei, prepared from fresh nonfixed tumour tissue samples resuspended in media and processed using standard cytogenetic procedure, thus bypassing the problem of nuclear truncation. We examined 25 patients with histologically proved oligodendroglial tumours (8 oligodendroglioma, 14 anaplastic oligodendroglioma, 3 anaplastic oligoastrocytoma). Molecular cytogenetic analyses were successful in 23 patients (92%) and were uninformative in two patients only, due to nonadequate tissue specimen. Combined deletions of 1p36 and 19q13 regions were proved in 17 patients (68%), in 12 cases as sole cytogenetic abnormality (progression of tumour occured in 33.3% of them). In five patients additional genetic alterations typical for high-grade astrocytoma were found, which are sign of worse prognosis (amplification of EGFR gene, deletion of RB1 gene, deletion of p16 gene, monosomy of chromosome 10). Recurrence or tumour progression appeared in 80% of these cases. In summary, I-FISH on isolated whole cells nuclei is a sensitive method for detection of specific chromosomal aberrations in brain tumour specimen. In patients with oligodendroglial tumours, it is the essential part of diagnostics and it considerably influences treatment and prognosis. However, further studies are necessary to identify the real prognostic
6th ECC: Abstracts
184 significance of additional chromosomal aberrations for patients with oligodendrogliomas and combined 1p36/19q13 deletions. Supported by VZ064165 and MSM LC535.
7.38-P
The incidences of del(13q), del(20q), trisomy 8 and trisomy 9 by interphase fluorescence in situ hybridization (I-FISH) in patients with chronic myeloproliferative disorders I. Bazdiara, D. Pantelidou, G. Trypsianis, D. Margaritis, G. Xanthopoulidis, A. Anastasiadis, I. Kotsianidis, V. Kaloutsi, G. Bourikas and C. Tsatalas Democritus University Of Thrace Chronic Myeloproliferative Disorders (CMPD), including Polycythemia Vera (PV), Essential Thrombocythemia (ET), Idiopathic Myelofibrosis (IMF) and Unclassified CMPD (UN CMPD), are clonal stem cell diseases, in which chromosomal abnormalities are not very common at diagnosis but are increased with disease progression. The aim of the present study was to determine the incidences of del13q14 (RB-1), del20q12 (D20S108), +8 and +9 by I-FISH in CMPD patients either at diagnosis or during the course of the disease and to assess their clinical utility. One hundred bone marrow samples from 42 ET, 39 PV, 3 IMF and 5 UN CMPD patients, with median age 63 years (range 17Y84) were studied using I-FISH, utilizing probes for RB-1 and D20S108 loci and for centromere enumeration of chromosomes 8 and 9. Forty samples were studied at diagnosis, whereas 60 during the course of the disease. The median duration of the disease at the time of analysis was 62 months (range 2Y217). Most of the patients (40/60) were treated with hydroxyurea for a median period of 62 months (range 2Y162). Thirty-four of the 89 (38%) patients exhibited an abnormality by I-FISH. Chromosomal aberrations were found in 17/42 (40%) ET, in 11/39 (28%) PV, in 2/3 (67%) IMF and in 4/5 (80%) UN CMPD. There were 25 (28%) cases of D20S108 deletion, 6 (7%) with RB-1 deletion, 2 (2%) with +8 and 1 (1%) with +9. The presence of the above chromosomal rearrangements was associated with treatment failure(p=0.012). The event free survival
(EFS) without disease progression to myelofibrosis, secondary leukemia, myelodysplastic syndromes or death was 62T15 months vs 89T5 months in patients with or without a clonal abnormality respectively. Patients with a clonal aberration had 3-fold risk to develop progression of the disease (OR=3.1, 95% CI=1.1j9.0, p=0.037). The present data strongly support that the application of I-FISH to CMPD patients may provide valuable information regarding the role of the above chromosomal abnormalities in the prognostic evaluation and clinical management of these disorders.
7.39-P
Molecular cytogenetic characterization of chromosome 20 derivatives in myelodysplastic syndrome N. Douet-Guilbert, A. Basinko, A. Herry, M. J. Le Bris, F. Morel and M. De Braekeleer Faculte´ de Me´decine & CHU, Faculte´ de Me´decine, CHU Brest Deletions of the long arm of chromosome 20 are present in 5% of myelodysplastic syndromes (MDS), but are not limited to the Bclassical^ 20q deletion. In the present study, we focussed on chromosome 20 abnormalities, other than the Bclassical^ deletion, present in 16 MDS patients and characterized them using fluorescence in situ hybridization (FISH) techniques. Balanced rearrangements involving chromosome 20 were observed in 2 patients. Monosomy 20 was identified by conventional cytogenetics in 7 patients, but confirmed by FISH in two cases solely; in the remaining 5 patients, material from chromosome 20 was found in structural rearrangements. Unbalanced rearrangements with loss of 20q were identified in 12 patients (interstitial and terminal loss in 9 and 3 patients, respectively). D20S108 locus, located in the commonly deleted region in Bclassical^ 20q deletion, was lost in 7 of these 12 patients. Dicentric and dicentric derivative chromosomes were identified in 58.3% (7/12) of the cases. Chromosomes involved were chromosomes 5, 7, 12 (1 case each), and 22 (4 cases). Furthermore, amplification of chromosome 20 material (20p and proximal 20q)
6th ECC: Abstracts
185
Dicentric chromosomes in childhood acute lymphoblastic leukemia (ALL)
formation of dicentric chromosomes were X, 2, 7, 9, 11, 12, 13, 16, 20 and 21. The most frequent chromosomes involved in dicentric chromosomes were chromosome 9 (6 cases) and chromosome 12 (4 cases). In two patients isodicentric chromosome 21 was detected. In all but one case, the presence of dicentric and/or isodicentric chromosomes was a part of complex karyotype, in 4 patients with TEL/ AML1+ ALL, in 3 patient with MLL rearrangement and in one with deletion of 11q23 region. The presence of complex karyotypes complicated the clinical evaluation of the prognostic impact. All patients are alive in the first complete remission. Our cytogenetic and molecular cytogenetic study in childhood ALL showed low frequency of dicentric chromosomes, confirmed non-random involvement of chromosomes in translocations and identified five new dicentric chromosomes. This work is supported by grant MSM 6198959205
M. Holzerova, I. Lakoma, H. Pospisilova, J. Balcarkova, D. Pospisilova, Z. Novak, V. Mihal, B. Blazek, K. Indrak and M. Jarosova
7.41-P
was observed in 3 patients, emphasizing that retained and/or amplified 20q material may play a critical role in MDS development. In conclusion, dicentric (derivative) chromosomes involving chromosomes 20 and 22 appeared to be a recurrent rearrangement, seldomly reported in the literature. Material from the long arm of chromosome 20 was lost in 14 of the 16 cases studied. Loss of tumor suppressor gene(s) could play a critical role in MDS pathogenesis and should be interesting to be studied. However, to the contrary of the commonly deleted region observed in Bclassical^ 20q deletion, loss of 20q material observed in chromosome 20 derivatives is more heterogeneous.
7.40-P
University Hospital Olomouc, Department of Hemato-Oncology, University Hospital Olomouc, Department of Pediatrics, Teaching Hospital Ostrava, Department of Children Hematology, U The identification of recurring chromosomal translocations in pediatric acute lymphoblastic leukemia (ALL) can provide clues to the cellular events with biological and clinical significance. Chromosomal translocations resulting in dicentric and isodicentric chromosomes are less common chromosomal abnormalities in leukemias nevertheless they are also detected in childhood ALL with different impact on prognosis. Dicentric chromosome is a derivative chromosome with two centromeres of different origin, while isodicentric chromosome arises from translocation of two homologous chromosomes. The aim of our study was to precisely characterize dicentric and/or isodicentric chromosomes by using cytogenetic and molecular cytogenetic methods and to evaluate their clinical significance. From 1996 to 2006, 145 children with a newly diagnosed ALL were analyzed by conventional cytogenetic and molecular cytogenetic techniques (FISH and/or mFISH and/or mBAND FISH and/or CGH). Dicentric and/or isodicentric chromosomes were present in 12 (8%) patients. The chromosomes involved in the
Clinical implications of 13q14 and 17p13 deletion, t(4;14) and 1q21 amplification in patients with relapsed multiple myeloma treated by Thalidomide or Bortezomib (Velcade) P. Kuglik, R. Zaoralova, H. Filkova, H. Greslikova, P. Nemec, A. Oltova´, L. Pour, Z. Adam, M. Krejci and R. Hajek Faculty of Science, Masaryk University, Brno, Monoclonal Gammopathy and Multiple Myeloma Basic Research Centre, Masaryk University, Brno, Department of Medical Genetics, University Hospital, Brno, Department of Internal MedicineHematooncology and Clinical Hematology, ¨ niversity Hospital Brno and Faculty of Medicine, U Masaryk University The aim of this study was to investigate if Thalidomide or Bortezomib (Velcade) is able to antagonize the impact of negative cytogenetic prognostic markers in patients with relapsed multiple myeloma (MM). We have focused on four chromosomal aberrations known as negative prognostic factors in
6th ECC: Abstracts
186 MM treated by conventional or myeloablative treatment: deletion of 13q14, deletion of 17p13 (p53), translocation t(4;14) and amplification of CKS1B gene (1q21). We have identified monotypic plasma cells and studied chromosomal aberrations by cytoplasmic light-chain fluorescence in situ hybridization (cIg-FISH) technique. Two groups of patients with relapsed multiple myeloma of similar age, sex, stage of the disease and other parameters were treated by Thalidomide based regimens (24 patients) and by Bortezomib based regimens (18 patients). Cytogenetic findings: Thalidomide group - deletion of 13q14 was found in 8/16 (50%) patients, t(4;14) in 8/15 (53%) patients, deletion of 17p13 in 7/15 (47%) cases and amplification of CKS1B gene in 10/15 patients (67 %). Velcade group Y deletion of 13q14 was detected in 13/21 (62%) patients, t(4;14) in 14/ 21 (66%) patients, deletion of 17p13 in 7/17 (41%) patients and amplification of CKS1B gene in 12/19 (63%) patients. In our preliminary experiments, we have found no significant difference when compared patients with or without of each aberration for time to progression (TTP), duration of response (DOR), progression-free survival (PFS), overall survival (OS) and response rate. It is possible that new drugs, Thalidomide and Bortezomib (Velcade), antagonize the impact of cytogenetic negative prognostic factors in relapsed patients with MM. However, these findings require confirmation from further studies. Supported by Myeloma Basic Research Centre Brno MU (LC 06027) and by grants from Ministry of Educations (MSM0021622415) and Ministry of Health of Czech Republic (No. 8183-4)
7.42-P
Chromosomal abnormalities in myeloid leukemi G. Svyatova, G.Abildinova, K. Koshkarova and G. Sabyrbaeva Scientific Centre of Obstetrics, Gynecology and Perinatology, 2National Medical University Chromosomal abnormalities were performed in cells bone marrow of subjects illness chronic myeloid leukemia. From 71 surveyed cases with CML at 63 patients (89%) was found out Ph’ Y chromosome,
formed usual translocation between 9 and 22 chromosomes. In 11% cases it was marked Ph ’ - negative CML, but at the patients the clinic CML was marked. Among the patients with Ph ’-positive chromosome at 9 patients (12,7%) the picture was observed an atypical in cytogenetically relation, so, besides a specific marker at 1 patient is found in addition out translocation between 4; 9 chromosome - t(4:9), 2 patients (2,8%) - are revealed cells with two Ph ’ chromosomes. For today cytogenetically and hematologically stability has stepped at 6 patients (8,4%). The results confirm the usefulness of using cells bone marrow the important role in differential diagnostics, forecasting, current of disease and allows to choose the appropriate therapy and to watch its efficiency.
7.43-P
Genetical effects in blood lymphocytes of the inhabitants at influence chronic exposure to ionizing radiation G. Abildinova and G. Svyatova Scientific Centre of Obstetrics, Gynecology and Perinatology Chromosomal analysis were performed in blood lymphocytes of subjects continuously living in region of influence of Semipalatinsk nuclear test site (Dolon_, Mostik, Sarshjal). The general frequency chromosomal aberration has made 3,43T0,5 100 on cells. The control level chromosomal aberration of the people in the age of 20Y50 years, has made 1,15T0,2 on 100 cells. High level of chromosomal aberrations is caused by radiation markers Y acentric fragments; dicentrics and ring chromosomes and stable chromosomal aberrations. The mean frequency of cells containing dicentrics+ ring (0,44T0,04) were significantly increased compared to the control levels (0,023T0,01) on 100 cells. For reconstruction effective doze on the moment of an irradiation in limits up to 0,5 Gy is found the model a & cos (x)+sin (x), where x Y ratio dicentrics+ rings with pair fragments. Frequency and spectrum of chromosomal aberrations show a substantial mutagenesis effect of ionizing radiation upon chromosomes of somatic cells. Cytogenetic examination and ESR-spectrometry of tooth enamel with the measurement of absorbed radiation
6th ECC: Abstracts dose was done among people. Dependence of cytogenetic parameters upon ESR-doses had been studied. Had been received dependences: for the total frequency of chromosomal aberrations a+b*cos(x)+ c*sin(x), for acentric fragments and the sum of change aberrations - a*cos(x)+b*sin(x). The results confirm the usefulness of using human lymphocytes as a bioindicator for chronic exposure to ionizing radiation and in cases where physical radiation detector are not available.
7.44-P
A molecularly genetic determination of prognostic factors of the prostate cancer and their relationships J. Dvorackova, M. Uvirova, I. Urbanovska, M. Cegan, J. Sterba and L. Ceganova
187 genetic abnormalities were revealed in 27 patients (77.2%). A Chı´-squared test showed the dependence of Gleason score on amplification of the c-myc gene in nonmetastasing prostate cancer. In the case of a Gleason score of 3, abnormalities in amplification of c-myc were statistically more significant than a Gleason score of 2 using significance according to the Fisher Exact Probability test (p=0.039). We showed that the level of expression of protein p27 Kip1 was related to abnormality of amplification of the c-myc gene. We also came to the conclusion that degradation of protein p27 Kip1 expression is related the c- myc amplification. Determination of the degradation of expression of protein p27, together with proving the 8q24 amplification or 8p22 deletion, in a prostate carcinoma primary sampling would result in showing a tumor population with a more favorable biological nature and where the hormonal independence would be an accompanying mark of this kind of prostate carcinoma.
CGB Laborator Spol. S.R.O. A Molecularly Genetic Determination of Prognostic Factors of the Prostate Cancer and Their Relationships to Expression of Protein p27kip1. Dvorackova J., Uvirova M., Urbanovska. I.,Cegan M., Sterba J., Ceganova L., Ziak D., CGB laborator spol. S.R.O. Ostrava Prostate cancer is a heterogeneous disease. Progression of this tumor is known to be connected to a number of genetic abnormalities. Loss of a part of chromosome 8p22 and amplifications of the field 8q24 are the most frequent chromosomal aberrations in prostate cancer. Changes in locus 8p22 are associated with poor prognosis in patients with advanced prostate cancer. Loss of heterozygosity described in up to 69% of prostate cancer is responsible for the frequent changes that result in prostate cancer. We chose a subgroup of 17 monitored patients who had died in the five years following diagnosis, and added this a sample of 31 surviving patients whose Gleason score exceeded 5. Owing to lack of tumor cells in puncture biopsies, we made hybridizations in situ and objectively evaluated the result in 35 patients out of 48. Amplification in the field for oncogene c-myc was found in 19 cases (54.2%), in 15 of these (78.9%) polyploidy of the chromosome 8 was also confirmed. Deletion of a part of chromosome 8p22 was found in 21 cases (60%). Normal findings were shown in 8 cases (22.8%) and
7.45-P
Distinct cytogenetic clonal anomalies involving the AML1 gene in acute myeloid leukemia at diagnosis and after bone marrow transplantation M. J. Le Bris, N. Gue´ganic, E. De Braekeleer, V. Marion, J. C. Ianotto, N. Douet-Guilbert, F. Morel and M. De Braekeleer CHU Brest, Faculte´ de Me´decine & CHU The AML1 (also RUNX1or CBFA2) gene codes for a transcription factor essential for normal hematopoiesis. Its impairment, resulting from mutation, deletion, translocation or amplification, is reported to contribute to the pathogenesis of acute leukemias. We report here distinct impairments of AML1 in a 51-year-old male patient diagnosed with acute myeloid leukemia (AML) subtype M2 (FAB classification), before and after bone marrow transplantation (BMT). Karyotype at diagnosis was interpreted as 46,XY,der(7)t(7;11)(q31;q14)[7]/46,XY[15], resulting in a partial 7q monosomy and a partial 11q trisomy (including MLL). The patient did not achieve complete remission following chemotherapy, leading to BMT. Six months later, aplasia persisted,
6th ECC: Abstracts
188 suggesting relapse. Surprisingly, conventional and molecular cytogenetic analyses showed a 46,XY,t(3;11;22;21;3)(p13;q14;q12;q22;q26)[15]/ 46,XY[5] karyotype. FISH studies with LSI TEL/ AML1 Dual color translocation probe (Abbott, Rungis, France) revealed disruption of the AML1 gene and translocation to band 3q26. Using BACs located to 3q26, it appeared that the break occurred at 3q26.32, with loss of RP11-91K9, about 8 megabases distal to EVI1, suggesting fusion of the AML1 gene with a yet unknown partner. Retrospectively, FISH analyses, using the same TEL/AML1 probe, were performed on the sample at diagnosis and on follow-up samples.Unexpectedly, they disclosed an AML1 cryptic deletion in the metaphases considered as normal at diagnosis. It is noteworthy that AML1 deletion was not present in the partial 7q monosomic/ 11q trisomic cells. With chemotherapy, both initial abnormal clones decreased concomitantly. They had disappeared at the time of BMT and were never detected after. This unusual case could contribute to highlight the causal role of AML1 in the pathogenesis of acute leukemias.
7.46-P
Acute promyelocytic leukemia with i(17)(q) and cryptic PML-RARA rearrangement only by RT-PCR, not FISH J. Huh, H. Moon, H. Chi and W. Chung Mokdong Hospital, Ewha Womans University, Asan Hospital, Ulsan University The molecular hallmark of acute promyelocytic leukemia (APL) is PML-RARA rearrangement. FISH (fluorescent in situ hybridization) can detect almost all PML-RARA rearrangements including complex and cryptic rearrangements. Here, we describe a case of APL with the karyotype 46,XX,i(17)(q10) without evidence of PML-RARA rearrangement by FISH, but PML-RARA fusion gene was molecularly confirmed by reverse transcriptase Ypolymerase chain reaction (RT-PCR). A 44-year-old female was diagnosed as having APL based on morphology, cytochemistry and immunophenotype. The cytogenetic analysis of bone marrow showed 60% of metaphase cells
bearing i(17)(q10) in the 20 metaphase cells examined. No apparent abnormality of chromosome 15 was found. The fluorescence in situ hybridization (FISH) study was performed using PML-RARA dual color, dual fusion probe (Vysis, Downers Grove, IL). FISH analysis showed two red and three green signals in 55% of interphase cells. Two red signals (PML gene) indicated both normal chromosome 15 and three green signals (RARA), one for normal chromosome 17 and two for i(17)(q10). Two yellow fusion signals indicating PML-RARA rearrangement were not detected. In addition, any FISH signals, indicating complex translocation or translocation of RARA that do not involve PML, could not be detected. To identify PML-RARA rearrangement, RT-PCR was performed using bone marrow aspirates. The molecular study showed PML-RARA chimeric transcript. In the present case, PML-RARA rearrangement was not evident by FISH study, wherease RT-PCR revealed the presence of PMLRARA fusion transcripts. These results suggest that the small sized PML-RARA fusion transcript might not generate hybridization signals large enough to be visualized by eye examination. Therefore, RT-PCR for PML-RARA rearrangement must be conducted in cases of morphologically APL without evidence of PML-RARA rearrangement by FISH.
7.47-P
High hyperdiploidic chromosomes in a child with acute lymphoblastic leukemia M. Karkucak, T. Yakut, T. Gulten, B. Baytan, H. Cangul and A. Meral-Gunes Medical Genetics Department, Pediatric Hematology Department, Medical Faculty, Uludag University, Bursa, Turkey Acute lymphoblastic leukemia (ALL) is the most common childhood malignancy which accounts for one third of all pediatric cancers. Some pre-treatment numerical and structural chromosomal abnormalities including the translocations t(9;22), t(1;19), t(12;21), rearrangements of the MLL gene and hyperdiploidy are known as prognostic factors in childhood ALL. High hyperdiploidy is defined as the gain of one or
6th ECC: Abstracts more chromosomes (between 50Y67) in a nonrandom situation and known as a good prognostic factor whereas the translocations t(9;22) t(1;19) and rearrangements of the MLL gene known as poor prognostic factors. Some studies showed that generally the chromosomes such as 4, 6, 10, 14, 17, 18, 21 and X contribute the high hyperdiploidy so, they are more effective than others for prognosis. We present a case who had high copy number for chromosomes 5, 7, 8, 9, 11, 13, 15, 16, 17, 21, 22, X/Y detected by fluorescence in situ hybridization (FISH) using centromeric or locus specific probes. Our FISH probes were available for only tested chromosomes so, others can be analyzed in future. FISH analysis also did not show t(9;22) translocation and MLL gene rearrangements. However, the chromosomes 5, 7, 8, 9, 16, 17, 21, 22 were generally in 4 or 5 copy number (someones more than 5), the chromosomes 11, 13 and 15 were detected as 3 copy number in high percantage of the evaluated cells. The case was clinically classified in the high risk group. Therefore, we speculate that although lack of the t(9;22) and MLL gene translocations by FISH, the clinical assessment of our case in the high risk group may be originated from the very high copy number of the analysed chromosomes, from relative low copy number of the chromosomes 11, 13, 15, from the chromosomes not analyzed here, or from other clinical risk factors.
7.48-P
Abnormal clones in Philadelphia negative (Ph-) cells in CML patients treated with Imatinib mesylate M. G. Grimoldi, F. Radaelli, A. Benevento, S. Buiatiotis, R. Busuito, A. Iurlo, R. Malgara, C. Vener, F. Ripamonti and S. Fiori Sanso` University of Milan Dept Medicine, Surgery, Dental Sciences Cytogenetics Laboratory, Policlinico of Milan IRCCS Hematology II, AO S. Paolo Dept Medicine, Surgery, Dental Sciences Cytogenetics Laboratory, University of Milan Hematology I Bone Marrow Transplant Unit Policlinico IRCCS Chronic myeloid leukaemia (CML) is characterized by the reciprocal translocation involving the long
189 arms of chromosomes 9 and 22 that results in the BCR-ABL fusion gene and in a cytoplasmatic protein (p210) with enhanced tyrosine kinase activity. Imatinib mesylate is a potent specific inhibitor of the BCR-ABL protein tyrosine kinase domain and most of CML patients achieve a major or complete cytogenetic remission. Recently, clonal changes in Ph- cells of CML subjects treated with imatinib mesylate have been reported: trisomy 8 and monosomy 7 are the most common findings. We performed cytogenetic and FISH analysis, with dual fusion dual colour probe, in 70 CML patients at diagnosis, before imatinib mesylate treatment and periodically during follow-up. Five patients developed clones with chromosomal anomalies in Phcells. Two patients with major cytogenetic response showed a clone with trisomy of chromosome 8 in Phcells: 46,XX,t(9;22)/47,XX,+8/46,XX. The other patients developed the abnormal clone after complete cytogenetic remission: two patients showed a clone with 20q deletion, respectively 43 and 54 months after the starting of therapy, and 7 and 42 months after achiving complete cytogenetic response; finally, one patient developed a clone without Y chromosome 27 months after the starting of therapy and 24 months after complete cytogenetic remission. These patients are still in major/complete cytogenetic response and neither clinical progression nor myelodysplastic disease have been documented during follow-up. The role of imatinib mesylate in the occurrence of these additional abnormalities remains to be determined; the aberrations could be an effect of the disease process or/and a result of long-term inhibition of ABL tyrosine kinase. Prognostic implications of these abnormalities need systematic evaluation on a larger group of CML patients.
7.49-P
Cytogenetic studies in myelodysplastic syndromes A. Valera, B. Nomdedeu, F. Cobo, M. Belkaid, C. Go´mez, A. Carrio´ and D. Costa Hospital Clinic At our hospital 364 patients were diagnosed between 1997 and 2006 with myelodysplastic syndromes.
6th ECC: Abstracts
190 Cytogenetic studies were performed in both conventional and molecular techniques. These patients were 208 males with mean age 70 and 156 females with mean age 71. Myelodysplastic syndromes, according to the WHO classification, were found as follows: 21 RA, 29 RARS, 128 RCMD, 30 RCMD-RS, 79 RAEB, 69 CMML, 2 MDS-U and 6 MDS associated with isolated del(5q). Conventional cytogenetics were studied in all patients and the results were: 198 normal karyotype, 77 with one abnormality, 17 with two abnormalities, 39 with three or more abnormalities (complex karyotype) and 32 with no result. With one abnormality the following were more frequent: 23 patients with del(5q)/-5, 11 patients with trisomy 8 and 8 patients without Y. With two simultaneous abnormalities the most frequent were del(5q) and trisomy 8.The molecular technique was FISH analysis and is was performed in 41 patients.The FISH probes were 5q, 7q, cep8, 20q and MLL. The FISH confirmed the same results as were found in conventional cytogenetics, except with the probes cep8 in two patients and 20q in two patients. But these results were only slightly above the cut off values. Samples could not be verified with FISH because in these patients no results were found in conventional cytogenetics. The relationship between conventional cytogenetics results and myelodysplastic syndrome classification will be described and discussed.
7.50-P
Comparative genomic hybridization (CGH)-array analysis of chromosome 14 in meningiomas A. B. Espinosa, A. Maillo, M. Merino, P. Sousa, P. A. Diaz, A. Orfao and M. D. Tabernero Unidad de Investigacion, Hospital Universitario de Salamanca, Salamanca, Spain, Neurosurgery Service, Hospital Universitario de Salamanca, Salamanca, Spain, Centro de Investigacio´n del Ca´ncer, Cytometry General Service and Department of Medicine, University of Salamanca, Salamanca, Spain, Hospital Universitario-IECSCYL, Salamanca, Spain
Genetic losses of chromosome 14 are a powerful predictor of tumour recurrence in meningiomas even in histologically benign tumours. Despite this, no systematic study has been performed in which the whole chromosome 14 has been screened for the precise identification of the lost regions. In the present study, we built a chromosome 14 specific CGH-array for the identification of the most frequently lost to obtain wide information of this chromosome losses in a group of 25 meningiomas. For this purpose a BAC clone collection for chromosome 14 provided by the BACPAC Resources Children_s Hospital Oakland Research Institute, which was composed of 828 DNA clones with a median size of 150 Kb and an average spacing of 128 Kb, defined by overlapping BAC segments, was used. In addition, 104 BAC and PAC clones mapping to different regions of human chromosome X (Welcome Trust Institute) and five clones from Drosophila melanogaster, were also spotted in the array and used as hybridization controls. Once built, the CGH-array was used to screen for chromosome 14 gains and losses in a series of 25 meningioma tumors. Interphase fluorescence in situ hybridization (iFISH) was previously performed in all 25 cases using a chromosome 14q32 probe (Vysis, Inc) showing the presence of del(14q32) in 8 cases and trisomy 14 in one patient. The CGH-array analyses revealed several recurrent losses on chromosome 14 in those 8 cases showing del(14q32) by iFISH. In one additional patient coexistence of gains and losses in chromosome 14q were observed. Interestingly, no chromosome 14 copy number changes were observed in the remaining 16 cases studied, supporting the existence of a high degree of agreement between the CGH-array and iFISH results. In summary, our results indicate that the CGH-array used allows for a precise evaluation of the number of copies of chromosome 14q, confirming and refining the resolution of iFISH analyses of chromosome 14q in meningiomas. (Supported by a grant from Gerencia Regional de Salud, SACYL, ref 44-05).
7.51-P
Analysis of genomic imbalances in cutaneous squamous cell carcinoma by array comparative genomic hybridization
6th ECC: Abstracts
191
R. Salgado, B. Espinet, A. Toll, M. Salido, S. Serrano, R. Pujol and F. Sole´
Universidade Minho, Centro Hospitalar de Vila Real-Peso da Re´gua, IPO Porto
Hospital del Mar-IMAS
The cytogenetic study of tumors is extremely difficult, due to technical obstacles to obtain sufficient quantity of quality metaphases and several rearrangements of the chromosomes. Contamination of tumor samples with phenotypically and karyotypically normal cells is a factor that often interferes with tumor chromosome analysis. An alternative approach is the use of cell lines. Cell lines offer the advantage of reproducibility and represent an important tool in drug development. The present study is inserted in a project to test some drugs in the treatment of bladder tumors. The bladder carcinoma cell line T24 with aneuploidy ranging from 69 to 72 chromosomes, and usually with 4 marker chromosomes was used. This work corresponds to the optimization of a protocol for cellular culture and cytogenetic analyses of cell line T24, in order to obtain high resolution chromosomes with good quality so all the cytogenetic abnormalities could be characterized. Several protocols where tested and the optimized one was applied. We found all the cytogenetic anomalies described by the distributors (DSMZ N- ACC 376) and also some new ones. To elucidate these new anomalies, GTL, CBG and NOR were applied and also fluorescence in situ hybridization (FISH).
Introduction: Cutaneous squamous cell carcinoma (CSCC) derivates from transformed epithelial keratinocytes frequently developing on sun-exposed areas with occasional local invasion and metastasic potential. The aim of this study was to analyze chromosomal abnormalities by array-CGH and evaluate the significance of the detected genetic aberrations in relation to the clinical and histological features. Patients and Methods: Nine patients (8 males/1 female; mean age 75) with CSCC were included in the study. DNA was extracted from frozen tissue. Forward and reverse hybridizations were performed in test and control samples using the Spectral Chip 2600TM (Spectral Genomics), an array consisting on 2,621 BAC clones at an average of 1Y2 Mbp resolution, according to the manufacturer_s specifications. Results: All cases showed genetic alterations. Recurrent losses and gains were observed. The most frequent numerical abnormalities were j19, j17, j16, j10, j4 and +X and regarding structural aberrations, losses of 17p13, 4p16.1-p16.3, 9q13.1p13.3, 10p14 and gains of Xq31, 1q21.1-q21.3, 5p15.2 and 13q13 were the most frequently detected. We observed correlations between histological features and sun-exposed areas of the tumors with an important presence of gains. Conclusions: The use of the CGH-array tecnique has rarely been reported in CSCC. The finding of losses in 17p, previously described with other techniques, indicates the presence of recurrent aberrations. The detection of abnormalities in small regions in chromosome 1 illustrates the capacity of this technique to detect small alterations. Larger numbers of tumours should be analyzed with CGHarray to better understand the genetic aberrations implicated in the tumorigenesis of this disorder.
7.52-P
Characterization of new rearrangements of cell line T24 P. Botelho, R. Pinto Leite, M. Souto, L. Santos, C. Pais and E. Ribeiro
7.53-P
SKY and FISH studies in 19 patients with splenic marginal zone lymphoma (SMZL) C. Baro´, M. Salido, B. Espinet, L. Astier, A. Domingo, I. Granada, L. Florensa, A. Salar, S. Serrano and F. Sole´ Hospital del Mar, Ciutat Sanita`ria i Universita`ria de Bellvitge, Hospital Germans Trias i Pujol Introduction: Splenic marginal zone lymphoma (SMZL) is a lymphoproliferative disorder with clinical, immunophenotypic, cytological and histological features distinct from other B-cell malignancies. Few cytogenetic studies include large series of patients and most karyotypes are usually complex and difficult to define.
6th ECC: Abstracts
192 Objectives: The aim of the present study is to perform a comprehensive characterization of new chromosomal aberrations involved in SMZL, using spectral karyotyping (SKY) and fluorescence in situ hybridization (FISH) techniques. Patients and Methods: We report 19 patients diagnosed with SMZL according to the WHO criteria, selected among a series of 160, on the basis of complex karyotype and a sufficient number of metaphases. Samples for cytogenetic studies were obtained from peripheral blood, bone marrow and spleen biopsies. Conventional banding cytogenetics and SKY technique were applied to detect new chromosomal aberrations. Subsequently, in order to verify the involvement of known genes in them, we performed FISH using commercial probes: BCL-6 (3q27), c-MYC (8q24), RB1 (13q14), IGH (14q32), P53 (17p13), BCL-3 (19q13), IGK (2p11) and PAX-5 (9p13). Results: P53 gene was involved in six cases of seven studied. BCL-6 presented gains in seven of nine patients. MYC gene was gained in four cases and only one patient of three analysed presented loss of 13q14 region. Regarding to the immunoglobulin loci, reciprocal translocation involving PAX-5/IGH and IGH/ BCL-3 genes was confirmed. IGK gene was implicated only in one translocation of three cases studied. Conclusions: In situ hybridization studies have permitted to refine G-banding results and especially SKY allowed us to describe aberrations not detected by conventional banding cytogenetics. The application of SKY and subsequent FISH techniques led to the identification of molecular breakpoints implicated in new detected translocations. Acknoeledgements: This work has been partially supported by grants from la Fundacio´ La Marato´ de TV3 2004 (Ca`ncer).
of unexplained origin without morphological or immunophenotypic characteristics of malignancy. We describe clonal chromosomal rearrangements in two cases of LH (BG and CR), 64 and 55 year old adults. BG_s personal history was uneventful while CR developed a follicular lymphoma 16 years before. Both lymph nodes showed typical morphologic and phenotypic features of benign follicular hyperplasia (the germinal centres showed polymorphous shapes, with abundant tingible body containing macrophages, negative for Bcl2 and with a high proliferation rate with Ki67 antibody). Cytogenetic analysis of a cell suspension obtained from mechanical tissue disaggregation after 24 h in vitro culture without stimulation revealed in CR a 14q32.1q32.3 deletion in 4 out of 8 metaphases. In BG four different karyotypes with two clonal chromosomal abnormalities were identified: an interstitial deletion of chromosome 14q22q32.1 (6 out of 24 metaphases), an interstitial deletion of chromosome 6q arm (2 out of 24), a combination of these two abnormalities (2 out of 24) and a normal female karyotype in 14 metaphases. FISH with 14 break apart (14q32) probes revealed a partial deletion of the IGH locus in both cases: the loss of the LSI IGH in CR and the loss of LSI IGHV locus in BG on the morphologically normal 14. In the latter case the finding of two morphologically normal chromosomes 14 with the IGHV deletion in one suggested that the first mutational event was the IGH deletion and the second event was the chromosomal deletion of chromosome 14 with the IGH locus intact. Immunoglobulin heavy chain gene analysis by PCR amplification showed absence of clonal products in both cases. The finding of clonal cytogenetic abnormalities on LH raises difficulties on results interpretation and clinical follow up.
7.54-P
Lymph node hyperplasia and clonal 14q deletion: report of two cases N. Villa, S. Lissoni, E. Sala, F. Crosti, L. Dalpra`, G. Cattoretti, G. Isimbaldi and H. San Gerardo University of Milan-Bicocca Cytogenetic analysis is rarely performed on Lymph node Hyperplasia (LH), a benign lymphadenopathy
7.55-P
Complex philadelphia (PH) translocations in 7 patients with chronic myelogenous leukemia (CML) J. Grau, F. Vall-Llovera, M. Hermosilla, I. Granada, N. Ruiz Xiville´, M. Xandri, L. Zamora, M. Cabezo´n, F. Milla´ and E. Feliu
6th ECC: Abstracts
193
Institut Catala` d_Oncologia - Badalona, Institut Catala` d_Oncologia - Girona
D. Costa, S. Valera, A. Carrio´, A. Arias, M. Granell, F. Cervantes and E. Campo
Introduction: CML is characterized by the presence of a Ph chromosome produced by t(9;22)(q34;q11.2) and the consequent chimeric BCR/ABL gene. Variant rearrangements involving 9q34, 22q11.2 and one or more additional genomic regions are observed in 2Y10% of cases. Aim: To characterize complex variant Ph translocations in a series of CML patients from a single diagnosis unit. Materials and methods: In all patients age, sex, hematological parameters (leucocytes, hemoglobin, platelets and % blasts in bone marrow), cytogenetic, FISH, and molecular studies, treatment and survival were analyzed. Karyotypes were analysed by G-banded chromosomes obtained from 24 hours bone marrow cultures, and were described according to ISCN 2005. For FISH, LSI BCR/ABL DC DF was used. Results: 69 new CML patients diagnosed from 2004 to 2006. Six of them showed complex variant Ph translocations at the moment of diagnosis and 1 during the progression of the disease (10,1%). The third chromosome involved region in these 7 cases was: 3p13, 3q27, 6p21, 11q11, 12p13, 13q21 and 15q22 respectively, FISH patterns were 2R2G1F (4), 2R1G1F (1), 1R1G1F (1) and 1R1G2F (1). Karyotype was modified in 1 case from the results of FISH study. BCR/ ABL isoform was P210 (b2a2) in 5 cases and P210 (b3a2) in 2. All patients started imatinib treatment and 1 of them received an allogeneic SCT. The median survival of the patients with variant rearrangements was 14 months (5Y16). At present 5 patients are alive, with complete molecular response (n=3) and complete cytogenetic response (n=2). Conclusions: 1YIn our series the incidence of variant rearrangements is similar to those from others. 2YFISH is useful to determine the presence of the variant rearrangement and helps to define the characterization of complex Ph translocations. 3YTheP210(b2a2)is the most frequent BCR/ABL isoform in variant Ph rearrangements. Grants: Fundacio´ de Recerca Biome`dica HUGTIP and FIJC-P-EF-03.
Hematopathology Unit, Hematology Service
7.56-P
7.57-P
FISH studies in patients with chronic myeloid leukemia resistant or intolerant to IMATINIB
Cytogenetic analysis of bone marrow samples for post-therapy evaluation of CML patients with Gleevec
Chronic myeloid leukemia (CML) is characterized by a reciprocal translocation t(9;22)(q34;q11). The crucial pathogenetic consequence of this translocation is the creation of a novel, chimeric BCR/ABL gene which encodes for a protein with protein kinase activity. The development of a protein BCR/ABLspecific tyrosine kinase inhibitor (imatinib mesylate, STI571;Glivec or Gleevec) has enhanced the treatment options for CML patients. Genomic amplification of the BCR/ABL fusion gene has been described as a mechanism of resistance to Imatinib. FISH studies were performed to detect, the presence of additional bcr/abl rearrangements in patients resistant or intolerant to imatinib.Twenty-three patients diagnosed of CML with t(9;22)(q34;q11.2), who were resistant (n=19) or intolerant (n=4) to imatinib were studied by FISH using the LSI BCR/ABL.ES and LSI BCR/ ABL DC,DF probes. Conventional cytogenetic studies revealed additional chromosomal abnormalities, in 7 cases, being trisomy 8 and der(22)t(9;22) (q34;q11.2) the most frequent, both of them associated with a progression to blast crisis. Six out of the 23 test cases (26%) showed discrepancies between the karyotype and FISH studies. In five of these, there was an additional der(22)t(9;22)(q34;q11.2)(Ph_ chromosome): in three of these five cases as the sole abnormality, in one of the five cases with a deletion of 9q34 (gen ASS)(n=1), and in another as an ider((22)(q10)t(9;22)(q34;q11.2) with deletion of 9q34 (gen ASS). In the remaining case one of the two expected fusion signals in the nucleus was split. In 22% of CML patients resistant to Imatinib, FISH studies showed an extra der(22)t(9;22)(q34;q11.2) chromosome not detected by conventional cytogenetics. In conclusion, FISH studies are of paramount importance in the detection of the extra der(22)t(9;22) (q34;q11.2) chromosome and for the prediction of imatinib resistance.
6th ECC: Abstracts
194
A. Moshtagh, Maryam Zangeneh, Roxana Karimi-Nejad, Tarlan Nayeb-Bagher, Faranak Zandi, Hale Aghili, Sepideh Matin-far and Mohammad Hassan Kariminejad Kariminejad - Najmabadi Pathology & Genetics Center After approval of Imatinib mesylate (Gleevec) by FDA on December of 2002, the application of this drug among the CML patients has been increasing ever since and the accurate post-therapy evaluation has become more demanded. During last year, our referral for posttherapy evaluation of CML patients taking Gleevec has been markedly increased (about 95 cases). Fifty metaphase spreads were studied, looking for Philadelphia chromosome for all these cases, which in 29 cases (30.5%) no Philadelphia chromosome were detected and reported as all normal cell line. In other 29 cases (30.5%), no normal cell was detected and all the spreads showed translocation of chromosomes 9 and 22. The remaining 37 cases (39%) revealed mosaic pattern of both normal and abnormal cell lines. From cytogenetic point of view, the accurate evaluation should usually be concluded upon a large scale cytogenetic analysis and these kinds of analyses are usually difficult, if not possible at all, in routine G-banding cytogenetic analysis. In order to provide a better service for these patients, simultaneous molecular study for bcr-abl fusion gene by RT_PCR multiplex technique was also performed. In the next step, the Vysis LSI BCR/ABL dual Color, single fusion translocation probe was ordered and performed. This probe is a mixture of the LSI ABL probe located on chromosome 9 labeled with spectrum orange and the LSI BCR probe located on chromosome 22 labeled with spectrum green. A nucleus lacking the t(9;22) will exhibit the two orange, two green (2O2G) signal pattern. In a cell harboring the t(9;22), two orange, one green, and one orange/green (yellow) fusion signal pattern (2O1G1F) will be observed. This simple probe design detects the 5¶ BCR/3¶ ABL gene fusion and is useful for detecting samples with a high percentage of cells possessing this translocation. In this technique, more than 500 interphase and metaphase cells will be studied and therefore a more accurate result will be provided for the therapy management.
R. Kariminejad, Maryam Zangeneh, Azadeh Moshtagh, Tarlan Nayeb Bagher, Sorour Voghouie, Nargess Miraftabi, Faranak Zandi, Leila Hafizi, Haleh Aghili and Mohammad Hassan Kariminejad Kariminejad - Najmabadi Pathology & Genetics Center Today, cytogenetic study is a major factor in the prognostic profile of most cancers. Initial cytogenetic studies of bone marrow showed chromosomal aberrations in approximately half of all patients with ALL, 60% of those with AML. Later and more recent studies with the combined used of FISH and molecular techniques have shown that the average reported rates of chromosomal aberrations is at least 70Y80% in ALL patients and 85% in AML patients We received our first bone marrow sample in April 1998, and have studied more than 4500 bone marrow samples since. Among these, 1277 cases were 17 years or younger, 637 cases were referred for ALL, and 249 referred for AML, and the remainder for other reasons including CML, lymphoma, anemia, or unspecified. Table 1 The rate of referrals has increased yearly while the number of cases with unspecified indications has decreased accordingly. At the same time, the number of inconclusive cases has decreased and the number of cases with chromosomal aberration detection has increased. The results within the major referral groups ALL & AML are shown in figures 1 & 2. We would like to stress the various factors that could make cytogenetic study of bone marrow samples in childhood hematological disorders more. They include proper sampling in appropriate media before initiation of therapy, proper expedient delivery to the laboratory, sufficient information including initial diagnosis where available and possible diagnosis when not, close communication between the various laboratories involved including flow cytometry, pathology, molecular genetics, and the cytogenetics laboratory.
7.59-P 7.58-P
8 years experience with chromosomal study of childhood bone marrow samples
The MLL (myeloid-lymphoi or mixed lineage leukemia) implication in acute leukemia, using FISH technique
6th ECC: Abstracts
195
M. Zangeneh, Roxana Karimi-Nejad, Azade Moshtagh, Tarlan Nayeb-Bagher, Faranak Zandi, Hale Aghili, Sepideh Matin-far and Mohammad Hassan Karimi-Nejad
7.60-P
Kariminejad-Najmabadi Pathology & Genetics Center
A. Kariminejad, Mohammad Taghi Arzanian, Maryam Zangeneh, Azade Moshtagh, Tarlan Nayeb-Bagher, Majid Naderi, Aziz Eghbali, Hassan Mahmoodi and Mohammad Hassan Kariminejad
MLL (Mixed lineage Leukemia) gene located on chromosome 11 at q23 band region consist of 37 exons, spanning over 100 kb and is implicated in at least 10% of acute leukemias (AL) of various types: Acute Lymphoblastic Leukemias (ALL), Acute Non Lymphocytic Leukemias (ANLL), biphenotypic ALs, treatment related leukemias and infant leukemias. Although over 30 variant translocations have been seen involving MLL translocations, the most common abnormalities are t(4;11)(q21;q23), t(9;11) (p22;q23), t(6;11)(q27;q23), t(10;11)(p12;q23) and t(11;19)(q23;p13). We have performed FISH analysis as confirmatory test for suspicion of 11q rearrangements in routine cytogenetic analysis and generated report including colored hybridization picture for all of them. One-hundred interphase FISH analysis was performed using Vysis locus specific identifier MLL break-apart probe to detect the translocation of MLL. This probe is designed to detect the 11q23 rearrangement associated with various translocations involving the MLL gene and consists of a 350 kb portion centromeric of the MLL gene breakpoint cluster region (bcr) labeled in spectrum green and approximately 190 kb portion largely telomeric of the bcr labeled in spectrum orange. In approximately 25% of 11q23 translocations, a region beginning at the MLL breakpoint and extending distally is deleted. The signal pattern observed in a cell lacking the MLL rearrangement is expected to show a two orange/ green (yellow) fusion signal pattern (2F). In a cell possessing a MLL translocation, the expected pattern is one green/orange (yellow) fusion signal, one orange signal, and one green (1O1G1F) signal. In 3 of the case (a 43 year old male, 23 weeks old female infant and a 28 weeks old male infant), all the cells showed two yellow fused signals corresponding to intact MLL gene in 11q23. The other two cases (an 26 weeks old male infant and 1-year old female child), a percentage of the cells showed one yellow fused signal and one red, one green signal corresponding to break apart and translocation of the MLL gene in 11q23.
N-myc amplification in neuroblastomas
Kariminejad Najmabadi Genetics & Pathology Center, Mofid Children_s Hospital, Tehran, Iran Neuroblastoma belongs to the group of Fsmall blue round cell_ tumours of the children, it is a tumour of the sympathetic nervous system. Prognosis is very poor in most cases (median survival 1 yr), cytogenetic and genetic anomalies are of important prognostic value. Chromosomal study can be performed on fresh tumor biopsies and will detect the status of the tumor cells numerically and structurally. Aneuploid tumours (near triploid, pentaploid or hexaploid), with whole chromosome anomalies, often with relative gains of chromosomes 17, 7, 6, relative losses of chromosomes 11, 14, are low grade tumours, with good prognosis. Whereas diploid and/or tetraploid tumours, with 1p deletion -minimal critical region being 1p36- in 40% cases, 11q deletion, trisomy or tetrasomy for 17q21qter (in 90% of high grade tumours), DM or HSR (MYCN amplification) are often associated with high grade tumours, and bear a grave prognosis. MYCN amplification is associated with 1p deletion and partial 17q polysomy, and is inversely related to 11q deletion. However, as study of fresh tumor is always not possible, the use of FISH techniques for detection of MYCN amplification levels has become increasingly available. In cases where the copy number exceeds 10, amplification is inferred and where copy numbers below 10 are observed, an aneuploid tumor is assumed. Amplification of MYCN is found in various tumours, in particular neuroblastoma; the level of amplification increases with tumour progression and is a critical factor in determining treatment and therapy options. We have obtained 6 fresh tumor samples from children diagnosed with neuroblastoma in Mofid children_s hospital. These samples have been studied for MYCN amplification using the Vysis FISH probe. In 5 of the 6 cases there is no MYCN amplification, however there is triploidy, tetraploidy
6th ECC: Abstracts
196 and hexaploidy in 3 cases. In 1 case MYCN amplification was detected. The technique can be applied to paraffin embedded tumor samples and will determine ploidy levels and MYCN amplification with relative accuracy.
7.61-P
Genetic characterization of primary cutaneous T-cell lymphomas by array comparative genomic hybridization: preliminary results B. Espinet, R. Salgado, O. Servitje, Bibiana Ferreira, F. Gallardo, T. Estrach, M. Salido, M. P. Garcı´a-Muret, R. M. Pujol and F. Sole´ Hospital del Mar, Ciutat Sanita`ria Universita`ria de Bellvitge, Centro Nacional de Investigaciones Oncolo´gicas, Hospital Clı´nic, Hospital de Sant Pau Introduction: Primary cutaneous T cell lymphomas (CTCL) represent 70% of all cutaneous lymphomas. Among them, the most frequent is mycosis fungoides/Se´zary syndrome (MF/SS) followed by primary cutaneous anaplastic large cell lymphoma CD30+ (ALCL). In these entities, few high resolution cytogenetic studies have been performed. Genetic aberrations described in their nodal counterparts do not seem to be involved in their pathogenetic process. The aim of the study was to analyze chromosomal abnormalities (gains and/or losses) in CTCL by array-CGH. Patients and methods: Thirty-three patients (15 MF tumoral stage, 14 ALCL and 4 other CTCL) were included in the study. DNA was extracted from frozen tissues containing more than 70% of tumor cells. At present, nineteen patients (10 MFt and 9 ALCL) have been studied by array comparative genomic hybridization (aCGH) using the Humane Genome CGH Microarray Kit 44B (Agilent Technologies). The array consists on 44.000 oligonucleotide probes of 60 bp covering all the human genome with a mean resolution of 50Y100 Kb. CGHAnalytics 3.2.25 was used for array analysis. Results: Cytogenetic imbalances were observed in 18/19 cases. Among the 10 MFt cases, the mean chromosomal imbalances per case were 5.7 gains and
3.9 losses. The most common aberrations were +7 (40%), +7q21q36 (60%) and j9p12 (50%). In contrast, in ALCL, the mean chromosomal imbalances per case were 0.8 gains and 3.8 losses, being the most relevant abnormalities monosomy 19 (44%) and loss of 17p12-p13.2 (55%). Conclusions: -CLCT show multiple chromosomal abnormalities: in MF, gains are more frequent whereas in ALCL, losses are predominant. -In MF, gain of 7/7q has been detected, as previously described. -In ALCL, the most common aberration is loss of 17p12p13.2 and monosomy 19. -More cases are being hybridized by aCGH and carefully analyzed in order to confirm our results. Aknowledgements: Grant FIS PI051827 from the ISCIII, Xarxa de Limfomes Cutanis de Catalunya, Spain.
7.62-P
Molecular cytogenetic characteristics of B-cell lymphoma with complex translocation (8;14;18) R. Lasan Trcic, I. Kardum, D. Sustercic, I. Fabijanic, P. Korac, M. Dominis, D. Begovic and B. Jaksic University Hospital Centre Zagreb The functional consequence of gene dysregulation in lymphoid lineage development and lymphomagenesis may be effected by juxtaposition of homeobox (Hox) genes with imunoglobulin heavy chain gene (IGH). Specific chromosomal translocations are closely associated with distinctive subtypes of nonHodgkin lymphoma (NHL). Concurent activation of BCL2 and MYC usualy occurs in B-cell nonHodgkin lymphoma (B-NHL) by translocation of both oncogenes to both IGH alleles. Here we describe B-NHL molecular cytogenetic analysis culture of bone marrow from 51-year-old female patient at diagnosis. A bone marrow aspirate contained 38% atypical lymphoblast cells with multiple vacoules. Imunophenotipic evaluation showed expresion of CD19, CD20, CD30, CD38 AND clonal Ig kappa light chains and negative of CD10. Morphology and immunologic phenotype identified an ALL L3 subtype (Burkitt). This indicates clonal evolution or clonal selection. Conventional
6th ECC: Abstracts cytogenetics revealed two normal cells with karyotype 46,XX and compositum karyotype: 47,XX,del(2),del(3q),der(8q?24),-13,t(14;18) (q32;q21),del(15q),+2mar in 20 metaphases. Specific t(14;18) was present in 60% of analysed metaphases, and also suggested t(8;14). FISH studies on metaphase chromosomes and directly on parafin-embedded tissue section with MYC/IGH and IGH/BCL2 probes showed complex translocation (8;14;18)(8q24; q32;q21) leading to activation of MYC at 8q21 and BCL2 at 18q21 allels via juxtaposition with IGH locus at 14q32. Future investigations are needed to disclose structure of other reanged chromosomes.
7.63-P
Multiple cytogenetic anomalies detected in the pleural fluid of a patient with relapsed ewing_s sarcoma O. Ozalp Yuregir, F. I. Sahin, Z. Avci, Z. Yilmaz, B. Celasun and F. Sarialioglu Baskent University Faculty of Medicine Department of Medical Genetics, Ankara, Turkey, Baskent University Faculty of Medicine Department of Pediatric Oncology, Ankara, Turkey, Basknet University Faculty of Medicine Department of Pathology, Ankara, Turkey, Baskent University Faculty of Medicine Department of Pediatric Oncology, Ankara, Turkey Ewing sarcoma is the second most common solid bone and soft tissue malignancy in children and young adults that belongs to a histologically heterogeneous family of small round-cell tumours that derive from mesenchymal progenitor neural crest cells. A consistent reciprocal translocation t(11;22) (q24;q12) is found in 90% of all Ewing sarcomas that results in the fusion of the EWS and FLI1 genes. We report a 6-year-old male patient with a right paraspinal tumour, diagnosed as high-risk (metastatic) Ewing sarcoma. After six cycles of chemotherapy involving iphosphamide, vincristine, adriamycin and actinomycin-D (EICESS 92 study protocol), he had local recurrence with pleural effusion. The pleural fluid along with the bone marrow was sent to our laboratory for karyotyping. Bone marrow cultures
197 revealed a normal karyotype, whereas 48,XY,i(1) (q11),+10,t(11;22)(q24;q12) karyotype was found in the cells obtained from the pleural fluid cultures. Trisomy 1q is quite frequently observed in Ewing sarcoma patients, mostly as part of unbalanced translocations, along with the common t(11;22) translocation. This patient_s findings were significant, as we were able to show the complex karyotype in the pleural effusion cells.
7.64-P
MYC amplification in form of double minutes, extrusion and formation of micronuclei in two cases of acute myeloid leukemia without maturation Salido, O. Villa, A. Ferrer, E. Pe´rez-Vila, B. Espinet, C. Pedro, S. Serrano, S. Woessner, L. Florensa and F. Sole´ Hospital Del Mar Introduction: In AML double minutes (DMs) are rare, present only in 4.5% of cases and they are usually associated with AML with maturation (M2FAB subtype). Micronuclei have been defined as an aggregation of genetic material in the nucleus that can be removed from the cell by extrusion. In this regard, the elimination of amplified MYC (8q24) via micronuclei has been correlated with loss of tumorigenicity. Patients and Methods: We have analyzed the incidence of DMs, on patients diagnosed of AML in our institution, from January 2000 to December 2006 (n=2/137=1.4%).We present two cases diagnosed as AML without maturation or AML-M1 (FAB subtype)with DMs in karytotype. We apply for their study G banding cytogenetics and FISH using MYC/IGH/CEP8, CBFb and PML/RARA probes in order to characterize DMs and derivative chromosomes. RT-PCR analyses specific for PML/ RARA rearrangement were performed due to strong MPO staining. Our two patients started treatment but died after three month after diagnosis. Results: Morphologically, both cases were characterized by the presence of extrusion of chromatinic material (May-Gru¨nwald Giemsa stain). These two cases showed a complex karyotype including
6th ECC: Abstracts
198 approximately 10~30 DMs containing MYC gene detected by FISH. After apply FISH, we observed the phenomenon of DMs aggregation in interphase cells and the subsequent formation of micronuclei with MYC amplification (only 1Y5% of micronuclei). In our two patients the amplified region (8q24) was deleted in one of the chromosome 8 homologues, suggesting the excision of this DNA segment prior to its amplification, according to the Bepisome model[. PML-RARA fusion was discarded by RT-PCR and FISH. Conclusion: We can speculate that the small percentage (1Y5%) of MYC exclusion in our two patients was in accordance with the poor prognosis,since elimination of DMs via micronuclei has been correlated with loss of tumorigenicity. The morphological evidence of cytoplasmic micronuclei and extrusion of chromatinic material in blast cells could be a cytological marker for MYC amplification.
7.65-P
Gene expression profiles by oligonucleotide microarrays in meningiomas: association with chromosomal aberrations Tabernero, Merino Marta, Maillo Angel, Gil Bellosta Carlos, Castrillo Abel and Orfao Alberto Hospital Universitario De Salamanca, 4Centro de Investigacio´n del Ca´ncer IBMCC/CSIC-USAL, Cytometry General Service and Department of Medicine, University of Salamanca Recent data clearly indicates that tumour cytogenetics is one of the most powerful tools for predicting disease recurrence in meningiomas, even among histologically benign/grade I tumors. Despite this, no study has been reported so far in which the impact of tumour cytogenetics in the patterns of gene expression has been analyzed in meningioma patients. In the present study, we analyzed the gene expression profiles of 47 tumours and correlated it with the clinically most relevant cytogenetic subgroups of meningiomas, as confirmed through the analysis of a series of 172 patients. In addition, three normal meningeal cell samples were also studied and used as controls. Overall, our results show a clear association between the clinically relevant cytoge-
netic subgroups of meningiomas including diploid tumours (n=18), cases with an isolated j22/j22q (n=12), del(1p36) alone (n=4) and complex karyotypes associated with del(1p36) and/or j14q(n=13) and their patterns of gene expression. Accordingly, based on the expression of a group of 85 genes (40 of which were coded in the altered chromosomes used for patient stratification) the cytogenetic class of the tumour could be predicted with an error of G1%. In contrast, no clear association was found between the patterns of gene expression and tumour histopathology. In summary, in the present study we show a clear association between the genomic profiles of tumor cells and the different clinically relevant cytogenetic subgroups of meningiomas. The exact biological significance of the altered pathways of gene expression as well as the identification of the relevant genes associated with tumour behaviour, require further investigation. Supported by grants from the Fondo de Investigaciones Sanitarias (FIS 02/0010, Madrid, Spain) y Fundacio´ n MMA (Madrid, Spain) and RETICC RD06/0020/0035 from the Instituto de Salud Carlos III, Ministerio de Sanidad y Consumo, Madrid.
7.66-P
AML1 amplification detected by FISH on the archived bone marrow smear Podgornik, H. Kavcic, P. Cernelc and J. Jazbec Hematology Department, Medical Center Ljubljana, University Children_s Hospital, Medical Center Ljubljana AML1 amplification was found in a 13 years old patient with AML M4/M5 leukemia which appeared 5 years after common-B ALL was diagnosed. Due to the lack of cytogenetic data from the time of first diagnosis (standard cytogenetics failed) we tried to perform FISH analysis on the only available sample of bone marrow cells, the archived bone marrow smear previously stained by May-Grunwald/Geimsa. The main obstacle was that the archived cells were not fixed before the first staining. Bone marrow smear from 2001 was destained in fresh methanol first. After third methanol wash the slide was air dried and then soaked in a series of ethanols. We proceeded with a slide pretreatment following the standard bone
6th ECC: Abstracts marrow pretreatment protocol and FISH denaturation step. Immediately after the slide was exposed to warm formamide solution the cells were released from the slide surface together with the remained protein matrix which was not completely removed by pepsinisation. No fixation compatible by FISH method worked and cells were lost form the glass surface during formamide denaturation step. Therefore, the cells together with the protein matrix were collected into PBS solution and left at room temperature over night. The buffer was changed and cells were fixed with methanol/acetic acid fixative. FISH analysis was then carried on fixed cells following the routine FISH procedure. As a control the slide with a normal bone marrow smear from 2001 stained by May-Grunwald/ Geimsa was used going through the same procedure simultaneously with the sample slide. Clear orange signals were obtained for AML1 genes although cells differ in shape and size considerably. They were smaller than cells obtained by normal isolation procedure and the chromatin structure was disturbed to some extent. The cell number was small but we were able to analyze 200 nuclei of the patient. FISH analysis on archived bone marrow confirmed overexpression of AML signals as well as clustering of AML1 signals typical for AML amplification.
7.67-P
Spontaneous micronucleus frequency in the bone marrow cells of patients with leukemia Sevinc Basak, Ozturk Sukru, Palanduz Sukru, Bagatir Gulcin, Ucur Ali, Bayrak Aysegul, Cefle Kivanc, Perdeci Oktay, Kalayoglu-Besisik Sevgi and Dincol Guncag Student of MSc in Medical Genetics Programme in Institute of Health Science, Istanbul University, Istanbul Medical Faculty, Department of Internal Medicine, Division of Medical Genetics., I, Istanbul University, Istanbul Medical Faculty, Department of Internal Medicine., Istanbul University, Istanbul Medical Faculty, Department of Internal Medicine, Division of Hematology., Istanbul University, Istanbul Medical Faculty, Department of Internal Medicine, Division of Hematology
199 Purpose: Micronuclei (MN) may arise from partially or totally mitotic loss of chromosomes. MN frequency, which is a cytogenetic biomarker of genotoxicity is used for assessment of radiation induced genomic instability. We aimed to assess the genomic instability in patients with leukemia by detection of MN formation. Material and methods: According to a previously described method we detected the presence of spontaneous frequency of MN in uncultured bone marrow cells in patients with leukemia (13 patients with acute leukemia, 7 with chronic myeloid leukemia; mean age 44.28T18.47 between 3.5Y69 years of age, sex ratio: F/M=7/10). The control group consisted of 8 bone marrow donors (mean age:26.25T9.70; sex ratio : F/M=1/7). The frequencies of MN in the study and the control groups were compared by using Mann-Whitney U test. Results: We observed statistically increased MN frequency in the study group compared with the control group (9.2T4.91, 4,62T1,84 respectively; p=0.01). Conclusion: These findings support the presence of genomic instability indicated by increased MN frequency in bone marrow cells of leukemia patients.
7.68-P
Cytogenetic and arrayCGH analysis in a series of childhood renal tumors Stejskalova´, M. Jarosˇova´, H. Pospı´sˇilova´, J. Malisˇ, R. Kodet and J. Stary´ Department of Pediatric Hematology and Oncology, University Hospital Motol-Prague, Czech Republic, Department of Hemato-oncology, Palacky University Hospital Olomouc, Czech Republic, Department of Pathology and Molecular Medicine, University Hospital Motol-Prague, Czech Republic Many of the common pediatric renal tumors contain characteristic cytogenetic aberrations with substantial diagnostic and prognostic relevance. By far the most common renal neoplasm, diagnosed in children, is nephroblastoma (Wilms tumor, renal embryoma). Treatment is generally very successful, with about 85% of affected children expected to be long-term survivors. However, successful treatment of relapsing
6th ECC: Abstracts
200 or nonresponding Wilms tumors remains a challenge. Reliable identification of tumors likely to show aggressive behavior would allow selection of patients for risk-adapted therapy. Cytogenetic and recently arrayCGH studies have shown that some chromosomal changes have prognostic significance. Cytogenetic abnormalities of prognostic significance include karyotype complexity, gain of material from the long arm of chromosome 1 and allelic losses from the short arm of chromosome 1 and from the long arms of chromosomes 11,16 and 22. Among those, 1q gain and monosomy 22 were highlighted as markers of increased relapse risk. In our study we have compiled a series of 12 cases of mostly previously untreated Wilms tumors, one rhabdoid tumor of the kidney, one mesoblastic nephroma and one rare childhood renal tumor Y Grawitz renal adenocarcinoma. By cytogenetic analysis, we have detected abnormal clonal aberrations in all but two cases. The detected changes were numerical as well as structural and mostly involved chromosome 1, either presenting with a deletion of 1p or the formation of an isochromosome 1q. One Wilms tumor, with lung metastases at diagnosis, exhibited an unfavorable prognostic marker del(22q). We have detected an atypical t(2;8), which was not yet published, in a relapsed patient. In our report, we have correlated cytogenetic findings with histological and clinical features and patient outcome. To gain further insight into genetic events responsible for the pathogenesis, arrayCGH was performed on 5 tumor samples. The work is supported by grant IGA MZ NR/9050-3.
phoma. Flowcytometry, immunohistochemistry and cytology of the bone marrow showed infiltration of the lymphoma cells with characteristics of Burkitt lymphoma. Chromosomal analysis of bone marrow cells resulted in the following karyotype: 48,XY, +3, +5, del(6)(q14q16), add(10)(q22), t(14;18) (q32;q21) [12]/ 46,XY[1]. Translocation (14;18) is characteristic for follicular and diffuse large B-cell nonHodgkin lymphoma. To our surprise, FISH analysis on metaphases with a probe for the c-MYC gene (8q24) showed a t(3;8) with rearrangement of the c-MYC gene. Rearrangement of this gene is one of the characteristic features of Burkitt lymphoma. According to the literature, the combination of t(14;18) and 8q24/c-MYC translocation is rare and seems to be specifically involved in an aggressive type of diffuse large B-cell lymphoma with Burkitt characteristics. This type of lymphoma is usually associated with a poor prognosis and a median survival of 9 months.The patient has been treated with intensive chemotherapy for 6 months. A chest CT-scan and bone marrow examination, performed 6 months after the start of treatment, showed a complete remission.
7.69-P
Mojtahedi, Dr. F. Seirati, Dr. E. Keyhani, Dr. Sh. Akhlaghpour, Dr. M. Karimloo, Ms. S. Ghasemi Firouzabadi, Mr. I. Bagherizadeh and Dr. F. Behjati
BURKITT-like lymphoma associated with concurrent t(14;18) and 8q24/c-MYC translocation Kroes, Corine Buitenhuis, Marie-Joze´ Verdonk, Shama van Zelderen-Bhola, Patty Jansen and Erik Marijt Leiden University Medical Center A 61-year old male presenting with shortness of breath, back pain and fever was admitted to the hospital. A chest CT-scan showed a large tumour in the right lung. Pathological examination of the tumour revealed a large B-cell non-Hodgkin lym-
7.70-P
Investigation of chromosome breakage as a risk factor in the development of sporadic breast cancer amongst Iranian women
Genetics Research Center, University of Social Welfare and Rehabilitation Sciences, Mehrad Hospital, Tehran, Iran, Genetics Research Center, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran, Novein Irradiation Center, Tehran, Iran, Department of Statistics, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran, Genetics Research Center, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran More than 90% of breast cancer is sporadic and it is thought that many low peneterant genes can contribute
6th ECC: Abstracts
201
towards increased risk for breast cancer. The radiosensitivity of cells could be one of these predisposing factors. Chromosome breakage can happen in the lymphocytes and fibroblasts of a number of autosomal recessive disorders with high risk of cancer such as ataxia telangiectasia or fanconi anaemia. The use of cytogenetics techniques to investigate chromosome breakage at the G2 stage of cell cycle is a standard protocol for such studies. Different reports have shown the level of chromosome breakage among women with breast cancer as 30-40% compared to normal population. In this pilot study the level of radiosensitivity of lymphocyte cells at G2 stage of cell cycle in 30 Iranian women with sporadic breast cancer is compared with 30 normal women. The level of chromosome aberrations in the two groups and the relationship between chromosome breakage and various clinical and immunohistochemical parameters in the breast cancer patients will be presented.
nography showed a complex neurological anomaly with followYup fetal MRI at 19 weeks showing an absent corpus callosum, right cortical dysplasia and a left facial tumour diagnosed as an NPT. Analysis of the tumour specimen showed a mosaic karyotype with tetrasomy 1q due to a 47,XX,+i(1)(q10) cell line. Unexpectedly this abnormal cell line was also detected in placental tissue. To the best of our knowledge this is the first reported case of supernumerary i(1q) detected in placenta from a fetus with NPT.
7.71-P
Ucur Ali, Bayrak Aysegul, Serakinci Nedime, Bagatir Gulcin, Palanduz Sukru, Ozturk Sukru, Cefle Kivanc, Yavuz Selim, Nalcaci Meliha and Dincol Guncag
Tetrasomy 1q detected in placenta and tumour from a fetus with Nasopharyngeal Teratoma Jennifer Bryan, Lesley Clark and Rohan Lourie Cytogenetics, Mater Health Services, Anatomical Pathology, Mater Health Services Fetal teratomas are among the most common neoplasms found in the newborn with an incidence of approximately 1 per 35,000 live births. They are comprised of tissues that are foreign to the tissue on which they arise and occur in a variety of locations in the craniospinal region. Naso/oro-pharayngeal teratomas (NPT) are however rare and account for only 2Y3% of all teratomas. Prenatally detected NPT are even rarer. In only a relatively few cases has prenatal or postnatal cytogenetic investigation of NPT been undertaken. In a number of these cases tetrasomy 1q was detected as the sole chromosomal aberration. We present a case of a 33 year old G1P0 female who presented at 18 weeks gestation with no significant medical history. Amniotic fluid karyotyping had been performed elsewhere and shown a 46,XX karyotype, with no abnormality detected. High resolution ultraso-
7.72-P
The use of FISH/M-FISH in patients with hematological malignancies for further characterization chromosomal abnormalities detected on conventional cytogenetic analysis
Istanbul University Istanbul Medical Faculty, Istanbul University, Istanbul Medical Faculty, Department of Internal Medicine, Division of Medical Genetics, Department of Human Genetics, University of Aarhus, Aarhus, Denmark, Istanbul University, Istanbul Medical Faculty, Department of Internal Medicine, Division of Medical Genetics, Istanbul University, Istanbul Medical Faculty, Department of Internal Medicine, Division of Hematology Cytogenetic analysis is an important technique performed for prognostic and diagnostic purposes in leukemia patients. The structural and numerical chromosomal abnormalities can be detected in the majority of patients with conventional cytogenetic analysis. Fluorescence In Situ Hybridization (FISH)/MultiplexFISH (M-FISH) can be used to determine complex rearrangement, unbalanced translocation and marker chromosomes that can not be identified by conventional methods. In our study, High Resolution Banding (HRB) and FISH was performed in the leukemic cells of eight patients; four with Acut Myeloid Leukemia
6th ECC: Abstracts
202 (AML) and four with Chronic Myeloid Leukemia (CML). In six patients numerical or structural abnormalities found on conventional cytogenetic analysis were confirmed with FISH. In two patients complex translocations were identified and the chromosomes that participated at this translocations were determined completely with M-FISH. We conclude that combined use of both techniques are extremity useful for identifying chromosomal abnormalities in patients with hematological malignancies.
7.73-P
Variant Philadelphia translocations in patients with Chronic Myeloid Leukemia Bayrak Aysegul, Ucur Ali, Palanduz Sukru, Ozturk Sukru, Cefle Kivanc, Bagatir Gulcin, Yenerel Mustafa Nuri, Kalayoglu-Besisik Sevgi, Diz-Kucukkaya Reyhan and Dincol Guncag Istanbul University, Istanbul Medical Faculty, Istanbul University, Istanbul Medical Faculty, Department of Internal Medicine, Division of Medical Genetics, Istanbul University, Istanbul Medical Faculty, Department of Internal Medicine, Division of Hematology During the chronic phase, nearly all patients with Chronic Myeloid Leukemia (CML) show the classical Philadelphia translocation, t(9;22)(q34;q11), or a variant translocation on conventional cytogenetic anaysis. The occurence of the Philadelphia chromosome in a fusion between the BCR and ABL1 genes. Variant philadelphia (Ph) translocations can present in simple or complex forms and have been reported in 5Y10% of patients with CML. In our study, we detected variant Ph translocations in bone marrow samples of seven patients with CML. In three of these cases a simple variant translocation and in four complex variant translocations were identified. In each of the three cases with variant translocations there were also a secondary abnormality: -Y in one patient, +del(22)(q11) in another and del(19)(p13) in the third. In three cases with complex translocations, chromosome abnormalites disappeared completely after Imatinib Mesilat (IM) treatment. It has been reported that after IM treatment, prognosis is similar
in patients with variant translocations and patients with classic Ph translocations.
7.74-P
Deletion mapping OF 2q21-37 region in oral cancer Cengiz, M. Gunduz, H. Nagatsuka, L. B. Beder, E. Gunduz and N. Nagai Okayama University, Graduate School of Medicine, Dentistry and Pharmaceutical Science, Okayama University, Graduate School of Medicine, Dentistry and Pharmaceutical Science, Department of Otolaryngology Tumor suppressor genes are defined as genetic elements whose loss or mutational inactivation allows cells to display one or more phenotypes of neoplastic growth. Frequent deletion in a chromosomal region suggests existence of a candidate tumor suppressor gene. We analyzed Ch2q22-37.3 region by using 17 polymorphic microsatellite markers in 39 matched oral normal and cancer tissues. Loss of heterozygosity (LOH) was detected at least one location in 36 of 39 (92%) tumor tissues. High deletions were detected at microsatellite marker locations, D2S2304 (35%), D2S111 (40%), D2S155 (35%), D2S164 (29%), D2S125 (71%) and D2S140 (39%). Three frequently deleted regions at 2q22, 2q35-36 and 2q37.3 were observed. Chromosomal 2q22-37.3 region is highly populated with genes. Several candidate tumor suppressor genes in this region including such as ING5, CASP8, CASP10, PPP1R7 and BOK are located. We are currently analyzing inactivation mutations and mRNA expressions in oral squaomus cell carcinomas.
7.75-P
add(12)(q24) and trisomy 14 acquired during clonal evolution in a patient with atypical myeloproliferative disorder harboring t(8;13)(p12;q12) Fahri Sahin, Ertan Ay, Erdinc Yuksel, Yes¸im Ertan, Serkan Ocakci, Murat Tombuloglu, Guray Saydam and Zeynep Sercan
6th ECC: Abstracts Ege University Hospital, Department of Hematology, Dokuz Eylul University Hospital, Dept. Medical Biology and Genetics, Ege University Hospital, Dept. of Pathology 8p12 myeloproliferative syndrome (EMS; also known as the stem cell leukemia syndrome- SCLL) is a rare atypical myeloproliferative disorder associated with chromosomal abnormalities involving the 8p12 chromosome band. Translocations associated with this syndrome result in the fusion of the fibroblast growth factor receptor 1 (FGFR 1) gene with various partners, resulting in ligand independent FGFR activity. The most commonly observed translocation of this syndrome is t(8;13)(p12;q12), which results in the expression of a chimeric ZNF198-FGFR1 tyrosine kinase. We hereby present a case diagnosed as atypical chronic myeloproliferative disease with consistent t(8;13)(p12;q12). Add(12)(q24) along with trisomy 14 was observed as additional acquired anomalies during progression of disease which rapidly transformed to Bcell acute lymphoblastic leukemia.
7.76-P
Low frequency of favorable genotypes in pediatric precursor B-cell acute lymphoblastic leukemia patients in western Turkey Sercan, H. Ogu¨n Sercan, Erdinc¸ Yu¨ksel, Sefa Kizildag, Sultan Cingoz, Canan Vergin, Hale Oren, Haldun Oniz and Meral Sakizli Dokuz Eylul University Hospital, Dept. of Medical Biology and Genetics, Izmir Behcet Uz Children Hospital Hematology and Oncology Department, Dokuz Eylul University Hospital, Department of Pediatrics, Izmir Tepecik Education and Research Hospital, Department of Pediatrics Specific genetic abnormalities that directly affect therapeutic strategies have been defined in acute lymphoblastic leukemia. Relative frequencies for these genetic abnormalities have been calculated in industrialized countries of the West and Far East with limited data of these rates in developing countries. We have conducted a retrospective analysis of data obtained at diagnosis, in which we report
203 the molecular and cytogenetic evaluation and frequency of t(4;11)(q21;q23), t(9;22)(q34;q11), t(12;21)(p13;q22) and t(1;19)(q23;p13) in a series of 186 pediatric precursor B-cell ALL patients. Our study shows a relatively low frequency of prognostic variables that predict favorable outcome in patients from Western Turkey. An increased rate in hypodiploidy when compared with reported frequencies in the West is also observed, suggesting a propensity towards genotypes with poor prognosis. Geographic variations of ALL genotype among different populations are still a controversial topic. More population studies especially in developing countries are needed to elucidate environmental and demographic factors contributing to leukomogenesis and genotypically different ALL subtypes.
7.77-P
Conventional cytogenetic (CC), fluorescence in situ hybridization (FISH) and comparative genomic hybridization (CGH) analysis in patients with myelodysplastic syndromes (MDS) Skonieczka, Olga Haus, Ewa Duszenko, Barbara Mucha, Mariusz Babicz, Elzbieta Wyrowinska and Wojciech Swistek Collegium Medicum UMK, Bydgoszcz, Department of Clinical Genetics, Collegium Medicum UMK, Bydgoszcz; Department of Hematology, Medical University, Wroclaw, Department of Hematology, Medical University, Wrocław, Department of Pediatrics, Hematology and Oncology, Cytogenetic Laboratory, Children_s University Hospital, Lublin, Department of Hematology, City Hospital, Torun, Department of Hematology and Internal Diseases, Regional Hospital, Bydgoszcz Introduction: Myelodysplastic syndromes (MDS) are a group of clonal bone marrow disorders. They are characterized by peripheral blood cytopenias, ineffective hematopoesis, increased apoptosis and propensity to evolve into acute myelogenous leukemia (AML).
6th ECC: Abstracts
204 Patients: 58 patients (23 women and 35 men), aged 22Y89 at the time of diagnosis were included in the study. According to FAB classification 12 women and 13 men had MDS-RA, 1 woman and 3 men had RARS, RAEB type was present in 1 woman and 8 men, CMML in 1 woman and 1 man. One woman had hypoplastic MDS. Material and Method: Bone marrow cells were obtained from 24Y48 hour cultures in RPMI supplemented with 20% FBS, with or without GM-CSF. In each patient 15Y20 GTG-banded metaphases were analysed. The conventional cytogenetics was combined with fluorescent in situ hybridization (FISH) with following probes: cen7/8, 5q31, 7q35, 17p13, 20q13.3. Whole chromosome painting probes and telomere probes were used in cases where complex karyotypes were present. Results: Conventional cytogenetics revealed normal karyotype in 27 patients. In 11 patients the karyotype appeared to be simple. The sole chromosome aberrations were: -5, 5q-, 17p-, 12p-, +6, +8, +19, -18, 11q-, 11p+, -Y. 11 patients had complex karotype (structural and numerical changes). Conventional cytogenetics failed in 6 patients. The FISH analysis was helpful in finding clonal changes in patients with normal karyotype. The CGH was performed in 8 patients with complex karyotypes to detect unbalanced changes which were later confirmed using the FISH technique: t(12;14), t(5;18), t(2;11;20), t(1;6), t(7;12), t(1;13), t(5;19), t(7;11), t(7;21), t(16;16), t(3;9;16), t(17;20), t(12;15), t(7;15), t(4;6), t(1;14).
7.78-P
Incidence of numerical chromosome aberrations in breast tumors from Egyptian patients as revealed by fluorescence in situ hybridization using chromosome-specific probes Aly and Manal F. Ismail Faculty of Science, Beni Suef University, Faculty of Pharmacy, Cairo University, Egypt Breast cancer is the most common malignancy among women and accounts for over one million new cases worldwide per year. Genetic heterogeneity
is high in breast cancer, and hence it is difficult to link a specific chromosome alteration to a specific clinicopathologic feature. In this study, FISH was applied to examine clonal chromosomal aberrations in breast tumors from Egyptian patients and statistically correlated the findings with clinical-histopathological parameters of the patients. The study was conducted on 34 samples obtained from 33 females and 1 male with breast carcinomas and 17 samples obtained from 16 females and 1 male with benign breast lesions. Our results revealed that the average number of chromosomal aberrations in the malignant group was significantly increased as compared to the benign group. The most common abnormalities were gains of chromosomes 4, 5, 6, 8, 9 and 12, as well as losses of chromosomes 17, 18, 20, 21 and X. Our findings suggest that tumors with specific chromosomal aberrations of chromosomes 4, 6, 12, 17, 18, and X result in an aggressive form of breast cancer. A statistically significant correlation was found between clonal aberrations in chromosomes 17, 20, and 21 and positive lymph node involvement (LN+) and between clonal aberrations in chromosomes X and 6 and negative involvement (LNj). The mean number of chromosome aberrations did not differ significantly among tumor grades. Further cytogenetic investigation of breast tumors and their variable pathological features is undoubtedly necessary. The recognition and ultimately the molecular understanding of these abnormalities may improve breast cancer taxonomy and provide important prognostic information for both the patient and clinician.
7.79-P
A novel translocation t(8;10)(q12;p13) in acute myeloid leukemia M. Talavera Yagu¨ez, M. T. Ferro, C. Villalo´n, A. de Leo´n, J. M. Garcı´a-Sagredo, P. Garcı´a Miguel, M. Polo and C. San Roma´n Hospital Universitario Ramo´n y Cajal, Servicio de Oncohematologı´a Infantil. Hospital Universitario La Paz. Madrid, Servicio de Hematologı´a. Hospital Clı´nico. Madrid In acute myeloid leukemia (AML), among others, appears several frequents rearrangements as t(8;21)
6th ECC: Abstracts (q22;q22), t(15;17)(q22;q21), and inv(16)(p13;q22), that have given way to define subtypes of this disease. Other new translocation would contribute to the discovery of new genes involved in leukemogenesis. We have studied two patients with AML, a M4 type and another M5 type of the FAB classification, in which we found a new translocation t(8;10)(q12;p13) as single anomaly. The first patient is a 74-year-old male diagnosed of AML M5 type of the FAB classification. At diagnosis, bone marrow karyotype was: 46,XY,t(8;10)(q12;p13)/46,XY. The second patient is a two year-old girl diagnosed of AML M4 type of the FAB classification. At diagnosis, bone marrow karyotype showed 45, XX, t(8;10)(q12;p13),-der(8)t(8;10)(q12;p13)/ 45,XX,t(8;10)(q12;p13),-der(8)t(8;10)(q12;p13),del(9)(p13),r/ 46,XX. Different chromosomal abnormalities, mainly, deletions and translocations that affect chromosome 11 at band q23, have been related to the AML types that these patients showed. To our knowledge, the observed t(8;10) has not been published yet, therefore their meaning remain unknown. The translocations found in leukemic karyotype as single anomaly and repeated in several patients, like in this report, open the possibility of a future new therapeutic target.
7.80-P
The t(3;5)(q21~27;q31~35) translocation in AML/MDS: a further three case reports and review of the literature Porter, D. Mu¨hlematter, S. Bougeon, N. Mercanton, M.-C. Ruchet, V. Beyer, V. Parlier, C. Arber, M. Stalder and M. Jotterand Centre Hospitalier Universitaire Vaudois, Ha¨matologische Abteilung, Kantonsspital, Basel, Service d_He´matologie, Laboratoire Consilia, Sion The t(3;5) translocation and its variant, ins(3;5), is a infrequent non-random abnormality that has been documented both in AML and MDS and which results in an NPM1/MLF1 gene fusion in many, but not all, reported cases. The breakpoints described in the literature vary considerably and range from 3q21~27
205 and 5q31~35. Other authors have already addressed the question of true molecular heterogeneity versus variability of interpretation of the breakpoints by conventional cytogenetics and have elucidated the nature of the resulting genetic rearrangements in some of the more recently described cases. We report a further three cases of t(3;5) as a sole abnormality at disease presentation (in a 50-year-old male patient diagnosed with AML-M2, a 35-year-old female patient with AML-M2 and a 52-year-old female patient with RAEB-T). The results obtained both by G-banded chromosome analysis and fluorescence in situ hybridisation are presented, together with an overview of the literature to date, thus reviewing the evidence for this translocation representing a clinically distinct subtype of AML/MDS as previously suggested.
7.81-P
Cytogenetic aberrations in intracranial pediatric ependymoma discriminate younger from older patients Annalisa Pezzolo, Valeria Capra, Alessandro Raso, Fabio Morandi, Claudio Gambini, Paolo Nozza, Armando Cama, Vito Pistoia and Maria Luisa Garre` Giannina Gaslini Institute Pathogenesis of pediatric ependymoma is still poorly known and molecular markers for risk-adapted patient stratification are not available. Aim of this study was to screen for novel chromosomal imbalances and prognostic markers in pediatric ependymal tumors using a cheap and reliable technique such as metaphase-based comparative genomic hybridization (CGH). Tumor DNA from twenty children with intracranial ependymoma (World Health Organization WHO grades II and III), treated prospectively at a single Institution ( Gaslini Children_s Hospital, Genova, Italy) from 1995 to 2003, were screened for chromosomal imbalances by CGH. The most frequent regions of overlap of detected genomic losses were found on chromosome 6p22.2-pter (45%), 9p24 (45%), 3p25-pter (40%), 6q23-qter (40%), 3q23-qter (35%), 13q31-qter (35%), 2q21-qter
6th ECC: Abstracts
206 (30%), 4q33-qter (30%), and 21q22-qter (30%). The most frequent regions of overlap of gains involved chromosome arms 19p13.1-p13.3 (30%), 1q42.3 (20%) and 1q32-qter (15%). We compared the CGH profiles of intracranial ependymoma from patients younger and older than 3 years and found significant differences. In addition, we detected significant associations among specific imbalances, either losses or gains, and clinical outcome. These findings demonstrate a greater degree of imbalances than held previously in pediatric intracranial ependymoma, and point to two distinct, age-dependent cytogenetics patterns related to tumor development.
7.82-P
A new chronic myeloid leukemia case with variant Philadelphia translocation Lungeanu, A. Arghir, G. Chelu and G. Cardos Victor Babes National Institute In chronic phase, chronic myeloid leukemia (CML) is characterized by Philadelphia chromosome as sole cytogenetic anomaly. However, variant translocations involving other chromosomes, apart of 9 and 22, have been reported in 5 to 12% of cases. Variant translocation breakpoints are not randomly distributed, but clustered in hotspots[ along the genome. We report a CML case with variant translocation t(1;9;22) revealed in chronic phase. GTG banded metaphases from bone marrow were used for chromosomal studies. In addition, FISH with a mixture of WCP (Cytocell) probes was applied. All metaphases showed Philadelphia chromosome in GTG banding. Instead of standard t(9;22)(q34;q11) a variant translocation t(1;9;22)(q21;q34;q11) was observed. The patient currently receive imatinib mesylate treatment and it is under hematological and cytogenetic monitorization. As far as concerns the disease evolution in variant translocation t(9;22;V) CML, previous studies reported divergent results. Taking into account that variant translocations are rare events in CML, only small groups of patients have been evaluated. We appreciate that all new cases, including ours, might bring some new
insights, with a special emphasis on disease evolution and imatinib treatment outcome. Acknowledgements: The authors gratefully acknowledge to CNCSIS National Program (Project No. 19/2006) and BResearch of Excellence[, National Program (Project No. 15/2006).
7.83-P
Cytogenetic and molecular study of BCR/ABL negative chronic myeloproliferative disorders: preliminary data Hinescu, A. Arghir, G. Cardos, C. Diaconu, M. Chivu, L. Dragomir, M. Closca, A. Lupu, D. Mut Popescu and A. Lungeanu Victor Babes National Institute, Stefan Nicolau Institute of Virology, Coltea Clinical Hospital, Carol Davila University of Medicine and Pharmacy Chronic myeloproliferative disorders (CMPDs) are a heterogeneous group of hematologic malignancies arising from a multipotent hematopoietic stem cell. Except for chronic myeloid leukemia which is invariably associated with Philadelphia chromosome, the cytogenetic abnormalities in CMPDs are heterogeneous and include numerical (+8, +9) as well as structural changes (mostly deletions: 20q-, 13q-, 12p-). Molecular studies in CMPDs led to important advances in understanding the pathogenesis of these disorders. The recently described JAK2 V617F mutation appears to be the key genetic event for most of the CMPDs patients. We present the preliminary results of a study aiming the cytogenetic and molecular characterization of BCR/ABL negative CMPDs, with emphasis on the detection of JAK2 V617F mutation, attempted for the first time in Romania. 19 patients diagnosed with either classical or atypical CMPDs were selected for this study, by date. Chromosome analysis, FISH and RT-PCR have been used to investigate the BCR/ABL fusion. Two patients were positive for Philadelphia chromosome and were excluded from study. For the remaining 17 patients the BCR/ABL fusion was not detected at chromosomal and molecular level. The cytogenetic analysis revealed chromosomal anomalies (deletion 17p) in 2 patients. In 10 out of 17 patients, the JAK2 V617F mutation has been detected by allele specific
6th ECC: Abstracts PCR. Further characterization of cellular genome imbalances or rearrangements is ongoing, allowing us to search for correlation between cytogenetic changes and JAK2 mutation status. A better understanding of the pathogenetic mechanisms of BCR/ ABL negative CMPDs will contribute to an optimized patient tailored therapeutic strategy. Acknowledgements: National Program Research of Excellence, Project 15/2006 and 111/2006.
7.84-P
A new automated four-colour interphase FISH approach for the simultaneous detection of specific aneuploidies of diagnostic and prognostic significance in ALL Talamo Blandin, Dominique Muehlematter, Sandrine Bougeon, Ce´line Gogniat, Sarah Porter, Vale´rie Beyer, Vale´rie Parlier, Guy van Melle and Martine Jotterand Centre Hospitalier Universitaire Vaudois, Institut Universitaire de Me´decine Sociale et Pre´ventive In ALL, high hyperdiploidy (HH) (950 chromosomes) is associated with a good prognosis in paediatric cases and improved clinical outcome in adults compared to other ploidy groups. The concurrent observation of trisomies 4, 10 and 17 is associated with an even more favourable prognosis irrespective of overall ploidy, thus demonstrating that HH is a less significant prognostic factor in the absence of these trisomies. The aim of our study was to develop an interphase FISH method that allows the simultaneous detection of centromeric probes for chromosomes 4, 6, 10 and 17 using a commercially available automated scanning system and to assess its contribution towards the detection of aneuploidy for these chromosomes in HH ALL. Optimal values were established for signal detection parameters. Cut-off values were determined for each tested chomosome using 10 control samples. Based on the analysis of 10 samples from ALL patients with an aneuploidy for at least one of chromosomes 4, 6, 10 or 17, we compared the respective power of conventional cytogenetics (CC)
207 and FISH for the detection of these aneuploidies. All clones detected by CC were also detected by FISH. The automated four colour I-FISH system has numerous advantages: it provides the reliable simultaneous recognition of aneuploidy for chromosomes 4, 6, 10 and 17; it allows a large number of nuclei to be scored in a relatively short time, thus providing a highly sensitive approach that will detect small abnormal clones; it provides information on specific aneuploidies at the cellular level; and in addition is enumerative. Owing to its high sensitivity and ability to target non-cycling cells, it has the capacity to reveal additional abnormal clones not detected by CC which may ultimately be of interest with regard to the diagnosis, prognostic evaluation and further understanding of the pathogenesis of ALL.
7.85-P
Cytogenetic monitoring of patients with chronic myeloid leukemia (CML), undergoing Gleevec treatment Alla Zedginidze, Tea Vatsadze and Khatuna Gvimradze Georgian Institute of Haematology and Transfusiology, Tbilisi. Institute of Haematology and Transfusiology Gleevec is one of the first medicament directed towards pathogenetical treatment of leukemia, leading to rapid and effective improvement of clinical and haematological indicators. The most objective proof for assessment of the condition of patients are the results of cytogenetical test. 90 patients, having only t(9; 22) in all the analyzed cells before Gleevec treatment, underwent cytogenetical examinations every 6 months. These examinations revealed different results. 41 patients (46%) where observed to have reduced cells with Ph_ chromosomes during first 6 months. 20 patients (22%) after 6 months still had the Ph_ chromosomes in all analyzed cells. Within the same period of time 11 patients (12%) revealed new abnormal clones and in case of 18 patients (20%) no Ph_ chromosome was found. (In all the cases 30Y50 metaphases were analyzed). Later on, the individuals with clinical and haematological remission, revealing added chromosome disorders, showed worsening of clinical state or development of blast crises. In case of
6th ECC: Abstracts
208 one of them, who had a new clone with 56 chromosomes, FISH analysis revealed presence of atypical Ph_ chromosomes. After one or two years of treatment, FISH analysis was conducted for four patients with normal karyotype. Only in one case two cells out of analyzed 500 had t(9; 22). Cytogenetical effect is dependent upon many factors, correlation with which is being discussed. The results of cytogenetic monitoring are critical for selection of further treatment methods of individual patients.
7.86-P
Molecular monitoring of BCR-ABL transcript using Roche lightcycler t(9;22) quantification kit Joy, Gary Le Cornec, Peter Davidson and Susan White QML Pathology, Haematology Department QML Pathology Real-time quantitative PCR (RQ-PCR) for the BCRABL transcript has become an important tool in monitoring patient response to treatments such as imatinib. These methods have the ability to detect residual disease beyond the current capabilities of conventional and molecular (FISH) cytogenetic methods and also provide important long-term prognostic indications. The Roche Lightcycler t(9;22) Quantification kit allows real-time detection of both major (M-bcr) and minor (m-bcr) breakpoints within the BCR gene and can detect more than 95% of the described t(9;22) translocations. This kit allows for a two-step RT-PCR approach with reverse transcription of total RNA and subsequent analysis of cDNA with the Roche Lightcycler instrument. Quantification data is generated by the Lightcycler software using a reference curve of known standards. BCR-ABL results are then normalised against the control gene, Glucose-6-Phosphate Dehydrogenase (G6PDH) and a BCR-ABL/G6PDH ratio is produced. Breakpoint determination can be performed via gel electrophoresis of the PCR product. 17 patients have presented at diagnosis for Chronic Myeloid Leukaemia. All patients were positive by conventional or molecular (FISH) cytogenetics, with one case showing a variant t(9;22;15). The average
BCR-ABL/G6PDH ratio was 0.040. Follow-up testing post induction has occurred in 6 cases and all have shown a complete cytogenetic response (CCR). 5/6 (84%) cases have shown either a complete (CMR) or major (MMR) molecular response with a Q 3 log reduction in ratio values. 2 additional cases of BCR-ABL positive Acute Lymphoblastic Leukaemia have also presented and have shown similar findings. This data suggests that the Roche Lightcycler t(9;22) quantification kit is an efficient method of monitoring BCR-ABL transcripts and is comparable to other methods. Standardisation of ratio values to the proposed international scale is in progress.
7.87-P
BCR/ABL fusion and complex chromosomal rearrangement in a chronic myeloid leukemia case - two step variant translocation or additional anomaly? Arghir, G. Cardos, G. Mocanu, G. Chelu, N. Berbec, R. Colesniuc and A. Lungeanu Victor Babes National Institute, Coltea Clinical Hospital, Carol Davila University of Medicine and Pharmacy Chronic myeloid leukemia (CML) belongs to the chronic myeloproliferative disorders group and it is characterized by the invariable presence of BCR/ABL fusion. We report on a chronic phase - CML case with BCR/ABL fusion and a complex rearrangement involving chromosomes 9, 15, 22. Classical and molecular cytogenetic methods have been used for characterization at diagnosis and during imatinib mesylate therapy. BCR/ABL Dual Color, Dual Fusion Translocation Probe (Vysis) was used for FISH studies. GTG-banded metaphases were not available for analysis at diagnosis. Interphase FISH was performed and the expected fluorescent pattern (one green, one orange, 2 fusion signals) was observed. After six months of imatinib therapy, both classical and molecular cytogenetic investigation were performed. A rearrangement involving chromosomes 9, 15 and 22, but not Philadelphia chromosome, was observed on GTG banding. FISH analysis revealed the
6th ECC: Abstracts same pattern observed at diagnosis Y one green, one orange, 2 fusion signals. The banding pattern coupled with the standard FISH pattern led us to the conclusion that two genetic events took place. First a standard t(9;22)(q34;q11) occured, followed by a second translocation t(15;22). We consider that the breakpoint on chromosome 22 in t(15;22) was telomeric from BCR/ABL fusion. The time succesion of these two events is difficult to asses. As all the examined cells showed the same rearrangement, even after therapy, we assume that the events took place in a close succesion rather than far between. The therapy outcome and disease evolution will be monitored in order to asses the impact of this complex rearrangement, in our case. Acknowledgements: The authors gratefully acknowledge to CNCSIS National Program (Project No. 19/2006) and Research of Excellence National Program (Project No. 15/2006).
209 Purpose: To investigate genomic instability by using sister chromatid exchange in the peripheral blood lymphocytes in patients with lymphoma. Methods: We analyzed the frequency of SCE in untreated patients with lymphoma (12 patients with Non-Hodgkin_s Lymphoma and 3 patients with Hodgkin_s Lymphoma; mean age 47 between 17Y70 years of age, sex ratio; F/M = 12/3) and in control group (15 healthy individuals) by using Flourescence Plus Giemsa method. Results: The mean sister chromatid exchange frequency per metaphase was significantly higher in patients with lymphoma compared to the healthy control group (8.799 T 0.754 vs. 6.645 T 1.495; p = 0.0052). Conclusion: These results suggest that the increased sister chromatid exchange frequency in the study group may be an indicator for presence of DNA damage in patients with lymphoma.
7.89-P 7.88-P
Investigation of genomic instability in patients with lymphoma by sister chromatid exchange analysis
T(5;22)(P11,Q11) variant translocation in a case of chronic myeloid leukemia refractory to treatment
Duman, Ozturk Sukru, Sevinc Basak, Pehlivan Davut, Ergun Sertan, Basak Mesut, Perdeci Oktay, Dincol Guncag, Cefle Kivanc and Palanduz Sukru
Erkal, Ozturk Sukru, Yucel Serap, Cefle Kivanc, Bagatir Gulcin, Ucur Ali, Duman Nilgun, Aydin Demet, Bayrak Aysegul and Palanduz Sukru
Istanbul University Institute of Health Science, Istanbul University Istanbul Medical Faculty, Department of Internal Medicine, Division of Medical Genetics, Istanbul University Institute of Health Science, Istanbul University Istanbul Faculty of Dentistry, Department of Oral Disease, Haseki State Hospital, Service of Hematology, Istanbul University Istanbul Medical Faculty, Department of Internal Medicine, Division of Hematology, I
Istanbul University Istanbul Medical Faculty, Department of Internal Medicine, Division of Medical Genetics, Istanbul Okmeydani State Hospital, Service of Hematology, Istanbul University, Institute of Health Science, Department of Medical Genetics Istanbul University Istanbul Medical Faculty, Department of Internal Medicine, Division of Medical Genetics, Istanbul Ministery of Health
It has been demonstrated that viral infections, malignant diseases, chemical agents and ultraviolet light increase sister chromatid exchange (SCE) frequency. Lymphomas develop from malign transformation of lymph node cells. It has been reported that exposure to some environmental toxins or radiation cause the development of lymphoma.
Chronic myeloid leukemia is a hemotologic malignancy with a relatively favorable course. It is characterized with a chronic phase followed by an accelerated phase and blastic transformation occures evantually. The most frequent (90Y95%) cytogenetic finding in patients with a chromosomal aberration is t(9;22)(q34;q11). Another abnormality, such as variant or complex translocations is observed in the remaining. Herein we describe a variant translocation,
6th ECC: Abstracts
210 t(5;22)(p11;q11.2) in a patient in the chronic phase of CML who was refractory to treatment. To our knowledge, this chromosomal abnormality has not been reported before. Case: The patient, a 56-year old man, had splenomagaly on physical examination. The hemoglobin level was 11.7 g/dL, hematocrit: 34%, leukocyte: 100000/mm3, platelet: 432000/mm3. Conventional cytogenetic analysis performed in bone marrow cells showed the presence of t(5;22) (p11;q11.2) in all the metaphase figures analysed. To exclude the possibility of a constitutive chromosomal abnormality, another cytogenetic analysis with PHA-M on peripheral lymphocytes was performed and the karyotype was found to be 46, XY. It has been reported that in patients with a variant translocation, complete major cytogenetic response can be achieved in 74% of the cases in the chronic phase, which is not different from patients having the t(9;22) translocation. In the present case, a 3-month treatment with Gleevec 400 mg/d resulted in hematologic remission (as assessed by bone marrow examination) whereas the t(5;22) translocation persisted in all the metapahase figures analysed. This finding implies that the t(5;22) translocation may be conferring resistance to Gleevec treatment. However, it may be more appropriate to interpret the persistance of cells carrying the variant chromosome and hematologic response seperately with respect to patient outcome after treatment.
7.90-P
The association of Down Syndrome and acute myeloid leukemia: accompanying Trisomy 8 Palanduz Ayse, Bagatir Gulcin, Palanduz Sukru, Ozturk Sukru, Cefle Kivanc, Ucur Ali and Bayrak Aysegul Istanbul University Istanbul Medical Faculty, Department of Familiy Medicine, Department of Internal Medicine, Division of Medical Genetics Acute myeloid leukemia (AML) is common in patients with Down Syndrome. In this study we aimed to asses the cytogenetic abnormalities accom-
panying to the constitutional trisomy 21 in patients with AML The association of Down Syndrome and AML was identified in 4 cases among the 92 children with AML whose bone marrow chromosome analysis were performed at Istanbul University, Istanbul Medical Faculty, Department of Internal Medicine, Laboratory of Medical Genetics since 1996. Karyotype analysis revealed +8 in four cases. Trisomy 8 disappeared in 2 patients whose therapies were completed. We conclude that the cytogenetic abnormality involving chromosome 8 might have a role in leukomogenesis, although there is no direct causative relationship.
7.91-P
Loss of the Y chromosome in Leukemia: a report of 9 patients Bagatir, Palanduz Sukru, Ozturk Sukru, Cefle Kivanc, Ucur Ali, Bayrak Aysegul, Nalcaci Meliha, Yenerel Mustafa Nuri and Yavuz Selim Istanbul University Istanbul Medical Faculty, Department of Internal Medicine, Division of Medical Genetics, I, I, Istanbul University Istanbul Medical Faculty, Department of Internal Medicine, Divison of Hematology, I Age-related loss of the Y chromosome is observed in elderly males. However the significance of YY is not clear in hematological malignancies. This study was conducted in the Department of Clinical Genetics between 2003-2007. A total of 212 male patients with leukemia followed at the Department of Hematology in this time interval were included. Bone marrow chromosome analysis and Giemsa banding techniques were performed before the chemotherapy was started. Loss of the Y chromosome was observed in nine male patients with leukemia (4 cases of ANNL, 3 cases of MDS-AML, 1 case of MDS and 1 case of CML). The mean age was 46.3 T 18.5 with a median of 45 (range: 9Y72). jY incidence was 4.24%. One of the patients showed jY in 20% of bone marrow metaphases, six had jY in 40Y50 % of the metaphases while the Y chromosome completely disappeared in 2 cases.
6th ECC: Abstracts Loss of the Y chromosome was the sole karyotypic abnormality in two patients, and the remaining seven had additional chromosome changes. One case of CML had t(9;22)(q34;q11)+22q-, three cases had t(8;21)(q22;q22), one case had j7 and +11 and two cases had complex abnormalities in karyotype. The loss of Y chromosome is probably involved in the leukemic process especially in patients with jY observed in majority of the metaphases.
7.92-P
Constitutional chromosome abnormalities Palanduz Sukru, Bagatir Gulcin, Cefle Kivanc, Ozturk Sukru, Ucur Ali, Bayrak Aysegul, Aktan Melih and Dincol Guncag Istanbul University Istanbul Medical Faculty, Division of Medical Genetics, Istanbul University Istanbul Medical Faculty, Department of Internal Medicine, Division of Hematology Constitutional chromosomal abnormalities have been described to be associated with an increased risk of hematological malignant diseases. This study was conducted in the Department of Clinical Genetics between 2003Y2007. A total of 392 de novo patients with leukemia followed at the Department of Hematology in this time interval were included. Bone marrow chromosome analysis was followed by a peripheral blood chromosome analysis. Giemsa banding technique was performed. Constitutional chromosomal abnormalities were observed in 9 patients, two with Myelodysplastic Syndrome (MDS), one with acute myeloid leukemia (AML-M3), one with chronic lymphocytic leukemia (CLL), one with chronic myelomonosytic leukemia (CML) and four with acute lymphocytic leukemia (ALL). We observed inv(9) (p13q21) in 5 patients and t(3;14)(q14,q24), inv(3) (p24:q21), robt(13;14), and inv (1)(p12q21) each in one patient. Inv (9)(p13q21) was the most frequent (5/392) constitutional chromosomal abnormality in our series. At present, no direct evidence exists to support a causative relationship between the inversion of chromosome 9 and leukemia. However reporting of additional cases may offer insights into this association.
211
7.93-P
Chromosome instability, centrosome amplification and spindle multipolarity in bladder tumours Miro, E. Prat, N. Pujol, M. R. Caballin, A. Gelabert, J. Lloreta, F. Algaba and J. del Rey Universitat Autonoma de Barcelona, Hospital del Mar, Fundacion Puigvert Aneuploidy is a characteristic feature of many solid tumours including urothelial carcinomas of the bladder. One explanation of this aneuploidy is chromosome instability (CIN) in which cancer cells gain or lose whole chromosome at a greatly elevated rate compared to normal cells. Because CIN generates intercellular numerical variation in the same chromosome within a given tumour, FISH analysis is a practical method to detect CIN in paraffin embedded tissues. The use of these specimens allows analysing centrosomal amplification and gene amplification in the same sample. The aim of this study was to investigate the CCND1 status and the CIN for chromosome 11 in 22 superficial bladder tumour samples. To achieve this goal we performed FISH with CCND1 and CEP 11 dual colour probe on paraffin embedded tissue sections. Centrosome amplification and the occurrence of multipolar metaphase spindles were also analysed by immunofluorescence microscopy. CIN index was defined as the percentage of cell nuclei not displaying the modal number. CCND1 amplification (HSR or DM) was observed in six tumours (5/6 G3 and 1/6G2). Moreover, the analysis of CCND1 status allowed the identification of intratumoral subpopulations. in four samples, all of them were pT1G3 tumours. According to CIN status, tumours were arbitrarily classified in three groups: low CIN (G 30% nuclei not displaying the modal number), medium (Q 30Y60%) and high CIN. (9 60%) Eight out of nine tumours with the highest CIN showed centrosome amplification or abnormalities. Multipolar spindles were only detected in high grade tumours. Our results confirm the presence of CIN in superficial bladder tumours. A positive correlation was observed between increase of chromosomal instability and Grade. In our study, the presence of multipolar
6th ECC: Abstracts
212 spindles seems to be exclusive of high grade tumours.
7.94-P
Genome-wide analysis of DNA copy number changes in meningiomas using FISH and high-density SNP arrays Maillo, Orfao Alberto, Castrillo Abel, Sousa Pablo, Merino Marta, Espinosa Ana, Jensen Evan, Ciudad Juana and Tabernero Maria Dolores Hospital Universitario de Salamanca, Centro de Investigacio´n del Ca´ncer IBMCC/CSIC-USAL, Cytometry General Service and Department of Medicine, University of Salamanca, Hospital Universitario de Salamanca-Investigacio´n, Hospital Universitario de Salamanca, NEUROCIRUGI´A, IECSCYL-Hospital Universitario de SalamancaInvestigacio´n Meningiomas are heterogeneous tumors in which recurrent chromosome gains and losses have been detected by classical cytogenetic analysis or fluorescent in situ hybridization (FISH). Previous studies have provided that the chromosomal abnormalities in meningiomas predict disease recurrence, even among histologically benign/grade I tumors. Nowdays highdensity single nucleotide polymorphism (SNP) array are available to assess copy number analysis, plotted against the physical position of the SNPs along the chromosomes and to detect regions with loss of heterozygosity (LOH) which may be important for the pathogenesis of meningiomas. The aim of this study was to establish the chromosomal instability in 19 meningioma patients analyzing by 500K Affymetrix array set in the tumour tissue and in peripheral blood. In all cases, interphase FISH (iFISH) were performed for the detection of abnormalities for 11 different chromosomes. In addition, tumor cell DNA content was measured by flow cytometry. FISH results show three subgroups of meningiomas including diploid tumours (n = 6), cases with an isolated j22/j22q (n = 6) and complex karyotypes associated with del(1p36) and/or j14q (n = 7). The mean genotyping call rates were calculated with the 38 arrays performed for each enzyme StyI and NspI, 96.8% and 96.5%. Seven meningioma patients had
no detectable aberrations, whereas the others cases showed deletions of chromosome 22 alone and in 7 patients were detected aberrations in chromosome 1,3,6,7,8,10,11,14,18,19,20,21 and 22. The most frequently identified partial losses are located on chromosome 1, 3, and 21 and total losses on chromosome 6, 14 and 22. In summary, in the present study we show that mapping 500K SNP array revealed chromosomal imbalances and marked instability in meningioma tumours. Grant support: 66A06 (Junta de Castilla y Leo´n) and FIS 06/0312 (Fondo de Investigaciones Sanitarias, Spain).
7.95-P
Analysis of chromosome abnormalities by interphase fluorescence in situ hybridization (FISH) and gene expression profiles in human gliomas Ana L. Vital, Maria D. Tabernero, Ineˆs Crespo, Olinda Rebelo, Hermı´nio Ta˜o, Fernando Gomes, A. Castrillo, Maria C. Lopes and Alberto Orfao Center for Neuroscience and Cell Biology, University of Coimbra, Portugal; Faculty of Pharmacy, University of Coimbra, Portugal; Research Unit of University Hospital and Center for Cancer Research, University of Salamanca, Spain, Neuropathology Laboratory, Neurology Service, University Hospital of Coimbra, Portugal, Neurosurgery Service, University Hospital of Coimbra, Portugal Gliomas are a heterogeneous group of primary brain tumors being the most common and malignant in adults. Their classification still relies on the histopathological and immunohistochemical analysis. The objective of our study is to identify molecular genetic alterations that will establish homogenous genetic patterns. To correlate the chromosomal instability with the expression profiles of these tumors, samples were firstly studied by iFISH and then submitted to oligonucleotide microarray analysis. Fourty glioma patients were analyzed (34 astrocytomas, 4 oligodendrogliomas, 1 mixed tumor and 1 eppendimoma). In all cases, iFISH were performed for detection of numerical abnormalities in 8 chromosomes (1p36,
6th ECC: Abstracts 7q11, 7p11, 9q34, 9p21, 10q23, 13q14, 17p13, 19q13, 22q11). Among these 40 samples, mRNA from 12 astrocytic tumors was extracted and hybridized to U133Plus2.0 microarray (Affymetrix). Results showed numerical abnormalities for all chromosomes analyzed. In the astrocytic tumor group, chromosome gains were significantly more common than chromosome losses (72% versus 14%, respectively). Most frequent gains occurred in chromosome 7 (97%), long arm of chromosome 9 and chromosome 19 (96%) and chromosome 1 (92%). Chromosome losses mainly involved the short arm of chromosome 9 (63%) and chromosome 10 (44%). 82% of the cases had three or four tumor cell clones. Based on iFISH abnormalities in chromosome 1, two different subgroups of glioblastoma were established. Comparative analysis of the gene expression profiles of these two cytogenetic subgroups (T-test) showed differential expression for 973 genes (pG0.01) and 97 genes allowed a clear discrimination between them (pG0.001). In summary our results show that, despite showing common cytogenetic abnormalities, gliomas are genetically heterogeneous as indicated by the distinct gene expression profiles. The clinical impact of these observations remains to be established. (Supported by FCG, CIMAGO and FCT PhD fellowship, Portugal)
7.96-P
213 P2RY8 (G-protein coupled purinergic receptor P2Y8), and SOX5, one of the Sry (sex determining region Y)-box (SOX) genes. The fusion was detected by FISH and RT-PCR. The sequencing of the fusion transcripts disclosed that nt 187 of exon 1 of P2RY8 was fused with nt 117 of exon 2 of SOX5. The P2RY8/SOX5 chimera resulted in the overexpression of SOX5 and the encoded protein, evaluated by RQPCR and immunohistochemistry, respectively. The mechanism responsible of the transcriptional deregulation of SOX5 is the Bpromoter swapping[, as the SOX5 open reading frame was preserved and juxtaposed to the P2RY8 promoter. To the best of our knowledge, this is the first report of SOX5 overespression in PSFL. Further studies are needed to clarify the possible role of aberrant SOX5 gene expression in the pathogenesis of PSFL and of other t(14;18) negative follicular lymphomas.
7.97-P
mRNA and chromosomal microdeletion analysis of candidate metastasis suppressors, TGM3 and ECM1, in head and neck carcinomas Gunduz, B. Cengiz, E. Gunduz, H. Nagatsuka, L. B. Beder, K. Demircan and N. Nagai
Upregulation of the SOX5 by promoter swapping with the P2RY8 gene in primary splenic follicular lymphoma
Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Otolaryngology, Molecular Biology and Biochemistry
Storlazzi, F. Albano, C. Lo Cunsolo, C. Doglioni, M. C. Guastadisegni, L. Impera, A. Lonoce, I. Panagopoulos, G. Specchia and M. Rocchi
The metastatic ability is the most leading reason for the resistance to the treatment in cancer. Recent technologies using microarray and PCR indicated different gene expression patterns for the primary tumor and its metastasis. We examined recent literature and data related with thousand genes analyzed to identify such targets, and raised several candidate metastasis suppressor genes in head and neck carcinomas. We then analyzed the mRNA expression patterns of these genes in the matched normal, primary tumors and their metastatic lymph nodes. We also analyzed loss of heterozygosity (LOH) patterns of these genes by gene scan analysis. Our results revealed highly decreased expression of
University of Bari, Servizio di Anatomia Patologica, Ospedale S. Martino, Belluno, U.O Anatomia Patologica, Istituto Scientifico San Raffaele, Milano, Department of Clinical Genetics, University Hospital, Lund We report a primary splenic follicular lymphoma (PSFL) case showing a balanced t(X;12)(p22;p12) with the formation of a novel fusion gene involving
6th ECC: Abstracts
214 TGM3, BENE, ECM1, MAL, and MAL2 ranging from 43% to 75% in metastatic lymph nodes as compared to their matched primary tumors and remarkable LOH in the primary tumors and their metastatic foci. We are currently focusing the functions of TGM3 and ECM1 and designing expression vectors for further functional study. By clarifying the metastatic mechanism and the master genes would lead the development of molecular cancer therapies for head and neck cancer.
7.98-P
Constitutive X chromosome inactivation profile and BRCA genes germ-line mutations S. Tabano, S. Manoukian, F. R. Grati, B. Peissel, P. Antonazzo, C. Allemani, F. Barbera, S. Sirchia, P. Radice and M. Miozzo Genetica Medica, Universita` degli Studi di Milano, Oncologia Sperimentale, Istituto Nazionale Tumori di Milano, Citogenetica e Biologia Molecolare, Lab. Toma, Busto Arsizio, Clinica Ostetrica e Ginecologica II, IRCCS Fondazione Policlinico, Milano, Dipartimento di medicina preventiva e predittiva Y Unita` di Epidemiologia Analitica, Fondazione IRCCS Istituto Nazionale Tumori, Milano Constitutive BRCA1 and BRCA2 mutations account for a consistent number of inherited breast/ovarian cancers. They are involved in genomic integrity maintenance and BRCA1 is also implicated in XCI process. Butler et al. (1999) reported high frequency of skewed XCI in BRCA1 +/j patients. However, Kristiansen (2005) and Helbling-Leclerc (2006) in a relatively low number of cases failed to confirm the previous data. We investigated the occurrence of a preferential correlation between skewed XCI and BRCA1 status, in a large group of BRCA1+/j carriers. Since no information is available as for BRCA2, BRCA2+/jcases were also analysed. Blood cells DNA from 198 BRCA1+/j, 84 BRCA2 +/j and 151 controls were evaluated (HUMARA method, skewed XCI: valuesQ90:10). Two classes of age (9 and e55 years) were considered, because the per-
centage of women with skewed XCI increases with ageing. Overall, a reduced frequency of skewed XCI was observed in BRCA1+/j (16/198=8.1%) compared with controls (26/151 14,7%, pG0,05). BRCA1 +/j e55 years had a significant lower frequency of skewed XCI respect to controls (4.7% vs12,4% pG0.03). This phenomenon dramatically changed in women 955 yrs, in which 29,6% of BRCA1 showed XCI skewing (pG0.001); controls showed a similar, but not significant, trend (12.4% vs 16.7%). These data indicate an association between germ-line BRCA1 mutations and a more frequent random pattern of XCI respect to controls, suggesting a likely negative selection against a skewed XCI status during embryonic development. This tendency reverses with ageing, leading to a consistent increase of percentage of women with a skewed XCI, suggestive of a weaker stability during life of XCI pattern in BRCA1+/j respect to healthy women. These findings seem to be peculiar for BRCA1, because in BRCA2+/j no associations were found, strengthening the hypothesis that BRCA1, but not BRCA2 is involved in the Bcommitment[ and maintenance of XCI.
7.99-P
Rearrangements of chromosome 6 in hematological malignancies Berker-Karauzum, Sezin Yakut, Zafer Cetin, Ihsan Karadogan, Levent Undar, Volkan Hazar, Gulsun Tezcan, Alphan Kupesiz, Aysen Timuragaoglu and Guven Luleci Akdeniz University Faculty of Medicine Department of Medical Biology and Genetics, Akdeniz University Faculty of Medicine Department of Internal Medicine and Hematology, Akdeniz University Faculty of Medicine Department of Pediatric Hematology, A Deletion of the long arm of chromosome 6 is among the most frequently described rearrangements in chromosome 6, associated with Acute Lymphoblastic Leukemia, Non-Hodgkin Lymphoma, and Multiple Myeloma. Deletion of the p arm, and balanced or unbalanced translocations involving chromosome 6
6th ECC: Abstracts are rarely observed in hematological malignancies. Numerical abnormalities of chromosome 6 have been reported in only eight cases with myeloid disorder to date. In this study, karyotpes of a total of 384 patients, 180 with Acute Myeloid Leukemia (AML), 119 with Acute Lymphoid Leukemia (ALL), 52 with Lymphoma, and 33 with Multiple Myeloma, are presented. Numerical and structural abnormalities of chromosome 6 were detected in 8 (4.4%) AML, 8 (6.7%) ALL, 2 (3.8%) Lymphoma, and 3 (9%) MM patients. The most common abnormality was the deletion of 6q (43%). While derivative chromosome 6 was identified in two ALL cases, one ALL patient had duplication in 6p, while one AML patient displayed an additional region in 6q. One AML case was observed to have the t(6;11)(q27;q23) translocation reported frequently in literature, while another AML patient had t(3;6)(q21;q21), which has not been reported before. Translocations t(6;14)(p22;q32) and t(1;6)(p13;23), which have been reported previously in two separate cases, were detected in one AML and one ALL case in this study, with different breakage points. Extra chromosome 6 was detected as the sole numerical abnormality in two AML cases, while it was included in complex karyotypes in 3 cases with MM. Our results reveal the requirement for molecular characterization of the breakage points involved in translocations and deletions, for the prognostic significance of chromosome 6 to be revealed in hematologic malignancies.
215 tween March 2001 and March 2007. 57 (16%) patient could not be analyzed do to absence of metaphases. 150 (50%) patient were normal either structurally or numerically. Abnormal clones were found in 76 patients (25,3%) including 15 and 18 recurrent structural and numerical chromosomal anomalies, respectively. The most remarkable features of patients with hypodiploid and hyperdiploid karyotypes were the finding of recurring monosomy for chromosomes 22, Y, 8, and 14, and trisomy for chromosomes 8 and 21. Structural aberrations most frequently involved chromosomes 1, 17, 11 and 13 (n Q 11). The most frequent recurrent structural aberrations were del(11)(q23), del(17)(p) and del(13)(q) (n Q 5). Furthermore, we defined 27 novel structural anomalies for MM and most of them were related to rearrangement of previously known breakpoints.
7.101-P
Unexpected germinal mosaı¨cism of deleted gene CDKN2A/p16, detected by FISH, in a patient with unilateral retinoblastoma Wustefeld, M. Ravoet, J.-L. Gala, M. Viikkula, P. De Potter, W. Courtens and C. Sibille Universite Catholique de Louvain
7.100-P
Cytogenetic findings in 357 patients with multiple myeloma Ilgin-Ruhi, I. Akalin, H. G. Karabulut, N. Yurur-Kutlay, T. Tuncali, B. Saglam, K. Yararbas, F. Sadeghi, A. Vicdan and A. Tukun Ankara University Faculty of Medicine Multiple myeloma (MM) is a common hematological malignancy characterized by the accumulation of malignant plasma cells in the bone marrow. We investigated 483 either bone marrow or peripheral blood samples of 357 MM patients (mean age: 54; median 60) by cytogenetic analysis performed be-
We present the case of a 31-years-old woman, diagnosed at age of 3 with unilateral retinoblastoma (RB) managed with enucleation. At the age of 28, she was treated with photodynamic therapy for idiopathic neovascularisation without dysplasia. Her constitutional karyotype was apparently 46XX normal. The patient sought preconception counseling. Bilateral RB is usually associated to RB1 gene mutation and the incidence of unilateral RB associated with RB1 gene mutation is +/j 9%. However, sequencing of the RB1 gene from her PBMC derived DNA ruled out a germline mutation. Constitutional CDKN2A gene mutations are known to be involved in familial skin and eye melanoma, osteosarcoma, pancreatic and breast cancers. Although no specific cancer familial history was reported in our patient, we searched for a constitutional CDKN2A gene mutation. While gene sequencing demonstrated gene
6th ECC: Abstracts
216 integrity, a complementary interphase FISH analysis on her lymphocytes using a CDKN2A probe showed a whole gene deletion in 50% of the nuclei. We observed the same % of this gene deletion using FISH to examine a skin fibroblastic biopsy, confirming the constitutional mosaicism of the CDKN2A gene deletion. Retinoblastoma is the most common ocular malignancy in childhood and the majority of familial cases are associated to RB1 gene mutation. Additionally, constitutional chromosome aberrations are responsible for the heterozygote RB1 gene deletion, leading to familial RB predisposition and enhanced risk of congenital anomalies in the descendents. Herein, we described an unusual case of mosaicism of CDKN2A gene hemizygoty without karyotype abnormality. It is unclear how this status may potentially predispose our patient to other cancers related to CDKN2A mutation spectrum. The estimated risk for transmission to her offspring of full hemizygocity for the CDKN2A gene is 25%. We recommend performing complementary constitutional FISH analysis for detection of CDKN2A gene deletion in retinoblastoma.
7.102-P
A subgroup of thyroid lesions with PTC-FV features is characterized by trisomy 17 and lack of RET disruption, PAX8/PPARgamma1 fusion and BRAF mutations Frau, M. L. Lai, P. Caria, T. Dettori, P. P. Coni, G. Faa, G. Tallini and R. Vanni University of Cagliari, University of Bologna Papillary thyroid carcinoma (PTC) and follicular thyroid carcinoma (FTC) are encapsulated follicular patterned lesions which may be of difficult classification. PTC is the most common type of endocrine malignancy and may show simple rearranged karyotypes, usually in the diploid range (Mitelman et al. 2006). Activation of the RET proto-oncogene via chromosomal inversion or translocation, referred to as RET/PTC, has been reported as a cancer causative event (Grieco et al. 1990). Moreover, inv(7) (q21Y22q34), resulting in the AKAP9-BRAF gene
fusion, has been observed in 11% of post Chernobyl PTCs (Ciampi et al. 2005). Recently, the gene fusion PAX8/PPARgamma1 has been found also in PTC of the follicular variant (PTC-FV) (Castro et al. 2006). Numerical chromosome changes in PTC are rare and not representative of specific morphological or cytogenetic subgroups. In order to understand whether cases with trisomy 17 as the only karyotypic change (sporadically reported in PTC) could represent a cytogenetic subset of thyroid lesions, we selected from our cytogenetic files, containing 318 nodules, the 9 lesions sharing trisomy 17 as the sole change (irrispectively of the final diagnosis), and 31 nodules with disomy 17 and a final diagnosis of PTC (controls). Re-evaluation of histology and cytogenetics, was done. Cytogenetic re-evaluation was achieved on nuclei isolated from archivial paraffin embedded material by probing chromosome X,7,8,17 and TP53 gene copy number, as well as RET disruption and PAX8/PPARgamma1gene fusion. BRAF mutations was excluded by DNA sequencing. The correlation between the histopathologic and cytogenetic re-evaluations seems to support the view that trisomy 17, lack of RET and PAX8/PPARgamma1 rearrangements, and BRAF mutations, characterizes a rare and peculiar subset of follicular nodules within which PTC-FV and oncocytic features may develop. Supported in part by AIRC and RAS. We thank M Rocchi and YE Nikiforov for probes and control material.
7.103-P
Cytogenetic monitoring of patients with chronic myeloid leukemia (CML), undergoing gleevec treatment A. Zedginidze, T. Vatsadze and Kh. Gvimradze Georgian Inst. of Haematology & Transfusiology Cytogenetic Monitoring of Patients with Chronic Myeloid Leukemia (CML), Undergoing Gleevec Treatment A. Zedginidze, T. Vatsadze, Kh. Gvimradze Georgian Inst.of Haematology and Transfusiology, Tbilisi During the last 8 years 110 patients with CML,underwent Gleevec treatment in the Georgian Institute of Haematology and Transfusiology. Gleevec is one of the first medicament directed towards
6th ECC: Abstracts pathogenetical treatment of leukemia, leading to rapid and effective improvement of clinical and haematological indicators. The most objective proof for assessment of the condition of patients are the results of cytogenetical test. 90 patients, having only t(9; 22) in all the analyzed cells before Gleevec treatment, underwent cytogenetical examinations every 6 months. These examinations revealed different results. 41 patients (46%) where observed to have reduced cells with Ph_ chromosomes during first 6 months. 20 patients (22%) after 6 months still had the Ph_ chromosomes in all analyzed cells. Within the same period of time 11 patients (12%) revealed new abnormal clones and in case of 18 patients (20%) no Ph_ chromosome was found. (In all the cases 30Y50 metaphases were analyzed). Later on, the individuals with clinical and haematological remission, revealing added chromosome disorders, showed worsening of clinical state or development of blast crises. In case of one of them, who had a new clone with 56 chromosomes, FISH analysis revealed presence of atypical Ph_ chromosomes.After one or two years of treatment, FISH analysis was conducted for four patients with normal karyotype. Only in one case two cells out of analyzed 500 had t(9; 22). Cytogenetical effect is dependent upon many factors, correlation with which is being discussed. The results of cytogenetic monitoring are critical for selection of further treatment methods of individual patients.
7.104-P
Correlation of cytogenetic patterns and clinicobiological features in children acute lymphoblastic leukemia Puiu, Arghirescu Smaranda, Bataneant Mihaela, Firescu Radu, Dehelean Luca, Mihailov Delia, Stana Loredana, Oprisoni Andrada, Gug Cristina and Serban Margit University of Medicine and Pharmacy Background: It is the most common type of leukemia under the age of 18. Children are most likely to develop the disease, but it can occur at any age. The chance of being cured of low-risk ALL is 85% to
217 95%, standard-risk is 65% to 85%, and high-risk ALL is approximately 60% to 65%. Objectives: We aimed at evaluating the biological profile of leukemic cells and its particularities in ALL. Patients and methods: We analyzed cytogenetics, cell surface markers and biomolecular parameters in connection with clinical parameters in 156 ALL patients aged 0Y18 years, treated in our Clinic between 1990Y2002. Results: Injury to chromosomes can be assessed by cytogenetic methods, and the specific alteration in chromosomes also aids in subclassifying acute lymphocytic leukemia. The Philadelphia ( Ph) chromosome occurs in a small percentage of children and places the patient in a highter risk category. Thus, the approach to therapy would be intensified in those subsets of patients. In our study group we noticed no differences between sex distribution, a lower proportion of patients belonging to 2Y6 years age group (53.8% vs. 77%) and a double proportion of patients older than 6 years (41.6% vs. 20%), compared to data from literature. Frequency of medium and high risk forms was higher in study group (75.6% and 10.2% vs. 59.46% and 10.65%) and also the incidence of L3-ALL (3.3%). Biomolecular assessment revealed a comparable proportion of patients with t(9,22)-BCRABL mutation (1.28%) and a higher proportion of t(14,11) MLL-AF4 (2.56%). Leukemic cells expressed lymphoid CD10 marker in 35.07% vs. 63.01%. There were no differences between central nervous system involvement in newly diagnosed ALL (3.8% vs. 4%). These data can explain the worst prognosis of our patients. Conclusions: These findings are very helpful in diagnosing specific types of leukemia and lymphoma, in determining treatment approaches, and in following the response to treatment. Our results provide practical information that should be taken into account for planning individualized treatment.
7.105-P
Cytogenetic profile of 675 Iranian patients with leukaemia Khaleghian, F. Mahjoubi, Z. Beheshty, G. Togeh, H. Jalalyfar, M. Keyhani and M. T. Akbari
6th ECC: Abstracts
218 Akbari Medical Genetics Laboratory, Tehran, Iran, Clinical Genetic Dept, National Institute of Genetic Engineering and Biotechnology, Tehran, Iranand Akbari Medical Genetics Laboratory, Tehran, Iran, A, Dept of Hematology, Imam Hospital, Tehran, Iran, Dept of Hematology, Tehran, Iran, Department of Genetic, Faculty of Medicine, Tarbiat Modaress University, Tehran, Iran and Akbari Medical Genetics Laboratory, Tehran, Iran We analyzed bone marrow and peripheral blood samples of more than 675 Iranian Patients referred from Major hematology-oncology centers at Tehran and provincial capitals. They were either suspected of leukemia at presentation or being monitored for their response to medication. Bone marrow or/and blood cells were cultured, harvested and G-banded according to the standard protocols. Chromosome analysis was performed following ISCN guidelines. The patients were divided into six major groupings as far as the leukemia subtypes were concerned: CML, AML, ALL, MIDS, Lymphoma and others. They were more male patients than female (1.32: 1 ratio). In terms of sample type most cases had bone marrow aspiration whereas peripheral blood was utilized only in fraction of cases. The common typical chromosomal abnormalities as well as rare and complex forms were observed. The overall chromosomal abnormality rate obtained was around 50%. The breakdown figures for different categories were roughly as follows: 80% in CML, 40% in AML, 25% in ALL, 30% in MDS and 50% in other types. Compared to published data, the observed chromosomal abnormality rate in the present study is considered average.
patients (33%) were found with structurally and/or numerically abnormal clones. Of these 25 patients, 6 (24%) displayed hyperdiploid karyotype, 8 (32%) a hypodiploid/ pseudodiploid karyotype and 11 (44%) displayed a single structural chromosomal aberration. Recurrent numerical chromosomal abnormalities were mostly observed in hyperdiploid patients. More specifically, trisomies, in many cases co- segregating together, of chromosomes 5, 7, 9, 15 and 19 were found in 5 out of 6 hyperdiploid patients (83%), whereas trisomies of chromosomes 3, 4, 6 and 11 were seen in 3 out of 6 hyperdiploid patients (50%). In contrary, the most common numerical chromosomal abnormality found in 4 out of 8 (50%) hypodiploid/ pseudodiploid patients was monosomy of chromosome 13. Structural abnormalities were present in 18 out of 25 patients (72%). Among these, the recurrent translocations t(11;14)(q13;q32) and t(4;14)(q24;q32) involving the Immunoglobulin heavy chain (IgH) gene were highly associated with the hypodiploid/ pseudodiploid and single structural chromosomal aberration patients (26%). Furthermore, a partial deletion of chromosome 13 involving band 13q14 occurred in 3 out of 11 single structural chromosomal aberration patients (27%). Partial deletion of chromosome 11 was only seen in one single structural chromosomal aberration patient. The application of Fluorescence In-Situ Hybridization (FISH) for the regions 13q14 and 14q32 further established the association of these chromosomal loci with the pathogenesis of MM. Furthermore, patients with metaphase- defined cytogenetic aberrations, with or without FISH positive results for the deletion of the 13q14 locus and translocations of the IgH gene located on 14q32, compared with normal karyotype and FISH positive for the same abnormalities patients, present a poor overall survival rate.
7.106-P
Chromosomal aberrations in 75 untreated multiple myeloma patients Abazi-Stamboulieh, Oikonomou Pagona, Papadoulis Nikolaos and Tsezou Aspasia
7.107-P
University of Thessalia Medical School, Pathology Clinic, General Hospital of Larissa, Larissa, Greece
5q duplication and 13q deletion in a patient with Fanconi anemia associated with Myelodysplastic syndrome
A total of 75 untreated patients with Multiple Myeloma (MM) were studied. Among these, 25
Bennour, H. Sennana, H. E. L. Omri, A. Khelif and A. Saad
6th ECC: Abstracts Service de cytogenetique - CHU Farhat Hached Sousse Tunisia, Service d_hematologie- CHU Farhat Hached Sousse Tunisia
219
We report herein a 25 year old man undergoing a cytogenetic investigation for Fanconi anemia presented with myelodysplastic syndrome (MDS): refractory anemia with excess of blasts. Bone marrow RHG-banded karyotype showed deletion del(13)(q14q21) and additional chromosomal material on 5q. We performed Fluorescence in situ hybridization analysis using whole chromosomes painting (WCP) 5 and 13. This confirmed the chromosome 5 origin of the additional material: dup (5) (q31q35) and showed deletions del (q13) in few metaphases but revealed monosomy 13 in the majority of analysed metaphases. Various chromosome abnormalities were detected in bone marrow cells from patients with Fanconi anemia at different stages of their disease including acute leukaemia or myelodysplastic syndromes. The most commonly rearrangements involved chromosomes 1 and 7. To our knowledge dup (5) (q31q35) has never been reported previously in MDS nor in Fanconi anemia and may contribute to over expression of factors known to be required for normal hematopoiesis. The significance of this chromosomal change associated with del (13q) is discussed.
disorders. This study assessed a commercially available MLPA kit for CLL. Samples (48 blood, 1 bone marrow) were taken from 49 CLL patients, and DNA extracted using an EZ1 tissue kit. MLPA was carried out using MRC-Holland panels P037 and P038 which include 8 probes mapping to 17p13.1(TP53), 6 probes from the ATM gene at 11q22-23, 12 probes from 13q14-q14.3, 10 probes from chromosome 12 and 3 probes from 6q25-26. Results were analysed with Genemarker software. Interphase FISH was performed on fixed cells according to established methods. MLPA detected deletions at 17p in five cases (10%), 11q in seven cases (12%), 13q in twenty-seven cases (55%) and trisomy 12 in four cases (8%). No deletions of 6q were recorded. Seven cases exhibited two abnormalities and one case involved deletions at 17p, 11q and 13q. In 48 of the 49 cases, there was complete concordance between results obtained by MLPA and FISH. In the discrepant case, a 13q deletion determined by MLPA was not confirmed by FISH. There were seven cases with borderline loss/ gain by MLPA which required clarification by FISH. In this study, reagent costs per test were comparable between the two methods but MLPA is a more rapid, higher throughput technique. We conclude that MLPA is a viable first-line screening method for large numbers of CLL patients, provided that FISH is available to clarify equivocal results.
7.108-P
7.109-P
Comparison of MLPA and interphase FISH in chronic lymphocytic leukaemia
Prognostic significance of complex karyotype in philadelphia chromosome-negative (Ph-) acute lymphoblastic leukemia (all) in adults
C. Lowe, Fran O_Neill, Elaine Wilmore, Andrea Elliott and Nick Bown Institute of Human Genetics, Northern Institute for Cancer Research, Northern Genetics Service, Newcastle upon Tyne Northern Institute for Cancer Research, University of Newcastle upon Tyne For most laboratories, interphase FISH is the method of choice for the detection of prognostically significant abnormalities in chronic lymphocytic leukaemia (CLL). Multiplex ligation-dependent probe amplification (MLPA) is a well established method for detecting copy number alterations in constitutional
Granada, J. M. Herna´ndez-Rivas, J. J. Duarte, F. Sole´, M. Ortega, T. Ferro, I. Maruga´n, J. Cervera, M. L. Martı´n Ramos and J. M. Ribera Hosp. Germans Trias i Pujol. Institut Catala` d_Oncologia., Hosp. Universitario de Salamanca., GEM Estudio Gene´tico. Ma´laga., Hosp. del Mar. Barcelona, Balague´ Center. Barcelona, Hosp. Ramo´n y Cajal. Madrid, Hosp. Clı´nico de Valencia, Hosp. La Fe. Valencia, Hosp. 12 de Octubre. Madrid, Hosp. Germans Trias i Pujol. Institut Catala` d_Oncologia, Badalona
6th ECC: Abstracts
220 Background and Aim: Different from AML, the prognostic significance of complex karyotype is not known in adults with ALL. The aim of study was to analyze the possible prognostic influence of complex karyotype in Ph-adult ALL patients treated with riskadapted protocols from the Spanish PETHEMA Group. Patients and Therapy: The cytogenetic studies were reviewed following the ISCN criteria (2005). Complex karyotype (CK) was defined as the finding of 3 or more structural chromosomal aberrations. Patients were included in two different trials: ALL96 for standard-risk (SR) ALL, and ALL-93 or ALLAR03 for high-risk (HR) ALL. Results: 266 evaluable patients. SR: n=49, 26 males, WBC count 12109/L (SD: 14), 24 patients with normal karyotype (NK)(54,5%), 15 non-complex karyotype (non-CK)(34,1%) and 5 complex karytotype (CK)(11,4%). HR: n=217, 119 males, WBC count 58109/L (SD: 77), 104 with NK (53,9%), 64 non-CK (33,2%) and 25 CK (12,9%). CR, DFS and OS according to karyotype group and trial: CR ALL- 96 trial (n=49) ALL- 93/03 trials (n=217) NK 19/24 (79%) p90.05 88/104 (85%) p90.05 Non-CK 12/15 (80%) 57/ 64 (89%) CK 4/5 (80%) 19/25 (76%) DFS Median (yr) 2 yr (95% CI) p Median (yr) 2 yr (95% CI) p NK- 63% (37Y89) 0.014 1.9 47% (34Y60) 0.819 Non-CK- 100% 1.0 44% (29Y59) CK 1.5 33% (0Y86) 1.3 34% (7Y61) OS Median (yr) 2 yr (95% CI) p Median (yr) 2 yr (95% CI) p NK 2,7 59% (37Y81) 0.07 1.7 43% (32Y54) 0.889 Non-CK 3.5 65% (36Y94) 1.2 45% (31Y59) CK 0.6 20% (0Y55) 1.9 44% (21Y67). Conclusions: Complex karyotype did not have any prognostic relevance in adults with Ph-high-risk ALL, whereas a significant short survival observed in standard-risk patients with complex karyotype. Supported in part by grant P-EF-06 from Jose Carreras Leukemia Foundation.
7.110-P
Complex and composite karyotypes in malignant and neoplastic diseases in the Philippines Enriquez, Ma. Celeste Abad, Michael Ernesto Arnante, Hororata Baylon, Priscilla Caguioa, Dennis Natino, Catherine Rosales, Editha de Villa and Filipinas F. Natividad
St. Luke_s Medical Center/De La Salle University Identification of chromosomal abnormalities gives important insight into the mechanism of carcinogenesis. Common cytogenetic findings in many hematological malignancies and neoplastic diseases are translocations involving two chromosomes as in the case of t(9;22) in chronic myelogenous leukemia (CML), t(15;17) in acute promyelocytic leukemia (APL), t(8;21) in acute myelogenous leukemia (AML), t(8;14) in Burkitt lymphoma (BL) and t(2;5) in NonHodgkin_s lymphoma (NHL). There are cases however where the karyotype presents a complex pattern of structural and numerical abnormalities, yet giving rise to the same type of malignancy/disease. Questions have been raised on the role of these complex/composite karyotypes in the pathogenesis and prognostication of the disease. For a seven-year period (2000Y2006), our laboratory has processed a total of 444 virgin cases of malignant and neoplastic diseases for cytogenetic analysis. Of these, thirty nine cases (8.78%) have complex/composite karyotypes and these were observed in chronic and acute myelogenous leukemia (7.40%), multiple myeloma (15.79%), myelodysplastic syndrome (7.46%) and Non-Hodgkin_s lymphoma (30%). These different aneuploidies and structural chromosome aberrations emphasize the wide spectrum of genetic alterations and pathways in cancer. This may provide explanation to different responses to therapy and disease progression of patients.
7.111-P
Cytogenetic monitoring of patients with Philadelphia chromosomepositive chronic myleogenos leukemia treated with Imatinib mesylate Natividad, Ma. Celeste Abad, Michael Ernesto Arnante, Honorata Baylon, Priscilla Caguioa, Dennis Natino, Catherine Rosales, Carmen Narciso and Ma. Luisa D. Enriquez St. Luke_s Medical Center, De La Salle University Disease monitoring is vital to the management of chronic myelogenous leukemia (CML). This is needed to assess response to therapy and to detect
6th ECC: Abstracts early sign of relapse. In CML, response to therapy means eradication of the Philadelphia (Ph) chromosome, the abnormally short chromosome 22 produced by t(9;22)(q34;q11). The translocation produces the fusion BCR-ABL gene on chromosome 22 and a protein with a constitutively active tyrosine kinase believed to be responsible for the chronic phase of CML. The methods for monitoring response have changed considerably in recent years from the routine cytogenetic technique to molecular techniques. Yet for many laboratories cytogenetic evaluation remains the gold standard as it is able to detect other chromosomal aberrations. Imatinib mesylate is a new breed of drug recently introduced in the market designed to block the gene fusion and inhibit the tyrsosine kinase activity of the BCR-ABL protein. The acquisition of secondary chromosome aberrations in CML with Ph positive karyotype signifies clonal evolution associated with disease progression. Forty CML patients who carry the typical t(9;22) karyotype at diagnosis were given imatinib. Second samples of these patients were subsequently submitted for cytogenetic analysis. The time interval between the analysis of first and second samples ranged from 1.5 months to 4 years, with a mean interval of 11 months. Ten (25%) patients were found to retain the classis t(9;22) karyotype; twelve (30%) were hypodiploid and Ph positive; 3 (7.5%) patients were Ph positive but also have normal cells; two (5%) patients have additional copy of Ph chromosome (double Ph); three (7.5%) developed other chromosome abnormalities and ten patients (25%) responded well to the drug, with normal karyotype. The persistence of the Ph chromosome in 67.5% of these patients suggests that the Ph clone genetically evolved and escaped dependency on BCR-ABL kinase for proliferation. This group of patients could be considered candidates for another mode of treatment modality.
7.112-P
Detection of a complex karyotype by classical cytogenetics and multiprobes FISH analysis in a AML-M1 patient Azzena, Martorana, Murru, Licheri, Deidda and Marongiu, Floris, Virdis University of Cagliari
221 Detection of a complex karyotype by classical cytogenetics and multiprobes fish analysis in a aml-m1 patient. A. Azzena1, L. Martorana1, R. Murru1, V. Licheri1, S. Deidda1, R. Marongiu1, A. Floris1, M. Virdis1, S. Orru`1, C. Carcassi1 1Dipartimento di Scienze Mediche, Cattedra di Genetica Medica, Universita` degli Studi di Cagliari, Italy. We report a 78YyearYold male patient with acute myeloid leukemia M1 secondary to RCMD (Refractory Cytopenia with Multilineage Dysplasia). When RCMD was diagnosed, blood values showed neutropeny with WBC 1940/2l (N600/ 2l); Hb 10,1; Plt 156000. After three months, due lower level of Hb, the patient was treated with " EPO 40000U/week and occasional support with GR. Three months after treatment without response, was observed thrombopenia: bone marrow analysis revealed a AML evolution. Conventional cytogenetics by GTGYbanding showed a complex karyotype with a number of chromosomes from 51 to 54 in all analyzed metaphases. Trisomy of chromosomes 1, 9, 13, 22, a variable number of additional chromosomes and ricurrent translocations involving apparently chromosomes 2, 3, 5, 8, 12, 21 were found; we used FISH analysis by painting multiprobes (Chromoprobe Multiprobe\ Y System OctoChromei Cytocell), to confirm our results. because poor quality of metaphases (resolutionG250) in GTGYbanding. We confirmed trisomy of chromosomes 1, 9, 13 and 22 and found new trisomy of chromosomes 11, 14, 17, Y; we identified translocations involving chromosomes 2, 3, 5, 8: t(2;3), t(5;8) and classified derivative chromosomes: der(3), der(12), der(21). Therefore, cytogenetic analysis combined with Multipainting FISH techniques permitted in this case to define a complex karyotype otherwise incomplete, showing the involvement of chromosomes typically correlated with clinical data of the patient. Multipainting FISH analysis provide a relevant contribution to the characterisation of highly rearranged karyotypes with low resolution and low mitotic index, useful for a more correct diagnosis and prognosis.
7.113-P
Genetic characterization of oligodendrogliomas Drouin, M. Gadji, A. M. Tsanaclis and D. Fortin
6th ECC: Abstracts
222 Universite de Sherbrooke The pathogenesis of oligodendrogliomas is largely unknown. Combined loss of chromosomes 1p and 19q has proven to be a powerful predictor of chemotherapeutic response and survival in oligodendrogliomas. We undertook to retrospectively and prospectively study the oligodendroglial tumours followed at the Centre Hospitalier Universitaire Sherbrooke using cytogenetic and molecular genetic techniques. The immunohistochemical staining performed in paraffin embedded tissues showed a variable expression of EGFR gene (Epidermal Growth Factor Receptor) and a proliferation index between 1 to 90%. Fluorescent In Situ Hybridization using LSI 1p36/LSI 1q25 and LSI 19q13/LSI 19p13 probes for chromosomes 1 and 19 was performed in 21 paraffin embedded tissues retrospectively and 10 touch preparation smear slides prospectively. We studied 25 persons composed of 34.3% males and 64.7% females ranging in age from 18 to 77 years with a median age at 40.9 years. The results displayed sixteen 1p/19qYcombined deletions (1p-/19q); one patient displayed 1p-only, one patient displayed 19q-only and three cases did not show any deletion. To define the deletion length, we performed LOH (Loss Of Heterozygosity) screening with microsatellite marker mapping 1p and 19q chromosomes after standard PCRbased LOH. Tumor DNA was extracted from seven paraffin-embedded tissues and from three surgical biopsies. Constitutional DNA was extracted from peripheral blood leukocytes and from saliva in 5 cases. The preliminary results map the deletions between D1S2795 (1p36.31) locus and D1S2722 (1p34.2) locus and between D19S412 (19q13.32) locus and D19S422 (19q13.13) locus. The Kaplan-Meier curves depicting the survival of patients between 0.3 and 262 months and bearing 1p_/19q_ displayed a median survival time of 146 months and 136.5 months for oligodendrogliomas and anaplastic oligodendrogliomas, respectively. The average survival obtained in our study is longer than that from previously published studies.
7.114-P
Clonal evolution in a patient with post-polycythemic myelofibrosis: der(1;13)(q10;p10) appearing as a secondary anomaly to der(9;18)(p10;q10)
Erdinc Yuksel, Ozden Piskin, Inci Alacacioglu, Fatih Demirkan and Zeynep Sercan Dokuz Eylul University Hospital, Dept. Medical Biology and Genetics, Dokuz Eylul University Hospital, Dept. of Hematology/Oncology Here we report a 54 year-old male patient evaluated due to massive splenomegaly, anemia and thrombocytosis. Patient history revealed a previous polycythemia vera (PV) diagnosis. His peripheral smear showed leukoerythroblastic changes (early myeloid series, normoblasts), existence of erythrocytes with teardrop morphology, anisocytosis and poikilocytosis. Bone marrow aspiration was hypercellular, showed increase in megakaryocyte lineage and dysmegakaryopoiesis. Bone marrow biopsy revealed myelofibrosis. The patient was diagnosed as postpolycytemic myelofibrosis (PPMF). Bone marrow was collected for cytogenetic evaluation. Cytogenetics revealed a 46,XY,+9, der(9;18)(p10;q10)[9]/ 46,sl,+1, der(1;13)(q10;p10)[5] / 46, XY [6] karyotype, resulting in partial trisomy for 9p and 1q. Several chromosomal abnormalities have been identified in PV including trisomy 8, trisomy 9, del(13q), del(20q) and 1q anomalies. While del(13q) and del(20q) are associated with a favorable outcome with longstanding stable disease; other clonal aberrations have been identified as unfavorable prognostic factors. About 10Y15% of PV patients evolve to secondary myelofibrosis and interestingly partial trisomy 1 has been reported in 50Y70 % of these cases. In light of existing literature we purpose that the occurrence of partial trisomy 1 in PV patients is an indicator of high risk for disease evolution to PPMF.
7.115-P
Mutated SSCP profiles of c-myc proto-oncogene in bladder_s papillary urothelial (transitional cell) neoplasms: A molecular approach to cell proliferation, gene expression, grade, stage and recurrence O. Ozdemir, E. Yildiz, S. Ayan, E. Gul, G. Gokce, O. F. Goze and E. Y. Gultekin
6th ECC: Abstracts
223
Department of Medical Genetics, Faculty of Medicine, Cumhuriyet University, Sivas, Turkey, Department of Pathology, Faculty of Medicine, Cumhuriyet University, Sivas, Turkey, Department of Urology, Faculty of Medicine, Cumhuriyet University, Sivas, Turkey
Istanbul University Istanbul Medical Faculty, Istanbul University Istanbul Medical Faculty, Department of Internal Medicine, Division of Medical Genetics, Istanbul Okmeydani State Hospital, Service of Hematology
Objective: Transitional cell neoplasm of the bladder is a common tumor. The current study was designed to investigate the relationship between c-myc expression and cell proliferation and to examine the clinical significance of mutated c-myc in UNs of the urinary bladder. Materials and methods: A total of 88 paraffinembedded UN specimens were investigated immunohistochemically for c-myc and Ki-67 expression. A second set of experiments was directed at the mechanisms underlying possible c-myc overexpression in UNs. PCR based SSCP analysis was used for genotyping in 54 bladder_s UN cell lines. Results: UNs (n=83) yielded c-myc expression in 75 cases (90.4 %) and Ki-67 expression in all of cases with UNs. Thirty two cases ( 89%) from noninfiltrating (pTa) 36 UNs revealed c-myc expression. Investigation of infiltrating UNs revealed c-myc expression in 19 cases (95%) of 20 pT1 tumors (n=20) and in 24 cases (89%) of 27 muscle infiltrating pT2 tumors. In this series of UNs, tumor grade for recurrence (pG0.0001), tumor grade (pG0.012) and Ki-67 expression (pG0.0001) for progression to high tumor grade were independent prognostic factors. In PCR-SSCP analysis, there were mutations of the exon 2 of c-myc gene in two cases with high grade, stage (pT2) and proliferation index. Conclusion: Results indicate the mutated c-myc profiles could be involved in papillary type urothelial bladder carcinogenesis and bladder cancer patients who may require a more intensive treatment strategy in contrast Ki-67 expression in transtional cell carcinoma of the bladder cancer.
Chronic myeloid leukemia is a hemotologic malignancy with a relatively favorable course. It is characterized with a chronic phase followed by an accelerated phase and blastic transformation occures evantually. The most frequent (90Y95%) cytogenetic finding in patients with a chromosomal aberration is t(9;22)(q34;q11). Another abnormality, such as variant or complex translocations is observed in the remaining. Herein we describe a variant translocation, t(5;22)(q13;q12) in a patient in the chronic phase of CML who was refractory to treatment. To our knowledge, this chromosomal abnormality has not been reported before.
7.116-P
t(5;22)(q13;q12) variant translocation in a case of chronic myeloid leukemia refractory to treatment Erkal Haluk, Ozturk Sukru, Yucel Serap, Cefle Kivanc, Bagatir Gulcin, Ucur Ali, Karaman Birsen, Basaran Seher, Aydin Demet and Palanduz Sukru
Case: The patient, a 56-year old man, had splenomagaly on physical examination. The hemoglobin level was 11.7 g/dL, hematocrit: 34%, leukocyte: 100000/ mm3, platelet: 432000/mm3. Conventional cytogenetic analysis performed in bone marrow cells showed the presence of t(5;22)(q13;q12) in all the metaphase figures analysed. To exclude the possibility of a constitutive chromosomal abnormality, another cytogenetic analysis with PHA-M on peripheral lymphocytes was performed and the karyotype was found to be 46, XY. It has been reported that in patients with a variant translocation, complete major cytogenetic response can be achieved in 74% of the cases in the chronic phase, which is not different from patients having the t(9;22) translocation. In the present case, a 3-month treatment with Gleevec 400 mg/d resulted in hematologic remission (as assessed by bone marrow examination) whereas the t(5;22) translocation persisted in all the metapahase figures analysed. This finding implies that the t(5;22) (q13;q12) translocation may be conferring resistance to Gleevec treatment. However, it may be more appropriate to interpret the persistance of cells carrying the variant chromosome and hematologic response seperately with respect to patient outcome after treatment.
7.117-P
Cancer stem cells – a critical review for the cancer geneticist
6th ECC: Abstracts
224
D. Gisselsson
M. Nelen and M. Poot
Department of Clinical Genetics
University Medical Centre Utrecht
It is a long known curiosity that only a minority of cells within a tumour are typically responsible for tumour growth. Over the last few years it has become possible to isolate and characterise these tumourmaintaining cells, first from haematological malignancies and recently also from a number of solid tumours. The fact that many of the isolated tumourmaintaining cells share surface markers with nonneoplastic somatic stem cells and have capacities of both self-renewal and differentiation have popularly rendered them the name Bcancer stem cells[. In many respects, the stem cell theory of cancer harmonizes with the classical model of multi-step carcinogenesis. Somatic stem cells have a longer life span than their differentiated progeny and could thus, over many years, accumulate somatic mutations and undergo step-wise selection and clonal expansion. However, the hypothesis that most tumours are derived from normal somatic stem cells gives rise to a number of questions from a cancer cytogenetic perspective: (1) The idea that the long life span of stem cell is a prerequisite for the accumulation of somatic genetic changes is difficult to reconcile with the sometimes very complex genetic alterations observed in infant tumours. Does this mean that the mechanisms behind genetic rearrangements in childhood tumours are fundamentally different from the mechanisms in adult tumours? (2) Is it still possible that terminally differentiated cells could acquire stem cell-like features (dedifferentiate) through acquisition of genetic and/or epigenetic changes? (3) In many tumours, gene fusions have convincingly been shown to result in differentiation block, explaining the acquisition of a stem cell phenotype. What is then the role of the secondary cytogenetic changes observed in many neoplasms?
Several routes of investigation have demonstrated that the genome of healthy individuals is replete with copy number variants (CNVs). The clinical significance of CNVs is largely unknown. Neither is known whether CNVs are under selective pressures. During genome-wide segmental aneuploidy profiling of 48 unrelated healthy subjects with a 3,783 BAC array we found on average 41 BAC probes with triplicate signals significantly outside the 95% confidence interval covered by the autosomal probes. These BACs represented 375 autosomal CNVs. Such CNVs were also detected in a series of 273 unrelated patients with multiple congenital abnormalities and mental retardation. The 321 subjects making up our study population shared a total of 1350 distinct CNVs, occurring as deletions, duplications, or both, in frequencies up to 45%. CNVs occurring at 91% in the healthy individuals showed significantly less than expected rates for deletion only and duplication only. This suggests that these CNVs have been subjected to selective pressures. Out of 32 pathogenic genomic aberrations, confirmed by FISH, 20 were deletions. Out of these, 15 contained at least one CNV, such that 53 genes in pathogenic aberrations were found to be deleted in CNVs. This suggests that haploinsufficiency of genes contained within CNVs that also occur as deletions in healthy, normal persons, is not necessarily pathogenic in patients with deletions incorporating these CNVs. Therefore, CNVs should be taken into account when considering the clinical relevance of segmental aneuploidies in patients with congenital abnormalities or mental retardation.
9.1-O
Copy number variants complicate interpretation of pathogenic segmental aneuploidy R. Hochstenbach, M. J. Eleveld, S. E. v. d. Wijst, J. K. Ploos van Amstel,
9.2-O
Diagnostic use of molecular karyotyping by tiling-resolution array CGH in patients with mental retardation N. de Leeuw, R. Pfundt, D. Koolen, E. Sistermans, W. Nillesen, J. Hehir-Kwa, J. Veltman, A. Geurts van Kessel, B. de Vries and D. Smeets
6th ECC: Abstracts Radboud University Nijmegen Medical Centre In 2004, genome wide tiling-resolution array-based Comparative Genomic Hybridisation (array CGH) analysis was diagnostically implemented in our cytogenetic services in order to reach a resolution that extends far beyond routine cytogenetic analysis. At present, we perform diagnostic array CGH only after obtaining normal outcomes with routine cytogenetic analysis and subtelomere Multiplex Ligationdependent Probe Amplification (MLPA) analysis. So far, more than 650 samples from patients with mental retardation and/or multiple congenital anomalies as well as approximately 100 samples from healthy parents have been analysed on our 32 k BAC array. Upon detection of an aberration, other than a normal genomic variation, validation by region-specific MLPA and/or Fluorescence In Situ Hybridisation (FISH) is performed. On average, clinically significant imbalances are identified by genome wide array CGH in ~10% of our patients. The aberrations we identified vary in size from 0.15 to 12.4 Mb, acknowledging the importance of cryptic aberrations in the aetiology of mental retardation. Although the large majority of all aberrations is unique, a number of recurrent aberrations have now been identified by us and other groups. So far, loci in which recurrent genomic aberrations and a recognizable phenotype have been identified include 1q44, 2p15p16, 2q23.1, 10q21, 15q24 and 17q21.31. For some of these regions, the genomic structure offers a likely explanation for the recurrence of the identified imbalances, for many others, the exact mechanisms that lead to these rearrangements need to be elucidated. The use of genome wide array CGH significantly increases the diagnostic yield in patients with mental retardation and/or multiple congenital anomalies. Therefore, genome wide array analysis or so-called molecular karyotyping will soon replace or precede conventional karyotyping and replace subtelomere and microdeletion analysis by either MLPA or FISH, at least for certain clinical indications.
9.1-P
Specific transcriptional networks in human fetus with autosomal trisomies
225
¨ . Altug Teber, M. Bonin, O U. A. Mau-Holzmann, A. Dufke, H. Stappert, I. Tekesin, H. Heilbronner, K. Nieselt and O. Riess University of Tuebingen, Olgahospital, Stuttgart, Center for Bioinformatics, Tuebingen Among full autosomal trisomies, only trisomies of chromosome 21 (Down syndrome), 18 (Edward_s syndrome) and 13 (Patau syndrome) are compatible with postnatal survival. But the mechanisms, how a supernumerary chromosome disrupts the normal development and causes specific phenotypes, are still not fully explained. As an alternative to gene dosage effect due to the trisomic chromosome, a genomewide transcriptional dysregulation has been postulated. The aim of this study was to identify the transcriptional changes in trisomy 13, 18, and 21 during early fetal development in order to define whether overexpression of genes of the trisomic chromosome contributes solely to the phenotype, whether the ratio of gene expression is in agreement with the gene dosis, and whether the different trisomies show similar transcriptional characteristics. Using oligonucleotide microarrays, we analyzed whole genome expression profiles in cultured amniocytes (AC) and chorion villus cells (CV) from pregnancies with a normal karyotype and with trisomy13, 18 and 21. We observed a low to moderate up-regulation for a subset of genes of the trisomic chromosomes. Transcriptional level of most genes on the trisomic chromosome appeared similar to the respective chromosomal pair in normal karyotypes. Expression values as well as the expression patterns of genes from the trisomic chromosome distinguished the respective trisomic samples from euploid controls. A subset of chromosome 21-genes including the DSCR1 involved in fetal heart development was consistently up-regulated in different tissues (AC, CV) with trisomy 21 whereas only minor changes were found for genes of other chromosomes. In contrast, in trisomy 13 and 18 vigorous genome-wide transcriptional changes were found. Our findings supported a combination of the two major hypotheses for trisomies studied here. As several transcriptional pathways are altered, complex regulatory mechanisms are involved in the pathogenesis of autosomal trisomies.
6th ECC: Abstracts
226
9.2-P
9.3-P
Chromosomal constitution assessment of spontaneous miscarriages: cytogenetic and molecular approach
Cryptic 19p13.2p13.13 deletion in a child with complex craniosynostosis and mental retardation
D. Diego-Alvarez, C. Ramos, M. Rodriguez de Alba, M. J. Trujillo-Tiebas, A. Bustamante-Aragones, E. Vallespin, R. Cardero-Merlo, F. Infantes, J. Diaz-Recasens and I. Lorda-Sanchez
M. Ravoet, Ch. Debauche, M.-C. Nassogne, P. Bernard and C. Sibille
Genetics Service - Fundacio´n Jime´nez Dı´az - Capio CIBERER, Obstetrics and Gynaecology Service Fundacio´n Jime´nez Dı´az - Capio Spontaneous abortion occurs in about 15% of clinically recognized pregnancies, affecting near 25% of all women at least once in their lifetime. It has been demonstrated that knowing the cause of the miscarriage significantly reduces psychological distress and self-blame feelings in women with a miscarriage and enables offering an appropriate genetic counselling to these couples. Since the earlier surveys, cytogenetic studies have widely demonstrated that chromosomal anomalies account for no less than 60% of first trimester losses. But routine cytogenetic study of miscarriages entails high rates of culture failure (10Y40%) or misdiagnosis due to overgrowth of maternal cell contamination. Moreover, some authors support the hypothesis that cell cultures may yield normal karyotypes or selected abnormal ones that allow in vitro cell proliferation, suggesting that rates of abnormalities uncommonly seen by conventional cytogenetics may be more frequent than the reported ones. In contrast to conventional cytogenetic techniques, molecular ones employ DNA instead of live tissue, which solves culture related limitations and permits the study of fixed and macerated specimens. From 2003 onwards, we have performed molecular studies in 550 spontaneous miscarriage samples in addition to karyotyping. Molecular techniques included QF-PCR, CGH, MLPA with subtelomeric probes and array-based CGH. Here, we present our 3 year experience evaluating the advantages, possibilities and limitations of the mentioned techniques. Finally, we propose the optimal protocol for the study of chromosomal anomalies in spontaneous miscarriages.
Centre de Ge´ne´tique - Cliniques Saint-Luc - UCL, Service de Ne´onatalogie - Cliniques Saint-Luc UCL, Service de Pe´diatrie neurologique - Cliniques Saint-Luc - UCL, Service d_Obste´trique - Cliniques Saint-Luc - UCL We report a girl borne with a complex craniosynostosis without radial aplasia associated with encephalopathy. The patient_s birth weight was 1,800 g at 36w6/7. Her length and head circumference were at 50th percentile and-3DS, respectively. She was hypotonic and presented limb arthrogryposis. Dysmorphic features were noted such as proptosis, strabismus, hypertelorism, small nose with low nasal bridge, low-set dysplastic ears, deep skin folds of hands and feet, clinodactyly of Vth finger and IIId toe with an increased division between Ist and IInd toe. Cerebral IRM revealed a non-progressive ventriculomegaly. Cerebral scan reported a left coronal, lambdoid and parieto-temporal suture craniosynostosis. Although compatible with Neurofibromatosis type 1, this diagnosis was excluded by absence of mutation in NF1 gene. Since her facial dysmorphy and asymmetry were thought to be subsequent to the craniosynostosis, Saethre-Chotzen, Pfeiffer and Apert syndromes were proposed. However, sequencing of TWIST, FGFR1 and FGFR2 genes mutations was negative for any deleterious mutation. At age 3, an important developmental and psychomotor delay was observed, including absence of language acquisition. Familial history is unremarkable except one miscarriage and one vanishing twin. G-banding karyotype of the propositus was 46,XX apparently normal. Using CGH-array (Agilent 44K), a 3-Mbp cryptic interstitial deletion of chromosomal bands 19p13.2 to 19p13.13 was detected. This region contains 115 genes/ESTs between ICAM1 and CACNA1A genes, allowing a detailed genotype/phenotype comparison. In particular, ELAVL3 and CACNA1A genes are known to be involved in neuronal development and function. Partial chromosome 19 deletions
6th ECC: Abstracts are extremely rare. A terminal 19p13-pter deletion was once described in a 2 month-old male associated with microcephaly, spacticity, deafness and retina lesions. Our patient represents a unique case of interstitial 19p13.2p13.13 deletion and offers an opportunity to identify new genes predisposing to craniosynostosis and mental retardation.
9.4-P
Development and validation of the Bchromosome X exon-specific array[ that enables identification of copy number changes in genes of the X chromosome P. Patsalis, L. Kousoulidou, H. Van Bokoven, H. Ropers, J. Chelly, C. Moraine, A. De Brouwer, H. Van Esch, G. Froyen and S. Bashiardes Cyprus Institute of Neurology and Genetics, Department of human genetics, Radboud University Nijmegen Medical Centre, Nijmegen, The Netherlands, Max Planck Max Planck Institute for Molecular Genetics, Human Molecular Genetics Department, Berlin, Germany, INSERM U129ICGM, Faculte de Medecine Cochin, Paris, France, Centre Hospitalier Universitaire de Tours, Service de Genetique, Hospital Bretoneau, Tours, France, Centre for Human Genetics, University Hospital Gasthuisberg, Leuven, Belgium, Human Genome Laboratory, VIB, Dept. Human Genetics, K.U. Leuven, Department of Cytogenetics, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus The aim of this study was to design and produce a specialized and novel chromosome X exon-specific oligonucleotide microarray for screening of all X-chromosomal genes and detection of copy number changes. Identification of genetic alterations is extremely important for research and clinical purposes. Recent studies have indicated that microdeletions and microduplications occur at a high frequency in the human genome, while advances in high-density oligonucleotide arrays have paved the way with unparalleled resolution. The new Bchromosome X exon-specific array[ contains about 22,000 60mer oligonucleotides covering more than
227 92% of all chromosome X exons and miRNA regions, as well as control regions from other chromosomes. Two known abnormal control samples, one with a well-characterized isochromosome X and another with a Xp22.2 duplication were interrogated on the array to test its efficiency and identify probes that do not perform efficiently. Modifications were carried out and the final Bchromosome X exonspecific array[ was used for screening of 20 XLMR families from the EURO-MRX Consortium. One out of the twenty families was identified by array-CGH as having a 1.78-kb deletion involving all exons of one gene and a second family was found to carry a 27-kb deletion involving all exons of two contiguous genes. The above genetic changes were confirmed with PCR. The Bchromosome X exon-specific array[ could be utilized to detect genetic changes in Xlinked disorders and other chromosome X abnormalities. The Bchromosome X exon-specific array[ will become available from BOxford Gene Technology[ (OGT) biotechnology company within the next months.
9.5-P
Array-CGH characterization of familial and de novo Bapparently balanced[ translocations in patients with abnormal phenotype C. Sismani, S. Kitisiou-Tzeli, M. Ioannides, V. Anastasiadou, G. Stylianidou, E. Papadopoulou, Z. Kosmaidou, E. Kanavakis, A. Kolialexi, A. Mavrou and P. Patsalis Cyprus Institute of Neurology and Genetics, Department of Medical Genetics, University of Athens, Choremio Research Laboratory, BAghia Sophia[ Children_s Hospital, Athens, Greece, Department of Pediatrics, Arch Makarios III Hospital, Nicosia, Cyprus, Department of Paediatrics, University Hospital of Heraklion, Crete, Greece, Department of Genetics, Alexandra Hospital, Athens, Greece We have applied 1 Mb resolution array-CGH to investigate 12 cases of Bapparently balanced[ translocations in patients with mental retardation and congenital malformations. Six cases were de novo
6th ECC: Abstracts
228 and six familial. In the familial cases the patients had an abnormal phenotype but their karyotype appeared identical to other phenotypically normal translocation carriers of the family. Chromosomal and various FISH analyses suggested that the rearrangements were Btruly balanced[ in all patients. Array-CGH however, revealed cryptic genomic imbalances in three cases (25%), two de novo and one familial. All array-CGH findings were confirmed by FISH. The nature and type of abnormalities differed among the three cases. In the first case a de novo t(9;15) (q31;q26), a complex rearrangement was identified involving a ~6.1 Mb duplication on chromosome 9, a ~10 Mb deletion and an inversion on chromosome 15. These imbalances were near but not directly associated with the translocation breakpoints. In the second case a de novo t(4;9)(q26;p24), a ~6.6 Mb deletion was identified on chromosome 7 which is unrelated to the translocation. In the third case (t(4;7) (q21;p15)-familial), a ~4.3 Mb and a ~2.3 Mb deletions were found at the translocation breakpoints. In the remaining cases the translocations appeared balanced at 1 Mb resolution. This study provides additional evidence that cryptic genomic imbalances are common in patients with abnormal phenotype and Bapparently balanced[ translocations not only in de novo but also in familial cases. The use of microarrays with higher resolution such as high-density oligo-arrays may reveal that the frequency of cryptic genomic imbalances among these patients is even higher.
9.6-P
Micro-array comparative genomic hybridisation (array CGH) analysis of 55 unrelated patients with learning disability/mental retardation and multiple congenital anomalies S. W. Hellens, S. A. Zwolinski, M. J. Wright, S. M. Gribble, E. Prigmore, N. P. Carter, J. Wolstenholme and M. P. Splitt Institute of Human Genetics, Wellcome Trust Sanger Institute Constitutional chromosomal abnormalities are a major cause of learning disability/mental retardation and multiple congenital anomalies (MR/MCA).
Routine karyotype analysis is not sensitive enough to detect subtle chromosome rearrangements (G5 Mb). Array CGH offers a rapid high-resolution analysis for the detection of chromosomal imbalances across the genome. Previously reported array CGH studies on patients with abnormal phenotypes and normal karyotypes have identified sub-microscopic imbalances in 10Y25% of patients. In this study, analysis was undertaken on fifty-five unrelated patients with MR/MCA employing DNA microarrays constructed with large insert BAC/PAC clones spaced at approximately 1 Mb intervals across the genome (Sanger NCBI36). All Cy3/Cy5 data were processed with BlueFuse v3.4 software. Copy number changes were detected in 13 patients (23.6% of the total) and included 8 deletions, 4 duplications and 1 cryptic unbalanced translocation. Chromosomal imbalances detected ranged in size from those involving a single clone to those spanning three clones with a maximum size of 4.6 Mb. As expected, none of the abnormalities detected are visible on routine G-banded karyotype analysis. Further studies by unrelated techniques are in progress to verify the abnormalities detected.
9.7-P
Premature chromosome condensation, microcephaly and mental retardation: a report of two large consanguineous Iranian families Dr. F. Behjati, Ms. S. Ghasemi Firouzabadi, Dr. K. Kahrizi, Mr. M. Garshasbi, Mr. M. Motazacker, Ms. S. E. Esmaeili Nieh, Ms. S. S. Abedini, Mr. R. Vazifehmand, Prof. H. H. Ropers and Prof. H. Najmabadi Genetics Research Center, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran, Max Planck Institute for Molecular Genetics, Berlin, Germany We report two Iranian consanguineous families affected with microcephaly, growth retardation, and mental retardation. The two families were unrelated and from northern and southern parts of Iran. Six members of one family and two of the other were affected. Parents in both families were first cousins.
6th ECC: Abstracts Chromosome analysis using GTG banding technique on the probands showed a high frequency of prophase-like cells (80%) compared to normal controls (13%). The morphology of chromosomes were very poor and appeared fragile, twisted, curly and with breakage and overall very unusual looking. This phenomenon is due to premature chromosome condensation. Molecular investigation in the first family, using array-based homozygosity mapping and array CGH revealed deletion in the MCPH1 gene, one of four genes that have previously been implicated in autosomal recessive mental retardation with mirocephaly. In the second family, using homozygosity mapping, linkage to MCPH1 locus was suggested. The Cytogenetics findings demonstrating premature entry of cells into mitosis suggested mutation of genes involved in cell cycle regulation, which was then confirmed by molecular investigation. Our findings emphasise the importance of chromosome studies on patients with mental retardation and microcephaly. Findings of chromosomes with premature condensation in such patients implicate mutation in MCPH1 gene, which would therefore warrant further molecular investigations.
229
Interstitial deletion of 1p22.2-1p31.1 causing MCAD deficiency and review of interstitial deletions and duplications of this region
echocardiogram and frontal anomaly by brain MRI were found. Organic acid analysis revealed dicarboxylic aciduria and acylcarnitines analysis showed a ratio of 9:1 for octanoyl (C8) and decanoyl (C10) carnitines, indicative of Medium Chain acyl-CoA Dehydrogenase (MCAD) deficiency. ACADM sequencing showed an apparent homozygous c.190G-9C (A31P) mutation in exon 3; however, only mother was a carrier and HLA type 2 testing confirmed paternity. This prompted further karyotype (previously reported as normal) and genomic investigations. An interstitial deletion of the chromosome 1 short arm was detected by G-banding: 46,XX,del(1)(p22.2p31.1). Parental karyotypes were normal. The deletion was characterized by a 1 Mb BAC array. Clones with non-modal losses ranged from RP5-1007M22 (1p22.2) to RP11-88B10 (1p31.1), a 15 Mb deletion. FISH confirmations included deletion of clone RP11-503L20 that overlaps with ACADM. Interstitial deletions (n=6) and duplications (n=3) with breakpoints of 1p22 and 1p31/32, uncomplicated by rearrangements, have been reported. Similar Gband breakpoints may be the same or different at the molecular level. Review of 6/7 deletion cases indicate a variable phenotype whereas all 3 duplication cases have the feature of abnormal sex development in common. Thus, while both interstitial deletion and duplication cases have been reported, and G-band breakpoints are similar, the phenotypic variation of the deletion cases argue against the possibility that these cases share common breakpoints, facilitated by genomic features such as low copy repeats or segmental duplications.
Teshima, N. Poplawski, B. S. Andresen, G. Nie, J. Chen, J. T. R. Clarke and G. H. B. Maegawa
9.9-P
Hospital for Sick Children, Women_s and Children_s Hospital, Adelaide, Australia, Aarhus University, Aarhus, Denmark, Hospital for Sick Children, Toronto, Canada
Defining pathogenicity of genomic imbalances detected by genome-wide array CGH testing
9.8-P
We report a 6 year old girl with a chromosome 1 short arm interstitial deletion. She presented at age 6 months with seizures and delayed psychomotor development. A holosystolic heart murmur had been detected in infancy. At age 6 years, physical examination indicated normal growth parameters and mild dysmorphic features. Neurological examination revealed axial hypotonia. A small muscular VSD by
C. Lee Harvard Medical School / Brigham and Women_s Hosp With the advent and application of array-based comparative genomic hybridization (array CGH), it has been revealed that the human genome is much more dynamic and variable than previously appreciated (Iafrate et al. Y Nat Genet 36: 949, 2004; Sebat
6th ECC: Abstracts
230 et al. Y Science 305: 525, 2004). Indeed, recent development of a human copy number variation map has demonstrated that any two individuals can differ at hundreds of genomic regions with respect to copy number (Redon et al. Y Nature 444: 444, 2006). This has led to new challenges for the clinical cytogeneticist in the interpretation of the vast amount of information gathered from high resolution, genomewide assays performed in clinical laboratories. Accurate interpretation of the pathogenicity of genomic imbalances will first require better molecular definition of copy number variants (CNVs). We are utilizing multiple array platforms and molecular methods and are successfully defining the breakpoints of specific CNVs within CNV regions annotated in the Database of Genomic Variants. In addition, we are conducting validation studies for CNVs that overlap with genomic regions that are used as diagnostic probes for genomic disorders. We now provide a list of criteria that can be used in genetic counseling services to determine the risk for pathogenicity of a genomic imbalance detected by genome-wide array CGH.
9.10-P
X/Y chromosome tiling-path aCGH to investigate mental retardation at the West Midlands Regional Genetics Laboratory (WMRGL), UK D. McMullan, J. Walker, L. Coleman, D. Lim, J. Morton, L. Brueton and E. V. Davison WMRGL, Birmingham Womens Hospital Approximately 10~15% of cases of MR are thought to be X-linked. To date only ~21 genes have been identified thought to be involved in XLMR, representing a small proportion of total cases. Tiling-path BAC aCGH has recently been employed to identify further X chromosome imbalances and associated gene copy number (Lugtenberg, 2006 and Bauters, 2006). We investigated application of an X/Y tilingpath BAC array developed and validated by the Department of Pathology, Cambridge University (Karcanias, 2007). We tested eighteen XLMR families with previously normal karyotypes and fragile X
results, two Xp22.3 microdeletions identified by 1 Mb arrayCGH in female MR cases and one case of visible Xq24~27 duplication. 4/18 XLMR cases have single clone imbalances (validation of which is ongoing) in non-CNV regions containing genes associated with MR or cognitive development. Both Xp22.3 deletion patients are female and are deleted for the STS gene associated with X-linked icthyosis and occasionally MR in males with concurrent deletion of the VCX-A gene (Van Esch, 2005). MR in female carriers is highly rare (Chocholska, 2006). One case has a ~1.6 Mb deletion typical of the majority of STS cases. VCX-A deletion status is yet to be determined as the distal breakpoint lies at this gene region. The second other case has a larger but more proximal ~3.5 Mb deletion not including VCX-A. Both deletions are being delineated further via Affymetrix 250 k SNP array. Neither case showed evidence of preferential X-inactivation via analysis of the androgen receptor (AR) locus. The severity of these two imbalances in females is intriguing and underlying mechanisms are under further investigation. Higher resolution X-specific arrayCGH is a highly useful tool in delineating X chromosome imbalances and will hopefully elucidate further genes implicated in XLMR. However, given that the imbalances detected in XLMR males were small (~150 Kb), we predict that exon-based oligo-arrays will have a higher detection power.
9.11-P
Array CGH as a clinical service at the West Midlands Regional Genetics Laboratory (WMRGL), UK J. Walker, D. J. McMullan, E. Rattenberry, C. Lamb, L. Brueton and E. V. Davison Birmingham Womens Hospital ArrayCGH was implemented as a diagnostic clinical service at the WMRGL in September 2006. Patients with unexplained learning difficulties and dysmorphism were selected as likely candidates for cryptic imbalance by Consultant Clinical Geneticists. The current frontline automated platform comprises the BlueGnome CytoChip 1 Mb enhanced array, hybridised and washed via a Tecan HS4800Pro, scanned
6th ECC: Abstracts on an Agilent scanner and analysed in BlueFuse software. To date 970 cases with previously normal cytogenetics/FISH and molecular testing have been processed. Most cases have been validated with FISH both in the proband and parents and have been formally reported to the referring clinician. 26% of those validated have likely pathogenic abnormalities including deletions at 1p36, 1q42, 2q23, 3p14, 5q14, 12q24, 16p13, 19p13 and Xp22 (2 cases) and duplications at 7q11, 8q12 and 20q11. Further cases have copy number changes requiring validation which is on-going. Multiple copy number changes were found (2.5 per patient) which were reported as likely copy number variants (CNVs) in light of the findings of Redon et al (Nature, 2006). In addition, the majority of causative imbalances have also been further delineated with the Affymetrix 250/500K SNP array platform and analysed in Copy Number Analysis Tool (CNAT) 4.0 (Affymetrix). We will present our developing strategy for the analysis, follow-up and reporting of cases with particular regard to robust interpretation in the diagnostic setting.
10.1-O
Evidence for variable aneuploidy mechanisms in embryos from couples with distinct indications for preimplantaion genetic screening (PGS) A. Mantzouratou, A. Mania, L. Xanthopolou, S. Tashkandi, A. Doshi, S. Laver, P. Serhal, D. M. Ranieri, J. C. Harper and J. D. A. Delhanty University College London, ACU University College London Hospitals PGS is used to examine the chromosomes of human embryos from patients being treated for one of the following indications: Advanced maternal age (AMA); Recurrent miscarriage (RM); Repeated implantation failure (RIF). The genetic analysis of such embryos provides a valuable insight into the origin and extent of aneuploidy in early human development. In this study, embryos from 75 couples undergoing PGS were investigated for chromosomes 13, 15, 16, 18, 21 and
231 22 using FISH with individual probes in two rounds of hybridisation. Blastomeres were screened on day 3 followed by full follow up analysis on d5/6 of untransferred embryos. 94 PGS cycles are included in which 847 embryos were biopsied, with results obtained for 91%. Of these 19% were found to be diploid at diagnosis and 81% abnormal. The pregnancy rate per cycle to biopsy was 29.5%; 32.9% per embryo transfer. Satisfactory follow up was obtained from 536 embryos. All those diagnosed as abnormal were confirmed as such. Of these 55.7% were chaotic mosaics, 38.8% other mosaics, 5.3% uniformly abnormal. Meiotic errors were identified in 14.8% of embryos, most frequently for chromosomes 21, 18 and 22. Errors in mitosis were detected mostly for chromosomes 15, 16 and 13. There was a significant difference in the distribution of embryos that were uniformly abnormal (pG0.005) and of those with meiotic errors (pG0.005) between the RM, AMA and RIF referral groups (rates 24%, 20% and 8.9% respectively for meiotic errors). We found a much lower proportion of normal embryos after PGS compared with other published data (an average of 1.6T1 per cycle), yet the pregnancy rate remains acceptable. Striking similarities were seen in the abnormalities affecting embryos from the couples with RM and AMA. Couples with RIF appear to be different with a low frequency of identifiable meiotic abnormalities in their embryos suggesting that for the vast majority of embryos of this group post zygotic abnormalities are responsible for their subsequent demise.
10.2-O
Aneuploidy and aneusomy detection in human embryos by array CGH E. Vanneste, C. Le Caignec, C. Melotte, S. Debrock, J. P. Fryns, T. M. D_Hooghde and J. R. Vermeesch KULeuven, Center for Human Genetics, Nantes (France), Service de Ge´ne´tique Me´dicale, KULeuven, Leuven University Fertility Center Array CGH is a new method that can detect genome wide changes in the chromosomal copy number. Thus far, array CGH of isolated single cells has been challenging due to the low amount of DNA present
6th ECC: Abstracts
232 in a single cell. Recently, we developed an array CGH method following Phi29 DNA polymerase amplification that allowed accurate detection of aneuploidies in a single lymphoblast, fibroblast, and blastomere within a single day. Moreover, we showed that an a priori known segmental deletion as small as 34 Mb could be detected (Le Caignec et al. 2006*). After optimization of our protocol enabling the detection of chromosomal imbalances as small as 14 Mb, 113 blastomeres obtained from 15 day 3 and day 4 embryos were analyzed with array CGH. These embryos had been donated for research, since they could not be transferred to the patient due to genetic risks based on their sex, or on the presence of a microdeletion, as detected by FISH, and all remaining blastomeres of these embryos were analysed by array CGH. Surprisingly, in the 11 embryos that were diagnosed as Bchromosomally normal[ by FISH, only 2 embryos had a diploid content in all blastomeres. In 4 embryos, aneuploidy detected by FISH was confirmed by array CGH in the other blastomeres. Furthermore, array CGH in these 4 embryos revealed that these embryos were mosaic. This study further validates the accuracy and efficiency of array CGH for aneuploidy and aneusomy detection in single blastomeres and smoothens the way towards the clinical implementation of this technique in pre-implantation genetic diagnosis.
10.3-O
Preimplantation genetic diagnosis for HLA typing Saglam, H. Karadayi, B. Umay, H. Yelke, G. Karlikaya, F. Fiorentino and S. Kahraman Istanbul Memorial Hospital, Laboratorio Genoma Introduction: Genetically inherited haematopoietic disorders like Beta Thalassemia, Fanconi Anemia and non genetic disorders like leukemia need Haematopoietic Stem Cell Transplantation (HSCT) for the curation of the disease. The objective of this study is to present our five year experience between 2002 and 2007 on preimplantation HLA typing. Materials and methods: Overall 177 cycles were performed for totally 98 couples. 160 of these were for SGD combined with HLA typing applied to 84 couples, 17 of them were for only HLA typing (for
ALL and AML) applied to 14 couples. External and nested PCR amplification was performed on the spare blastomeres biopsied from day 3 embryos. Mutation analysis was done using the minisequencing method while HLA typing was performed using the polymorphic STR markers scattered throughout the HLA gene cluster. Results: Totally 1559 blastomeres were biopsied and 181 (11,6%) of them were transferred to the mother. Out of 177 cycles for HLA typing 122 embryo transfer (ET) cycles were performed. 55 ET cycles were cancelled due to lack of HLA compatible embryos. Totally 47 pregnancies (39.5%) were obtained out of 119 ET cycles. 14 deliveries are obtained while 15 pregnancies are still continuing. In 8 cases the sick child is totally cured after HSCT from the HLA compatible healthy siblings while 6 of them are waiting for the transplantation. Conclusion: Preimplantation HLA typing with or without a single gene disorder is a promising and an effective therapeutic tool for an affected sibling. Our results show the successful diagnosis of single gene disorders and application of HLA typing on the embryos using blastomeres with two-step PCR. Despite the lower probability of finding suitable embryos for embryo transfer, the data presented in this report shows the feasibility and the practicability of PGD-HLA application.
10.1-P
First pregnancy after double PGD analysis on couples carriers of a genetic disease and an aneuploidy risk A. Obradors, E. Ferna´ndez, M. Oliver-Benet, M. Rius, A. de la Fuente, J. Benet and J. Navarro Unitat de Biologı´a CelIlulat i Gene`tica Me`dica, Facultat de Medicina, Universitat Auto`noma de Barcelona, Laboratorio de FIV, Fundacio´n Jime´nez Dı´az, Madrid Preimplantation Genetic Diagnosis (PGD) for monogenic diseases is nowadays widely applied. PGD also applies to detect chromosome abnormalities on embryos of couples with potential risk of aneuploidy, as advanced maternal age. As some couples may
6th ECC: Abstracts need PGD analyses for genetic and cytogenetic risk (i.e. monogenic disease and advanced maternal age), we purpose a PGD protocol including both approaches. A couple carriers of two Cystic Fibrosis mutations (3849+10 Kb and Y1092X) with a maternal age of 38 year old and two previously failed IVFPGD cycles were included as candidates. After ovarian stimulation, 6 mature oocytes were obtained. To detect all chromosomes abnormalities, Comparative Genomic Hibridation (CGH) was applied on the First Polar Body (1PB) biopsed immediately after fertilization on 5 oocytes. On day +3, CGH analysis using a Metasystem_s Software showed that 1PB#1 and 1PB#4 had chromosomic alterations (-Chr.9,Chr.13,+Chr.17;-Chr.6 respectively), 1PB#2 and 1PB#3 had a YCht.13 profile, and 1PB#6 was euploid. Only oocyte#3 and oocyte#6 developed to 6Y8 cell embryos on day +3. One single blastomere was biopsed from those embryos to perform monogenic disease analysis. After whole genome amplification with Multiple Displacement Amplification, a multiplex PCR containing primers for small tandem repeats (STRs: D7S1799 and D7S1817) and mutation amplification primers was performed. MiniSequencing was applied to detect the nucleotide changes that produce both mutations using the f o l l o w i n g p r i m e r s ; 3 8 4 9 + 1 0 K b : 5 ¶T T T TTTTTTCCTTTCAGGGTGTCTTACTC3¶ and Y1092X: 5¶ACCAGCGCAGTGTTGACAG3¶. On day+4, the genetic diagnosis was performed with an ABIPrism sequencer. Embryo#6 carried both mutations and embryo#3 carried only the 3849+10 Kb mutation. Embryo#3 was transferred achieving an ongoing pregnancy. Prenatal diagnosis showed an euploid fetus, result compatible with the reparation of the chromatide gain. The applied procedure can be used to increase the implantation rate in PGD on carriers of a monogenic disease and with aneuploidy risk.
233 Istanbul Memorial Hospital, ASM Foundation Health Care
Acknowledgements: FIS-ISCIII (PI 051395) funded this study.
Introduction: Preimplantation genetic diagnosis is a widespread method which diagnose genetically or chromosomally abnormal embryos of couples at risky group. However, the need to perform this method, is embryos with minimum 6 blastomeres on day 3. Embryos less than 6 blastomeres are excluded since they have a very poor potential to form good-quality embryos after the biopsy. The effect of low oxygen concentration on embryo quality is shown to be beneficial compared to atmospheric oxygen concentration. The aim of this retrospective study was to investigate the effect of 5% oxygen concentration on embryo quality before and after blastomere biopsy. Materials and method: Following the routine ICSI procedure, one blastomere was biopsied from the embryos with at least 6 blastomeres on day 3. They were then fixed and analysed via FISH for any possible abnormalities. Genetically normal embryos were transferred on day 4 or 5. Results: A total of 1811 embryos were obtained on day 3. Significantly more embryos were available for blastomere biopsy on day 3 in 5% oxygen concentration group (group 1) compared to 20% oxygen concentration group (group 2) (90% vs 73% respectively, pG0.05) Therefore more embryos were biopsied in that group compared to group 2. The good-quality embryo rates on the day of transfer was also different between groups (83 vs 64%, pG0.05). No difference was found between groups according to the rate of normally defined embryos after PGD (34 and 32%, p90.05), and the rates of arrested embryos on day 4 were 6% and 22% respectively (pG0.05). The pregnancy rates were similar in both groups (47 and 43%, p90.05). Conclusion: We may conclude that 5% oxygen concentration may help us increase the number of embryos available for blastomere biopsy on day 3 and it may increase the chance of couples to have more good-quality embryos after PGD.
10.2-P
10.3-P
Effect of low oxygen concentration on day 3 embryo quality: how it is related to PGD
Chromosomal abnormalities in spontaneous abortions; A comparison between natural and intracytoplasmic sperm injection pregnancies
U. Kutlu, S. Sertyel, H. Yelke, S. Unal, Z. Atayurt, P. Kutlu and S. Kahraman
6th ECC: Abstracts
234
M. Kirgiz, Engu¨r Ayse, Ozkan Kamile, Karaman Birsen, Dehgan Tahir and Basaran Seher Premed Genetic Diagnosis Center, Istanbul University, Istanbul Medical Faculty, Department of Medical Genetics, Istanbul University, Istanbul Medical Faculty, Department of Medical Genetics andPremed Genetic Diagnosis Center Unbalanced chromosomal abnormalities are most common cause of spontaneous miscarriages within the first trimester of pregnancies. The rate of chromosome abnormalities observed in series of miscarriages in naturally conceived pregnancies ranges from 50 to 70%, which depends on selection criteria such as time of losses, used cytogenetic techniques and tissues, etc. Aneuploidies followed by poliploidies were found to predominate in these series. In vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI) techniques have been widely used to overcome the male infertility since 1992. The rate of chromosomal abnormalities is increased among infertile males, in the cells of blastocyst stage of human embryos obtained by using IVF/ICSI technique. There are several reports showing the increased rate of gonosomal aneuploidies, de novo structural chromosomal anomalies and mosaicism in fetuses of ICSI pregnancies compared to naturally conceived pregnancies. In this study, we compared the cytogenetic findings of spontaneous abortions from 769 naturally and 135 IVF/ICSI conceived pregnancies with respect to the frequency and type of chromosome anomalies. The rate of chromosomal anomalies was 55.68% in natural and 50.36% in IVF/ ICSI conceived pregnancies. Nonmosaic single aneuploidy was the most frequent abnormality in both groups (35.32 and 32.12%), which was followed by poliploidy (9 and 7.30%). The rate of structural chromosome anomalies was similar in both groups (5.96 and 5.84%); however paternal transmission of familial rearrangements (1.25 and 1.46%) was more frequent in IVF/ICSI pregnancies. Mosaicism was found to increase 1.7 fold in IVF/ICSI conceptions (3.47 and 5.84%). These data show that the rate of chromosomal abnormalities is not increased in spontaneous abortions of IVF/ICSI pregnancies. But the mosaicism should be taken more into consideration in preimplantation diagnosis of aneuploidies and prenatal monitoring of IVF/ICSI pregnancies.
10.4-P
Outcome of preimplantation genetic diagnosis in cases with severe sperm morphological defects E. Yuvacan, S. Sertyel, G. Karlikaya, S. Unal, H. Yelke, Z. Atayurt, U. Kutlu, F. Vanliog˘lu and S. Kahraman Istanbul Memorial Hospital Objective: To evaluate the outcome of preimplantation genetic diagnosis in couples whose male partner was diagnosed as having spermatozoa with distinct morphological abnormalities. Materials and Methods: 32 cycles, in which the male partner was diagnosed as having severe sperm morphological defects, were included and classified as follows: 18 cycles with more than 50% macrocephalic sperm forms (Group I), 14 cycles with 0% normal sperm morphology (Group II). 54 non-PGD cycles with male partner having macrocephalic spermatozoa and 66 non-PGD cycles with zero normal morphology were also included as control groups for Group I and II. Blastomere biopsy was realized on embryos with 7 or more blastomeres on day 3 and multicolor FISH analysis was performed for chromosomes 13, 18, 21, X and Y. Results: Transfer of normal embryos after PGD in Group I resulted in 6 pregnancies (37.5%) with the implantation rate of 24.3%. This rates were found to be 32.1 and 10.4% in non-PGD control group, although a significantly higher number of embryos were transferred in the latter (pG0.01). 6 pregnancies (46.1%) were obtained in Group II with the implantation rate 17.5%. Pregnancy and implantation rate in the non-PGD control group were 53.9 and 19.8 respectively. For Group II, abortion rate with or without PGD were 16.7% and 23.5% (pG0.01). Conclusions: Our results show that PGD allows for selection of chromosomally normal embryos and thus, implantation rate can be increased while abortion rate can be dramatically decreased in macrocephalic sperm. PGD does not seem to effect the pregnancy and implantation rates in absolute teratozoospermia, however abortion rate is decreased after PGD. Abnormal gamete cell morphology may give clues about an impending risk of aneuploidy in resultant embryo. Use of macrocephal spermatozoa
6th ECC: Abstracts with possible nuclear or cytoplasmic defects may increase the risk of chromosomal abnormalities.
10.5-P
Endometrial coculture: an effective culture system for preimplantation genetic diagnosis? S. Sertyel, S. Unal, H. Yelke, Z. Atayurt, U. Kutlu, C. Beyazyurek, H. Karagozoglu and S. Kahraman Istanbul Memorial Hospital Objective: Although the cause of repeated implantation failure seems to be multifactorial, studies have indicated a possible beneficial role of endometrial coculture (EC) systems on RIF cases via improving embryo quality and growing rate and are performed to overcome a possible contribution of chromosomal abnormalities on RIF by selecting the chromosomally abnormal embryos via preimplantation genetic diagnosis. This study is undertaken to analyze the cumulative contribution of (EC) in such cases undergoing PGD. Materials and Methods: Overall, 151 cycles in which PGD with the indication of RIF (n Q 3) have been performed were included in the study. Patients were retrospectively grouped according to culture medium used In 98 patients (group I) convantional culture medium has been of choice throughout the culture period and in 53 cycles EC has been utilized. From pre-zygote stage to embryo transfer, daily embryo growth parameters were scored and compared between groups. Blastomere biopsy was performed either on day 3 and normal embryos after FISH analysis were selected for embryo transfer. Results: No statistically significant difference in main patient and cycle parameters. However, when embryo development characteristics were compared, faster cleavage on day 3 (74,8%) were observed in GroupII with respect to GroupI(62.4%). Pregnancy results of this two group are different but they haven_t got statistically significancy. Group II has higher ongoing pregnancy and implantation rates (41,2%, 30,6% respectively) than Group I (38,7%, 24,1). Conclusions: Our results show that culturing embryos on endometrial monolayer cells seems to increase the cleavage rate and the quality of embryos
235 in RIF cases. Furthermore, since increase in cleavage rate can also increase the number of embryos available for biopsy during preimplantation genetic diagnosis, culturing the embryos in endometrial coculture systems can improve the cycle outcome. Therefore, EC can be a successful alternative to conventional culture media in such cases where PGD is planned.
10.6-P
The stage of the embryo but not the number of cells removed may affect the embryo development after biopsy S. Unal, S. Sertyel, H. Yelke, G. Karlikaya, F. Fiorentino, C. Beyazyurek and S. Kahraman Istanbul Memorial Hospital Objective: The objective of this study was to evaluate the effect of one or two blastomere removal on further embryo development in fertile couples undergoing PGD for single gene disorders (PGDSGD) or couples undergoing PGD with HLA typing (PGD-HLA). Materials/methods: In 81 PGD-HLA and/or PGDSGD cycles, a total of 482 and 519 embryos were evaluated on day 4 or day 5 after embryo biopsy and grouped as follows: Group 1 and group 2 include 6Y7 cell-stage embryos after one and two blastomeres removed and group 3 and group 4 consist of 8 cellstage embryos with one and two cells biopsied respectively. Embryos were cultured individually in microdroplets in sequential media and disease-free and/or HLA compatible embryos were selected for embryo transfer where available. Results: On day 4, the number of embryos in compaction-morula stage did not differ significantly in all groups. However, compared to groups 3 and 4, signicifantly lower or retarded blastocyst development was observed in group 1 and 2 (pG0,01). The blastocyst formation rates for groups 1,2,3 and 4 were 25,5%, 24,0%, 53,0% and 49,1% respectively. Conclusion: Although the number of embryos scored was limited, our results can show that removal of one or two blastomeres from 8- or more cell stage
6th ECC: Abstracts
236 embryos favors blastocyst formation better then embryos with lower blastomeres on the same day. Therefore embryos with 8 or more cells can be of choice for embryo biopsy procedures where available.
10.7-P
Vitrification may be an effective cryopreservation technique for remaining normal embryos of PGD cases H. Yelke, S. Sertyel, U. Kutlu, S. Unal, Z. Atayurt, P. Vanderzwalman and S. Kahraman Istanbul Memorial Hospital
embriyos after PGD by vitrification is very effective and ethical application with regard to providing another chance to this patients for futher applications. Furthermore it was shown that biopsy procedure did not effect vitality, survival rate and pregnancy negatively.
10.8-P
Outcomes of Preimplantation Genetic Diagnosis (PGD) in cases having only male factor (MF) and its combination with other indications Z. Atayurt, S. Sertyel, S. Unal, U. Kutlu, H. Yelke and S. Kahraman Istanbul Memorial Hospital
Introduction: The utility of an effective cryopreservation program is important in the case of embryos that have been blastomere biopsied for preimplantation genetic diagnosis (PGD) procedures. In this study, freezing and thawing of surplus PGD applied embryos, diagnosed as normal were evaluated and effectiveness of this application was compared to IVF/ICSI cycle. Methods: A total of 10 PGD cycle embryos have undergone blastomere biopsy for PGD application with different indications. 8 of them were evaluated for aneuploidy screening, 1 of them for single gene disorder (SGD) and 1 of them for SGD and human leukocyte antigen. Blastomer biopsy was performed either on day 3 or on day 4. Normal embryos were selected for embryo transfer after FISH analysis. Surplus normal embryos were vitrified on 4th day after embryo transfer. Results were compared to embyos of non-PGD (IVF/ICSI) cycles, frozen and thawed on day four. Result: There were not any statistically significance in main patient and cycle parameters. The vitality and survival rates of frozenthawed embryos were similar in PGD and ivf/icsi cycles (90,7% vs 83,8 vitality, 78% vs 71% survival rate respectively ). In addition between these two groups there was no significant differences on ongoing pregnancy rate 30% vs 20,8% and implantation rates 15,2% vs 10,3% respectively. Conclusion: According to our results neither the survival rate nor the ongoing pregnancy were significantly difference between PGD and ivf/icsi applied group. Thus freezing of surplus normal
Introduction: Severe MF is one of the major indications which cause to recurrent spontaneous abortions (RSA) and repeated implantation failures (RIF). Here we present our results of Preimplantation Genetic Diagnosis (PGD) cycles for patients having only male factor and its combinations with advanced maternal age (AMA), RIF and RSA. Materials and Methods: Group 1 patients (n = 22) have only MF. Group 2 patients (n = 15) have combination of MF with AMA (Q 38 age). Group 3 comprises patients (n = 28) have both MF and RIF and Group 4 patients (n = 8) have the combination of MF with RSA. Totally 680 embryo were analyzed (216,127,268 and 69 respectively). Briefly, zona drilling was performed by laser and biopsy was done by removal of one blastomere on day 3 and results were given on day 4. Blastomeres were analyzed by fluorescent in situ hybridization (FISH) for 5 to 9 chromosomes, depending on the indication, using two consecutive FISH hybridizations. In these four groups, percentage of biopsied embryos, implantation and ongoing pregnancy rates were evaluated. Results: Of 680 biopsied embryos, 583 had been able to analyzed by FISH (85,7%). In both group 2 and 4 (58.9%, 58.6% respectively) availibility of embryos for biopsy was lower compared to group 1 and 3 (89%, 75.2%, respectively). Ongoing pregnancy rates for group 1, 2, 3 and 4 were 45,0%, 35,7%,50,0 and 37,5 respectively and implantation rates were 24,2%, 19,4%, 33,8% and 26,3%, respectively.
6th ECC: Abstracts Conclusion: Considering the outcomes about ongoing pregnancy and implantation rates, group 2 showed lower implantation and pregnacy rates compared to group 1,3 and 4. Because AMA negatively affects the oocytes structure, endometrial receptivity as well as nondisjunction of chromosomes. These results could be thought that PGD provides benefit to patients, having either male infertility or its combination with RSA, RI˙F and AMA about ongoing pregnancy and implantation rate.
237 somes. It also suggests that the rate of aneuploidies is much higher among translocation carriers than among patients with a normal karyotype. It could be speculated that the chromosomal separation process in meiosis I might be impaired by quadruplet formation or other factors. To reduce the risk for subsequent miscarriages due to unbalanced or additional aberrations, female balanced translocation carriers may benefit from polar body analysis in combination with aneuploidy testing.
10.9-P
Pregnancy outcome in translocation carriers - impact for PGD T. Buchholz, M. Klehr-Martinelli, U. Vogt and A. Clement-Sengewald Gyn-Gen-Lehel Introduction: Translocation carriers experience a higher risk for recurrent miscarriages, due to an unbalanced segregation of their translocated chromosomes. Some miscarriages however, show a balanced segregation of the translocated chromosomes but an additional chromosomal aberration. Aim: The aim of our retrospective study is to evaluate the rate of balanced/unbalanced and additional aberrant karyotypes in pregnancies of balanced translocation carriers. Result: In our centre for polar body genetic diagnosis we overlook a series of 48 patients with a balanced translocation (33 reciprocal and 7 Robertsonian). Of these patients, one hundred thirty seven pregnancies were recorded. Only 16 babies were born (12%), 11 of those were healthy, with a normal or balanced karyotype, 4 carry an unbalanced and 1 carries a 47,t(4:18),+ XXY karyotype. Unfortunately, 86 of 121 miscarriages were not karyotyped. The remaining 35 miscarriages revealed 22 unbalanced, 8 balanced and otherwise normal karyotypes, but 5 balanced and additional aberrant karyotypes. Out of all karyotyped pregnancies (n = 51), we found 26 unbalanced (51%) and 19 balanced (37%) karyotypes. Six pregnancies turned out with an additional chromosomal aberration (12%), 5 due to a single chromosome aneuploidy; one was a triploidy. Conclusion: Our results confirm a high rate of unbalanced segregation of the translocated chromo-
10.10-P
Preimplantation genetic diagnosis for microdeletions using FISH C. Melotte, S. Debrock, E. Vanneste, T. D_Hooghe, J. Crolla, T. De Ravel, E. Legius, JP Frijns and J. R. Vermeesch KULeuven, Centre for human genetics, KULeuven, Leuven University Fertility Centre, Salisbury District Hospital, Wessex regional genetics laboratory Fluorescence in situ hybridisation (FISH) is the main tool for preimplantation genetic diagnosis (PGD) for sex-selection, aneuploidy screening as well as for the detection of unbalanced embryos of translocation or inversion carriers. Except for the detection of imbalances within the dystrophin locus and the 22q11 deletion region, FISH has not been applied in PGD for single gene or genomic disorders. Here, we prepared and/or applied FISH for PGD in seven families encompassing four different disorders. Two deletions cause late onset cancer predisposition syndromes, Von Hippel Lindau syndrome and Neurofibromatosis type I, and two cause autosomal dominant inherited disorders, 22q11 deletion syndrome and aniridia. Of 97 embryos tested in 9 PGD cycles, 22 embryos were suitable for transfer, which resulted in 1 twin pregnancy. Two healthy babies were born. Microdeletions/duplications within a single cell can at present not be detected by molecular diagnostic methods usually applied for PGD of monogenic disorders. We demonstrate that FISH as a tool for PGD in carriers of microdeletions is feasible. Considering that novel genomic screening tools such as array CGH will uncover many novel intrachromosomal imbalances predisposing for
6th ECC: Abstracts
238 different disorders, it seems likely that PGD for such novel aberrations will be requested in the future. FISH is, at present, the best method to perform this selection.
10.11-P
Chromosomal abnormalities in preimplantation embryos derived from ART Y. Saglam, C. Beyazyurek, M. Yesil, H. Yelke, S. Sertyel, G. Karlikaya, S. Lacin, S. Unal and S. Kahraman Istanbul Memorial Hospital, Genetics Center Introduction: Preimplantation Genetic Diagnosis (PGD) has a potential impact on increasing implantation rates and decreasing miscarriages. With fluorescent in situ hybridization (FISH) and microarray techniques, more than 60% of preimplantation embryos have shown to carry at least one or more of the chromosomal abnormalities. Materials and Methods: In 2006, 209 PGS cycles were performed for above indications, nearly half of the cases contained at least one additional PGS indication. PGD indications included advanced maternal age(AMA), male factor(MF), repeated implantation failure(RIF) and recurrent pregnancy loss(RPL). Zona drilling was performed by laser and biopsy was done by removal of one blastomere on day 3. Single blastomere was fixed to slides with hypotonic/fixative method. Blastomeres were analyzed by fluorescent in situ hybridization (FISH) for 5 (13,16,18,21,22) or 9 chromosomes (+15,17,X,Y), using two consecutive hybridizations. Results: Out of 1681 biopsied embryos, 1468 were analyzed by FISH (87%). 58% of the embryos analyzed were found to be abnormal, 199 patients underwent embryo transfer (ET), with a mean ET of 2,2.Overall, 43.6% clinical pregnancy rate has been achieved, with a missed abortion rate of 9%. When indications were analyzed according to maternal age, normal/abnormal embryo rates and pregnancy rates changed dramatically. While, in overall group 52% of embryos were abnormal, when AMA is analyzed separately, the percentage of chromosomally abnormal embryos increased up to 64,4%. Pregnancy rates
varied, again, between patients who have single indications such as AMA(30%), MF(50%), RIF(55%) or RPL(57%). MF, RIF and RPL patients when combined with AMA, had lower pregnancy rates 43%,30% and 31%,respectively. Conclusion:Our results showed that acceptable cumulative pregnancies were obtained in both single and combined indication PGS groups; even with the AMA effect is present. Combined indications decrease the success rates of PGS cycles, but more importantly, presence of AMA had the worst negative effect compared to other single indications.
10.12-P
Management of complex chromosomal rearrangements before preimplantation genetic diagnosis M.-L. Maurin, S. Fay, J.-M. Godet, P. Mabboux, M. Minz, M. Vekemans, G. Tachdjian and S. Brisset INSERM, U782; APHP, Laboratoire Cle´ment Complex chromosomal rearrangements (CCR) are defined as reciprocal exchanges between 2 or more chromosomes and involving at least 3 breakpoints. We report a cryptic complex rearrangement detected during complementary molecular cytogenetic investigations prior to preimplantation genetic diagnosis (PGD). A couple was referred to our laboratory for complementary cytogenetic investigations prior to PGD. The karyotype of the husband had been firstly performed because of oligospermia. Standard karyotype revealed a rearrangement described, using conventional banding techniques only, as a reciprocal translocation between the short arm of chromosome 3 and the long arm of chromosome 5. After genetic counselling, the couple asked for PGD. For all rearrangement carriers eligible for PGD, standard karyotype and FISH studies are performed in order to test probes for interphase FISH on blastomeres. Those investigations revealed a discrepancy with the conclusions of the first conventional karyotype. The (3;5) translocation proved to be a 3 break rearrangement between 3p, 5p and 5q extremities. An additional reciprocal (10;11) translocation was also identified. After genetic counselling, the couple was informed that PGD using FISH probes couldn_t
6th ECC: Abstracts be performed for this 5 breakpoints CCR. Here we report on a new CCR associated with oligospermia. This report stresses the necessity of molecular cytogenetic investigations for all structural rearrangements, especially prior to PGD.
10.13-P
Preimplantation genetic diagnosis: preventive genetic diagnosis technique in reproductive genetics Ercelen, Emel Tutar, Levent Erkan, Meral Gultomruk and Bulent Urman VKV American Hospital Nesrin ERC¸ELEN, Emel TUTAR, Levent ERKAN, ¨ LTOMRUK, Bu¨lent URMAN V.K.V. Meral GU Amerikan Hospital, Genetic Disease Diagnostic Center, Istanbul, Turkey Preimplantation Genetic Diagnosis (PGD) is a technique used to identify genetic anomalies in embryos following in vitro fertilization (IVF) before transferring them into the uterus. PGD is presently the only option available for avoiding a high risk of having a child affected with a genetic disease and multiple pregnancies. 230 IVF/ICSI-PGD-AS clinical cycles were performed between April 2001Y2004 of indications advanced maternal age (AMA), recurrent implantation failures (RIF), recurrent spontaneous abortions (RSA) and severe male factor (SMF). In 230 IVF/ICSI-PGDAS cycles 945 embryos were biopsied on third day of embryo development and one blastomere from each embryo was fixed for aneuploidy testing. MultiVysion PB and 4 Color Custom Probes (Vysis, Inc., Downers Grove, IL, USA) were used in order to analyze embryo for nine chromosomes: 13, 15, 16, 17, 18, 21, 22 and sex chromosomes by using fluorescence in situ hybridization (FISH) technique. On the fifth day IVF lab was informed about results. Of the 945 diagnosed embryos 314 (%33.2) were euploid, 631 (%66.8) were aneuploid. Average analyzed embryo number was 4.1, average maternal age was 36.6 and average previous IVF cycles of each couple was 2.8. Trisomies and monosomies were observed 36% of the cycles (each 18%). Average transferred embryo number was 1.6. Clinical pregnancy and implantation rate were observed 28.1% and 21.8%, respectively.
239 Similar clinical pregnancies and implantation rates were detected in different indication groups: Clinical pregnancy/ embryo transfer for advanced maternal age: 23.1%; for recurrent implantation failure: 28.9%; for recurrent spontaneous abortions: 35%; for severe male factor: 32.1%. In the view of these datas a satisfactory pregnancy rate can be achieved and healthy newborns will be delivered through the implementation of PGD in a poor prognosis patients.
10.14-P
Reproductive options in carrier of satellited Supernumerary Marker Chromosomes (SMCs) Me´ndez, M. C. Martı´nez, L. Rodrigo, C. Rubio, M. Molla´ and J. Landeras IVI - Murcia, IVI-Valencia, IVI-Vigo SMCs are a heterogeneous group of chromosomes with a frequency of 0.14Y0.72/1000 newborns and a higher frequency in infertile males; most of them are derived from the acrocentric chromosomes and these are less likely to be associated with a phenotypic abnormality though related to reproductive failure. Our aim is to improve the reproductive probabilities and to help the carriers to have healthy offspring; we have revised retrospectively ten cases of SMC (7 were inv dup 15p and 3 were derivative from 14/22 chromosomes). In three carriers of inv dup 15p that they were pregnant by ICSI, artificial insemination and spontaneous gestation respectively (n-:1Y3), we performed the Prenatal Diagnosis (DP) and the UPD15 was excluded. To the aim to avoid the nondisjunction subsequent to the marker, we offered the Preimplantational Genetic Diagnosis (DGP) to other six patients. In this way, we made previously studies by FISH using the CEP15 (n-3Y6) or CEP14/22 (n- 8 and 9) probes in interphases of the lymphocytes. The results reveal an elevated proportion of nucleus in which they were not possible to detect the signals that correspond to the markers (31.8%, for CEP15 and 63.8%, for CEP14/22), however these signals can be visualised clearly in all metaphases of the lymphocytes nucleus. We supposed these discrepancies that were observed in all cases, were due to the satellite
6th ECC: Abstracts
240 association that produce a more reduced number of signals in interphases nucleus when the chromosomal morphology is not visualised. In conclusion: 1. As it is usual, DP with molecular study for DUP14 or UPD15 is the genetic advice in fertile carriers. 2.It is not technically possible to distinguish the blastomeres which a satellited marker in their chromosomal constitution. 3.PGD could be offered to the infertile carrier patients using more specifically probes, such as the subtelomeric ones, which permit the selection of balanced embryos, including also the posterior molecular DP to avoid UPD14 or UPD15.
10.15-P
Preimplantation genetic diagnosis of rare single gene disorders Karadayi, B. Umay, Y. Saglam, S. Sertyel, G. Karlikaya, F. Fiorentino and S. Kahraman Istanbul Memorial Hospital, Laboratorio Genoma Introduction: Due to the high rate of consanguinity marriages in Turkey many couples are requesting Preimplantation Genetic Diagnosis (PGD) for various kinds of Single Gene Disorders (SGD) including Gaucher_s Disease, FVII Defficiency, Homocystinuria, Mucopolysaccharidosis Type IIIA, Type IIIB, Type VI, NF1, Tay Sachs Disease, LMD, CMTX, Fragile-X, X-ALD, WAS, Hyper IgM, Huntington_s Disease, Spastic Paraplegia, Retinoblastoma, Neiman Pick Disease, Tuberousclerosis, Alpha Mannosidosis, Diamond-Blackfan Anemia, Fanconi Anemia, LiFraumeni Syndrome, G6PD, FHHNC, Barter Syndrome, CAH, Beta Thalassemia, Cystic Fibrosis, Sickle Cell Anemia, SMA and FMF. In this report, PGD of rare SGDs studied in Istanbul Memorial Hospital since 2002 will be reported. Materials and Methods: External and nested PCR amplification was performed on the spare blastomeres biopsied from the 3rd day embryos. Mutation analysis was done using the Minisequencing method. Results: Since 2002, 265 cycles were performed for 32 different SGDs. 177 (66.8%) of 265 cycles were for SGD combined with HLA typing applied to 98 couples, while 88 (33.2%) of them were for the PGD of a SGD only. Out of 265 cycles 207 (78.1%) embryo transfer (ET) cycles were performed. 58
(21.9%) ET cycles were cancelled due to the lack of healthy or HLA compatible embryos. The average age of these cases were 32.7. Average embryos transferred are 1.96. Totally 90 pregnancies (44.3%) were obtained out of 203 ET cycles. 30 of the pregnancies resulted with birth while 31 of them are still continuing. Conclusion: PGD for rare single gene disorders avoids therapeutic abortion and the psychological trauma in the couples by diagnosing the embryos before implantation. Our results show the successful application of PGD for the diagnosis of single gene disorders at the embryo stage.
10.16-P
Factors affecting outcome of preimplantation genetic diagnosis cycles for translocation cases Beyazyurek, Y. Saglam, M. Yesil, S. Sertyel, G. Karlikaya and S. Kahraman Istanbul Memorial Hospital Introduction: Translocation carriership is one of the major indications for preimplantation genetic diagnosis (PGD).Here we present our results of PGD cycles for translocation carriers and try to investigate factors that may help to predict the outcome. Material and Methods:Between 2001 and 2007, 97 patients underwent 137 PGD cycles.62 patients were carrying reciprocal translocation(RecT), 35 patients were carrying robertsonian translocation(RobT). One cell was removed from each embryo on day 3 via laser biopsy. Blastomeres were fixed with hypotonic solution/3:1 fixative method. Commercially supplied telomeric, locus specific and centromeric probes were used. Sperm FISH analysis was applied to 12 male translocation carriers. Results: 89 cycles for RecT and 48 cycles for RobT carriers resulted in 22% and 27% pregnancies respectively. For RecT 22%, and for RobT carriers, 37% of embryos were found to be normal or balanced. When patients were grouped with respect to the age of woman; for RecT carriers, women whose age were lower than 38, have a clinical pregnancy rate (CPR) of 28.2% while this rate dramatically decreases to 5% for older women. This
6th ECC: Abstracts
241
same age effect was also observed in RobT group since there was significant difference between CPR of young (29.5%) and AMA (14%) patients. Sperm FISH study revealed that average unbalanced sperm in RecT carriers was 77,1% and in RobT carriers 22,5%,while abnormal embryo rates were 78% and 63% in RecT and RobT carriers, respectively. Conclusion:Presence of accompanying factors such as AMA had negative impact on outcomes of both RecT and RobT carriers. Results showed that RecT carriers with AMA have the lowest chance of CPR among other groups. In addition, strong correlation was found between sperm FISH results and abnormal embryo rates for RecT carriers while the same correlation could not be found for RobT carriers. Besides the factors mentioned above, type of rearrangement, positions of breakpoints and embryo developments are another important factors predicting the outcome.
chosen depending of the detectable abnormality and all of them were commercially available. The probes were tested either on the carrier_s lymphocyte preparates in the cases of balanced translocation or on both spouse_s lymphocyte preparates. Altogether over 361 embryos and 533 blastomeres were studied. In these the success rate was 68Y82% depending from the class of study (AS, sexing, reciprocal or robertsonian translocation). From the studied embryos the rate of normal embryos were 40% in As-cases, 58% (desired=girl) in sexing, 22% in reciprocal and 41% in robertsonian translocations. As a result of the IVF-PGD procedures 9 healthy babies have been born. Altogether clinical pregnancy rate/ET was for AS 37,5%, sexing 30%, robT 21% and balT 21% and take home baby rate/ET was 12,5%, 30%, 16% and 7%, respectively. To conclude PGD using FISH is a good option for couples having an advanced risk for abnormal chromosome content to have a chromosomally normal child.
10.17-P
12.1-O
Over 60 cases of PGD-FISH during years 1999Y2007
MLPA for prenatal aneuploidy testing: analytical validation and retrospective clinical evaluation
N. Horelli-Kuitunen, T. Tuuri, S. Ma¨kinen, C. Hyden-Granskog, I. Reima, A.-M. Nordstro¨m, A. Salumets and A. Slunga-Tallberg Medix Laboratories Ltd., Espoo, Finland, Family Federation of Finland, Infertility Clinic, Helsinki, 2, Women_s Hospital, IVF-Unit, Helsinki, Finland, Fertinova Clinic, Helsinki, Felicitas Clinic, Helsinki, Finland, AS Nova Vita Kliinik, Tallinn, Estonia, 1 Over 60 preimplantation genetic diagnostic cases have been performed during years 1999Y2007 using fluorescence in situ hybridization (FISH) method in collaboration between IVF-clinics in Helsinki area (both private and public) and Medix Laboratories. The indications for the IVF-PGD procedures were an advanced risk for an abnormal chromosome number/ material. The advanced risks were due to either one the parents being a translocation carrier, advanced maternal age or repeated failure in IVF treatments. The procedures included 9 AS- (aneuploidy screening), 13 sexing, 19 robertsonian translocation and 20 resiprocal translocation cases. The probes were
B. Faas, A. Kooper, E. Kater-Baats, T. Feuth, J. Janssen, M. Egmund-Petersen and A. Smits Radboud University Nijmegen Medical Centre MLPA for prenatal aneuploidy testing: analytical validation and retrospective clinical evaluation B Faas1, A Kooper1, E Kater1, T Feuth2, J Janssen2, M Egmund-Petersen1, A Smits1 Radboud University Nijmegen Medical Centre, The Netherlands Introduction: MLPA is a PCR-based method that can be used for the rapid detection of the most prevalent prenatal aneuploidies. Objective: 1. To study performance characteristics of MLPA kit P095 (designed for aneuploidy testing) in routine prenatal diagnostics. 2. To retrospectively evaluate the rate of karyotypes not detectable with MLPA in 7140 amniotic fluid samples with referral reason advanced maternal age. Materials and methods: To determine performance characteristics, isolated DNA from uncultured amniocytes with known karyotypes (euploid and aneuploid) and various artificially-made ratios of
6th ECC: Abstracts
242 XX/XY DNA was tested. Final results were obtained using statistical analysis with confidence intervals. Results: 1. Analytical validation showed a 100% sensitivity and specificity for the detection of fullblown aneuploidies. Mosaicisms of 20% of the target chromosomes can be detected. 2. Of the 7140 amniotic fluid samples, 152 showed an abnormal karyotype, 41 of which would have remained undetected with MLPA. This includes 19 balanced familial rearrangements: of the remaining 22, the clinical relevance could not always prenatally be established. This indicates that implementing P095 as a diagnostic stand-alone test for advanced maternal age samples would have resulted in a non-detection rate of possibly clinical relevant abnormalities of 0.3%. Conclusions: Validation studies have shown that for detecting the prenatal most commonly occurring aneuploidies P095 is reliable and rapid, as culturing of amniocytes is not needed. In our laboratory, this has led to the implementation of MLPA in addition to routine prenatal karyotyping. Replacing traditional karyotyping for targeted molecular testing appears to be a logical next step.
12.1-P
Rapid prenatal diagnosis of common chromosome aneuploidies by QF-PCR. Evaluation on 30.000 consecutive clinical samples V. Cirigliano, G. Voglino, E. Ordon˜ez, A. Marongiu, E. Lloveras, A. Plaja, C. Fuster and M. Adinolfi General Lab, Barcelona, Promea Day Surgery, Turin, Universitat Autonoma de Barcelona, University College London Recently it has been shown that rapid prenatal diagnosis by QF-PCR can detect the great majority of chromosome abnormalities, despite being deliberately targeted to disorders affecting three autosomes (21,18 and 13) and the sex chromosomes. Main advantages of the assay are low cost, speed and automation allowing large scale application. We developed a QF-PCR assay that was applied to systematically screen 30.000 prenatal samples with results issued within 24 hours. Most common referral
indications were: raised biochemical risk (32%), advanced maternal age (30%), 6% of these cases with an increased nuchal translucency; parental anxiety generated 22% of samples and abnormal ultrasound was present in 7% of cases. All samples were also tested by cytogenetic analysis. In 28.668 cases normal chromosome complement was correctly assessed by QF-PCR without false positive results. All 1069 non mosaic aneuploidies involving analysed chromosomes were identified with 100% specificity. The assay also proved efficient in detecting 11/21 cases of partial trisomies and 26/47 chromosome mosaicism. In our series QF-PCR assays showed 100% sensitivity in detecting clinically relevant chromosome abnormalities in samples referred for advanced maternal age and increased biochemical risk. In fetuses with ultrasound anomalies the sensitivity was 95%. QF-PCR reliability allowed early termination of affected pregnancies without waiting for cytogenetic analysis. Our results raise the possibility of reducing the load of prenatal cytogenetics if pregnancies are carefully monitored by biochemical and ultrasound tests. Women with positive results are offered amniocentesis or CVS and rapid QF-PCR should always be performed. In cases of normal QF-PCR results cytogenetic analyses might only be performed for fetuses with abnormal ultrasound findings. In countries where large scale cytogenetics is hampered by its cost and lack of technical expertise QF-PCR may be used as the only prenatal diagnostic test
12.2-P
Towards noninvasive prenatal diagnosis of trisomy 21 Down syndrome M. Hulten, F. Crea, W. M. Puszyk and R. W. Old University of Warwick The development of non-invasive prenatal diagnosis (NIPD) of trisomy 21 Down Syndrome based on a maternal blood sample rather than the invasive procedures chorionic villus sampling or amniocentesis, is a long-term goal in reproductive care. Copy number counting of cell-free fetal DNA (cffDNA)
6th ECC: Abstracts
243
sequences in maternal plasma presents a greater challenge than NIPD based upon detecting paternal sequences in cffDNA, already clinically feasible for X-linked disorders and RhD genotyping. One approach for identification of fetal DNA exploits differences in DNA methylation between maternal and cffDNA (the majority of which originates from placental syncytiotrophoblasts). We describe the first identification and characterisation of a panel of chromosome 21-specific sequences (and reference sequences on other autosomes) that are differentially methylated between peripheral blood and placental tissue, DNA sequences which thus constitute candidate biomarkers for NIPD of trisomy 21 Down Syndrome. To select DNA sequences to be screened for differential methylation between these tissues, we adopted three strategies (1) searching public databases for highly differentially expressed genes, (2) choosing Frandom_ promoter regions, and (3) choosing Frandom_ non-promoter regions. We screened these regions by methylation-specific restriction enzymatic and bisulfite-conversion assays, and hence identified a number of differentially methylated sequences located at 21q22.3 (AIRE, CLDN14, and ERG genes), at 1q32.1 (CD48 gene and FAIM3 gene), at 2p14 (ARHGAP25 gene) and at 12.24 (SELPLG gene). Clinical evaluation of the sensitivity and specificity for NIPD of try´somy 21 Down syndrome is underway. This work has been supported by the EC NoE SAFE no LSHB-CT-2004-503243.
and 21). In 10 of these samples, the QF-PCR analysis suggested the presence of an unbalanced non regular chromosome anomaly, which was later on confirmed by cytogenetic analysis in all but one case. In this case not confirmed by cytogenetic analysis, additional molecular evaluation confirmed the presence of an unbalanced karyotype. Regarding the chromosomes involved in the unbalanced structural anomalies, in 6 cases were the sex chromosomes, in 2 cases chromosome 21, and in 2 other cases chromosome 18. Of the 17.670 samples analyzed by QF-PCR in our laboratory, 519 (2.94%) had an abnormal karyotype and 24 (4.62% of the abnormal karyotypes) showed the presence of an unbalanced structural chromosome anomaly. The QF-PCR analysis detected 10 of these 24 (41.66%) unbalanced structural chromosome anomalies, and was important for the cytogenetic diagnosis of the chromosome anomaly in 7 of these 10 samples (29.17% of the total): in 3 it was essential for the characterization of the chromosome anomaly, and in 4 it added further important information. Therefore, and base on our experience, the QF-PCR technique is an important tool for the detection and characterization of non expected, unbalanced structural chromosome anomalies in prenatal diagnosis.
12.3-P
N. Shilova, T. Zolotukhina
Detection of unbalanced structural chromosome anomalies by QF-PCR: An important aid to the prenatal cytogenetic analysis
Research Centre for Medical Genetics of RAMS
M. Carrera, C. de la Iglesia, B. Me´ndez, A. Valldeperas, R. Ferreti, M. M. Punzo´n, R. Jime´nez and M. Rodrı´guez Centro de Patologı´a Celular Since April 1999 until February 2007, we have analyzed a total of 17.679 prenatal samples (chorionic villi or amniotic fluid) by quantitative fluorescent PCR (QF-PCR) for the rapid diagnosis of the common aneuploidies (chromosomes X, Y, 13, 18
12.4-P
Detection of fetal cells in plasma of pregnant women
The aim of this investigation was to detect and to identify fetal cells in maternal plasma, obtained from 28 heparinized maternal blood samples, treated with 4% formaldehyde. Blood samples were drawn from 20 pregnant women 10Y26 week_s gestation carrying a normal male fetus, determined by conventional chromosomal analysis after CVS or cordocentesis. The remaining eight samples, from women carrying a female fetus, served as controls. Five milliliters of maternal blood were centrifuged at 200 g for 10 min to obtain plasma containing a low-density cell population. This fraction was recentrifuged at 784 g for 10 min in 16 cases. Cells were fractionated by centrifugation on a discontinuous Percoll gradient
6th ECC: Abstracts
244 (1.085 g/ml, 1.075 g/ml, 1.060 g/ml, 1.053 g/ml) in remaining 12 samples of maternal plasma (only from women carrying a male fetus). Obtained cell fractions were analyzed by FISH with DXZ1, DYZ3 or DYZ1 DNA- probes. Fetal cells, determined by the presence of DXZ1 signal together with DYZ3 signal, were detected in all maternal plasma samples with the normal male pregnancy, obtained by two-step centrifugation (200 g followed by 784 g). The median frequency of fetal cells was 1.6 ° in these samples. One fetal cell per 1032 maternal cells was detected at average. No Y-fluorescent signals were found in cells from control samples. Fetal cells, determined by presence of DYZ1 signal, were detected only in 6 from 12 cases in maternal plasma samples after Percoll density gradient centrifugation. There are fetal trophoblast cells with density 1.053Y1.060 g/ml, fetal lymphocytes (plasma-1.053 g/ml) and fetal monocytes (1.060Y1.075 g/ml). Fetal erythroblasts with density 1.075Y1.085 g/ml weren_t found in all these samples. Thus different types of fetal nucleated cells were discovered in maternal plasma. Obtaining a relatively enriched sample of fetal cells from maternal blood was more effective by using of a simple two-step centrifugation process.
12.5-P
Triploidy-like QF-PCR profile and normal karyotype in two unusual prenatal cases of chimerism and mosaicism A. Soler, J. Bruguera, C. Morales, M. A. Sala, C. Badenas, A. Nadal, J. M. Martinez, A. Borrell and A. Sa´nchez Hospital Clı´nic, Fundacio´ Clı´nic, Servei Anatomia Patolo`gica, Hospital Clı´nic, Servei Medicina Fetal, Hospital Clı´nic QF-PCR allows rapid prenatal diagnosis of common aneuploidies and triploidies, with a high level of efficiency and reliability. A very few cases of discrepancy with the cytogenetic result have been reported. QF-PCR and cytogenetic analysis were performed in prenatal samples from two patients: a chorionic villi and an amniotic fluid samples. Indications for study were suspected partial mole
and fetal malformations respectively. Further QF-PCR analyses in parents_bloods and in new pre and post-natal samples were performed in both cases, as well as FISH analyses on different sites of the term placenta of the first case. Initial QF-PCR showed a triploidy-like profile in both cases, while the karyotypes obtained were 46,XY and 46,XX respectively. In the first case, the pregnancy went on to term and a healthy boy was born; QF-PCR, cytogenetic and FISH findings led to the interpretation of an androgenetic/biparental quimerism in placenta. In the second case, spontaneous fetal death took place after amniodrainage; QF-PCR and cytogenetic results led to the interpretation of an androgenetic/biparental mosaicism. These two cases illustrate how the combination of cytogenetic and molecular techniques gives the clue to reach a correct diagnosis in unusually complex cases. Partially supported by the grant PI05/0096 to A.S. from Fondo de Investigaciones Sanitarias, Ministerio de Sanidad y Consumo, Spain.
12.6-P
Prenatal detection of a rare population variant 15p F. Stipoljev and R. Lasan-Trcic Hospital Prenatal detection of a rare population variant 15p Stipoljev F1; Lasan-Tre`iæ R2 1Department of Pathology, Cytology and Cytogenetics, Hospital BSveti Duh^ and 2Department of Pediatrics, University Hospital, Zagreb, Croatia A 40-year old primigravida was referred to our centre for prenatal cytogenetic evaluation because of advanced maternal age The amniocentesis was performed at 16 weeks of pregnancy, showing a normal female karyotype with an enlargement of stalk region of chromosome 15. Ultrasonographic examination showed a normal fetal anatomy. FISH analysis was also performed on amnyocytes and parental peripheral blood lymphocytes using centromeric alfa and beta satellite DNA centromere probes and the whole chromosome painting probe for chromosomes 15. It revealed positive signals for all investigated probes. FISH testing for Prader-Willi/Angelman region was
6th ECC: Abstracts negative. The mother has the same variation. They were counselled with clinical geneticist. The infant was delivered by cesarean section at 38 weeks of pregnancy, weighting 2380 g, and was 49 cm long. External morphological appearance was normal except the bilateral clinodactily on both hands, also inherited from her mother. Postnatal 3-year followup was normal.
12.7-P
Cytogenetic Analysis and Quantitative Fluorescent PCR (QF-PCR) for prenatal diagnosis in CVS E. Lloveras, V. Cirigliano, M. Herrero, E. Ordon˜ez, L. Barranco, S. Andreu, S. Martin, J. Mendoza and A. Plaja General-lab S.A. Laboratoris d_Ana`lisis Prenatal diagnosis on CVS is usually performed by cytogenetic analysis of spontaneously dividing cytotrophoblastic cells (STC) followed by a second karyotype on long term cultures (LTC). Main drawbacks of this approach are possible discordance between two results obtained on different cell populations, confined placental mosaicism and maternal cell contamination. We present our experience on 428 CVS that lead to replace STC with rapid QF- PCR. A total of 84 samples were analyzed by STC and LTC, 65 by QF-PCR, STC, and LTC, 279 by QF-PCR and LTC. At least 20 cells were analyzed in LTC. In mosaic cases follow up with amniocentesis was suggested. Abnormal results detected by QF-PCR were confirmed on a second independent fragment. Cytogenetic abnormalities were detected in 44 out of 428 cases (10%). STC failed in 33/149 cases (22%), mainly because small sample size, LTC failed in 19/ 428 samples (4%). QF-PCR analysis was possible in all cases. In three cases with normal STC results the higher resolution of LTC revealed the presence of chromosome abnormalities. Two false positives were observed in LTC: a mosaic trisomy 18 (with normal QF-PCR and amniotic fluid culture) and one case of 48,XY,+2,+12 with normal QF-PCR (AF in process). In one case maternal cell overgrowth during LTC could be assessed by the discrepancy with the QF-PCR result of normal male. Extensive re-analysis
245 of cultures allowed then to detect 46,XY[7] cells in a total of 300 metaphases. QF-PCR failed to detect two cases of trisomy 8, one case of add(8p), one case with a r(18) and three balanced translocations. The frequent reception of very small samples determining a high failure rate observed in STC prompted its replacement with the QF-PCR. In our hands, rapid QF-PCR test coupled with LTC, resulted in the most robust diagnostic approach with high predictive value. It reduced the number of false positives being also suitable for cases with a very limited amount of sample.
12.8-P
First prenatal case of a de novo deletion del(4)(q31.3) defined by array-CGH Y proposal of a phenotype-karyotype correlation R.-D. Wegner, M. Entezami, N. Sarioglu, A. Mattha¨i, J. Landowski, U. Knoll, A. Hagen, R. Becker, M. Stumm and E. Klopocki Center of Prenatal Diagnosis, Paidopathology Charite, Institut fu¨r Klinische Genetik, TU Dresden, Gynecology, Sonnenallee 68, Berlin, Institute of Medical Genetics, Charite Campus Virchow Here we describe the first prenatal case of a de novo deletion in chromosome 4q - del(4)(q31.3) - investigated by conventional chromosome analysis and by molecular cytogenetics. In particular, array-CGH was applied to precisely determine the breakpoints which enables an improved karyotype-phenotype correlation as compared to cases reported hitherto. Moreover, the ultrasonographic data as well as the pathological results are essential contributions to reach this goal and provide - for the first time - a prenatal phenotype of this deletion 4q. The 33-yearold patient, a 3rd gravida, 1st para, 1 abortion, presented in the 22nd. gestational week (gw) with the following ultrasonographical abnormalities of the fetus: intrauterine growth restriction, increased nuchal translucency of 9.0 mm, singular umbilical artery, heart anomaly (DORV, transposition of the great arteries), club foot, clinodactyly, and diminished amniotic fluid volume. Pathological examinations
6th ECC: Abstracts
246 of the fetus in the 24th gw confirmed the prenatal findings. In addition, the palate showed median clefting. The chromosome analysis on amniocytes after GTG-banding showed a terminal deletion del(4)(q31.3). This deletion was confirmed by array-CGH using a BAC-array with a resolution of 1 Mb. The proximal breakpoint was located between the BAC clones RP11-259G7 (4q31.3) and RP11-27G13 (4q32.1) while the distal breakpoint was located telomeric of BAC clone CTC-963K6. Thus, the deleted segment encompasses õ35 Mb. Surprisingly, array-CGH revealed an additional deletion of about 4.6 Mb in chromosome 13: arr cgh 13q13.3q14.11 (RP11-56M2-RP11-2P5)x1. This deletion involves only parts of these two bands since chromosome 13 does not show a microscopical deletion at a banding resolution of 600 bands/haploid genome. Confirmation by FISH demonstrated the de novo occurrence in the fetus. The cytogenetic findings in our case will be compared to the few postnatal cases hitherto described in the literature.
cells). QF-PCR proved very effective with a positive predictive value of 100%: we had 42 abnormal karyotypes, 35 of them correctly predicted by QFPCR; the rest included 5 balanced familial structural rearrangements, one trisomy 14 and one del(8q). It was not possible to obtain the karyotype in 20 cases due to poor sampling, but amniocentesis was required in only 5 of them, the rest being informed only with QF-PCR. Discrepancy was detected in one case: QF-PCR detected XY in one fragment and XXY in another fragment with the result of a normal male karyotype in both LTC;this was interpreted as confined placental mosaicism (CPM). DNA was extracted of the digested villi after this case. There were also two more cases of probably CPM afecting chromosomes 2 and 8, respectively. Maternal contamination was found in 4 cases, but the match with maternal DNA sampling could solve the situation. STC was useful in rapid c o n fi r m a t i o n o f o n e d o u b l e a n e u p l o i d y (48,XXY+18)and one trisomy 14. DNA extraction from mesoderm cells (LTC) is preferred in order to avoid discrepancies or CPM
12.9-P
Introducing QF-PCR in CVS: our experience in 500 consecutive cases C. Mediano, V. Cirigliano, L. Espi, M. Jallas, A. Fernandez, J. Sagala and M. A. Sanchez-Duran Hospital Vall d_Hebron, General Lab Rapid QF-PCR analysis for 13,18,21 and sex chromosome aneuploidies has been offered to women undergoing chorionic villus sampling (CVS), in addition to karyotype, since 2003. We report our experience in 500 pregnancies using this approach. Short-term cultures (STC) and long-term cultures (LTC)were used for cytogenetic analysis. With the QF-PCR technique we have progressively abandoned the STC, which has improved our results in terms of work, time response and size of the sample required. 3Y5 mgr frond fragments of well-identified fresh villi were chosen for QF-PCR. Two independents LTC were established using double digestion with trypsin and collagenase. In the last 100 pregnancies we extracted DNA for QF-PCR of the cellular pool obtained after the collagenase digestion (mesoderm
12.10-P
Rapid aneuploidy detection by QF-PCR during routine prenatal diagnosis: experience and lessons derived in a large series of samples from one center in Greece C. Konialis, S. Karapanou, B. Hagnefelt, K. Kazamia, A. Markaki, E. Vasila, V. Karayianni, K. Skoumpla, M. Karampela and C. Pangalos Intergenetics Hellas - Diagnostic Genetic Center Introduction: The rapid detection of aneuploidies involving chromosomes 13, 18, 21, X and Y, the most common chromosomal abnormalities encountered in prenatal diagnosis, has become a routine practice in most genetic laboratories through the use of QF-PCR. The main advantages of this technique are the relatively low cost and high speed, enabling in most cases a result within 24 hours from sampling and the relief of anxiety of most patients. Although the clinical utility of this assay has generally been
6th ECC: Abstracts confirmed, there still remain serious issues regarding its proposed wide-scale application as a possible standalone prenatal test for the detection of chromosomal abnormalities. Methods: A rapid DNA extraction protocol was applied for all 13,771 amniotic fluid and chorionic villus samples (CVS). QF-PCR was performed using a multiplex PCR reaction for the simultaneous analysis of 3Y4 polymorphic small tandem repeats (STR) markers for each of chromosomes 13, 18, 21, X combined with the sex marker amelogenin. A second PCR multiplex reaction, containing 2 additional STR markers for each of the above chromosomes was applied in cases of observed homozygosity following the initial analysis. All samples exhibiting possible abnormalities were analyzed twice. Results: All samples involving full trisomies for chromosomes 13, 18 and 21 were correctly diagnosed, with the exception of 2 cases observed in CVS. A total of 13 discrepancies were observed involving aneuploidies of sex chromosomes, mainly XO. Detection of chromosomal mosaicism, although suspected in many cases, was not evaluated or reported. Conclusions: Our experience suggests that the widespread application of QF-PCR in prenatal diagnosis should be applied with a degree of caution. Although there is a very low rate of misdiagnosis, evaluating complex sex chromosome aneuploidies and mosaics is often problematic, while we propose that the information contained within the clinical reports should be discussed and possibly re-evaluated.
12.11-P
Two different approaches for noninvasive diagnosis of fetal gender from maternal plasma Jasenka Wagner, Doroteja Pavan-Jukic and Gordan Lauc School of Medicine, General Hospital Karlovac, School of Medicine For the last forty years, cytogenetic prenatal karyotyping is the golden standard for prenatal diagnosis. However, this commonly used invasive technique has
247 some disadvantages, the most important one being low, but definite risk both for fetus and mother. Since the discoveries of fetal cell free DNA in maternal circulation ten years ago, there were many attempts to develop safer noninvasive methods for prenatal diagnosis. In families with X-linked recessive genetic disorder it is important to determine fetal gender early. For this reason we have developed and compared two different methods for the detection of fetal Y-chromosome in maternal plasma: multiplex PCR and real time PCR. Cell free DNA was isolated from 90 samples of maternal plasma (lenght of gestation 11Y36 weeks) using QIAamp Blood DNA kit. Extracted cell free DNA was: a) amplified using AmpFl STR Identifiler kit (15 STR loci and gender specific amelogenin) and subsequently analyzed on capillary electrophoresis system ABI PRISM 310 Genetic Analyzer, or b) amplified and analyzed using Quantifiler Y Human Male DNA Quantification kit (SRY gene). Gender of fetuses was confirmed by cytogenetic analysis or phenotypically at birth. Out of 49 pregnancies with male fetuses, we have successfully determined presence of Y chromosome in all of them. However, in 7 cases we managed to detect Y chromosome using only one method, while the other method failed to detect it. Results obtained by multiplex PCR were correct in 45 cases (92%), while the results obtained by real time PCR were accurate in 46 cases (94%) of male fetuses. There were no falsely detected Y chromosomes in female fetuses.
12.12-P
Microarray-based screen for the identification of differential feto-maternal DNA methylation markers and development for NIPD of chromosome disorders E. Papageorgiou, H. Fiegler, N. P. Carter and P. Patsalis 1The Wellcome Trust Sanger Institute, 2The Cyprus Institute of Neurology and Genetics, 1The Wellcome Trust Sanger Institute, 1The Wellcome Trust Sanger Institute, 2The Cyprus Institute of Neurology and Genetics The discovery of free fetal DNA in maternal plasma allows future development of noninvasive prenatal
6th ECC: Abstracts
248 diagnosis (NIPD). We used DNA microarray technology to screen for sequences that are differentially methylated between maternal blood and fetal DNA (placenta) to find candidate regions for NIPD assays. Methylation DNA Immunoprecipitation (MeDIP) was applied to DNA samples derived from female whole blood and placenta. Hybridisation of the MeDIP enriched fractions to a whole genome tilling path BAC array identified large regions of methylation differences between the two tissues with relatively poor resolution. We then hybridised the same material to higher resolution oligo arrays specific for the chromosomes that have been associated with common euploidies (chr13, 18, 21, X, Y). The probes used in the oligo arrays are 50Y60 bp long with a median spacing of 225 bp for chr13, 170 bp for chr18, 70 bp for chr21, 340 bp for chrX and 20 bp for chrY. The results from the oligo arrays have shown small regions of several consecutive probes to be differentially methylated between whole blood and placenta in all five chromosomes. A detailed analysis of the results obtained from chr18 and chr21 has revealed 42 regions on chr18 and 34 regions on chr21 that are differentially methylated between whole blood and placenta. The Maspin promoter region (located on chr18) was found to be hypermethylated in whole blood compared to placenta as was expected based on the study of Chim et al. (2004). The methylation status of the maspin promoter region and the methylation status of two additional regions on chr21 where confirmed by real-time quantitative PCR. Although the results from the high resolution oligo arrays and the real time quantitative PCR look promissing, additional experiments are being performed in order to investigate the degree of MeDiP variability as well as the degree of methylation variability between individual samples.
Baskent University Faculty of Medicine Department of Medical Genetics, Ankara, Turkey, Baskent University Faculty of Medicine Department of Obstetrics and Gynecology, Ankara, Turkey, Baskent University Faculty of Medicine Department of Obstetrics and Gynecology, Ankara, Turkey
12.13-P
Ethical considerations regarding parental decisions for termination following prenatal diagnosis of sex chromosome abnormalities
INSERM U782, AP-HP, Univ Paris-Sud, AP-HP, Gyne´cologie, Clamart, AP-HP, Pe´diatrie, Clamart, AP-HP, Biochimie, Clamart, AP-HP, Anatomie Pathologique, Clamart, AP-HP, Anatomie Pathologique, Clamart, Laboratoire Pasteur Cerba, Cergy Pontoise
Z. Yilmaz, F. I. Sahin, T. Bulakbasi, O. Ozalp Yuregir, E. Tarim and F. Yanik
We report an exceptional family with two fetuses presenting an increased nuchal translucency (NT)
Termination rates following prenatal diagnosis of sex chromosome abnormalities have been reported to be in a very wide spectrum (12.7Y86.5%) in various studies. The different attitudes in management may depend on several facts; the type of the abnormality, the indication for prenatal testing, number of previous healthy children and whether the pregnancy was assisted or spontaneous. Over a period of 5 years, out of all amniocentesis patients analyzed in our centre (n=1130), 12 cases (1.06%) were diagnosed as having sex chromosome abnormalities. Five (41.67%) of these pregnancies were terminated (one case with 47,XXY, one case with 46,X,del(X), and three cases with 45,X karyotype); whereas seven pregnancies (58.33%) continued. Among the factors influencing parents_ decision-making, the attitude of the health-care professional giving the post diagnosis counseling seems to be the most important. Nevertheless it should also be considered that the socioeconomic and educational status of the parents affects the process immensely.
12.14-P
Prenatal diagnoses of a recurrent 4q duplication in two fetuses from a couple with normal karyotypes S. Brisset, M.-L. Maurin, O. Picone, P. Labrune, F. Petit, G. Rousseau, M. Laroudie, S. Prevot, S. Tapia and G. Tachdjian
6th ECC: Abstracts associated with an interstitial duplication of chromosome 4. The first pregnancy was marked by an increased NT (4.5 mm) during the first trimester. The parents were non-consanguineous and the family history was unremarkable. Chorionic villus sampling (CVS) was performed and chromosome analysis revealed an enlarged long arm of one chromosome 4. Parental chromosomes were normal. After genetic counselling, a termination of pregnancy was performed at 20 weeks of gestation according to French law. The autopsy showed a female fetus with growth retardation, dysmorphy, cardiopathy and lung malformation. The couple was advised of the low risk of recurrence of such a de novo structural anomaly. The second pregnancy was also marked by an increased NT (5 mm) and surprisingly CVS showed the recurrence of the enlarged 4q. Fluorescence in situ hybridization (FISH) with a whole chromosome 4 painting probe confirmed the additional material as being of chromosome 4 origin. To further define the duplication we performed a microarray comparative genomic hybridization (microarray CGH). Microarray CGH and subsequent FISH experiments with BAC clones showed a 66 Mb interstitial duplication [dup(4)(q22.3q32.2)]. High resolution chromosome and FISH analyses performed on parental chromosomes were normal. Ultrasound examination of the fetus was normal and the couple elected to continue the pregnancy. Examination of the baby boy after birth showed dysmorphic features without visceral malformations. He had not any thumb or urogenital anomalies, nor cardiac defect associated with previous reports of duplication 4q. Parental origin of the duplication 4q was investigated. Microsatellite analysis was consistent with maternal origin. We hypothesized that the recurrence of duplication 4q arose from maternal germinal mosaicism. This case highlights that genetic counselling for apparently de novo chromosome abnormalities should be quite careful with regards to gonadal mosaicism.
12.15-P
False negative results in non-invasive down syndrome screening tests Pehlivan, D. Acarsoz, Z. Azakli, H. Kayserili and S. Basaran Istanbul Medical Faculty
249 In the last 20 years many biochemical and ultrasonographic markers have been developed and used in the prenatal monitoring of the pregnancies for the screening of Down syndrome. Several strategies have been described for the first and second trimesters and their sensitivities have been reported as 64 to 96%. Detection rates are elevated when trained and certified perinatologists and labours perform these tests. It is generally recommended to use the test, which is most suitable in the local area. We aimed to find out the factors, which led to false negative screening result in our series. Therefore, we evaluated retrospectively Down syndrome patients_ record diagnosed by postnatal karyotyping between 1994Y2006 in our department. In the 71 pregnancies, screening test was resulted as Bscreen negative^ for Down syndrome. Out of these, 58 were triple and 13 were first trimester test. In the group of Btriple test B(n: 58), calculated risk was lower than prior risk in the 32 tests. In 12 of them maternal age was 935 years. Despite of the calculated risk was 1:256 and 1:290 in two cases, the result was interpreted as Bscreen negative^ because of the cut off level was 1:200 in the used program. In 26 triple tests, calculated risk was higher than prior risk. In 8 cases, calculated risk was between 1:235 and 1:377, which were less than cut off value (1:200). The risk was observed to be elevated 92 fold in 17 of 26 tests. In the group of B1.trimester screening test^ (n:13), the combined risk was lower than age related prior risk. Only in 2 tests, the combined risk was 1:274 and 1:350, which were interpreted as Bscreen negative^. In this study, we will discuss the possible factors, which might lead to false negative result in the Down syndrome screening tests in pregnancies.
12.16-P
Prenatal FISH diagnosis of mosaic tri- and tetraploidy in a fetus with regular trisomy 13 Krzysztof Piotrowski, Maria Konstantinou, Zbigniew Celewicz, Stanisław Zaja$ czek and Bogdan Kałuz˙ewski Dept of Medical Genetics and Pathomorphology, Pomeranian Medical University, Szczecin, Poland, Dept of Genetics, Medical University,
6th ECC: Abstracts
250 Lodz, Poland, Dept of Obstetrics and Gynaecology, Mother and Child Hospital BZdroje^, Szczecin, Poland, Dept of Medical Genetics and Pathomorphology, Pomeranian Medical University, Szczecin, Poland The probant was 8 Y multigravida and 8-para, 42 old woman, genetic diseases were not recorded in IIIgeneration pedigree at her and her husband family. During the pregnancy multiple fetal anomalies were identified by ultrasounds as early as 17 weeks. These included agenesis of corpus callosum, mild ventrculomegaly, hypoplasia of left heart ventricle, cleft palate, hyperechogenic bowls, overlapping fingers and polydactyly visible only in right hand. Fetal hypotrophy was first detected as late in IIIrd trimester. Pre- and postnatally any placental patologies were not detected. Amniocenthesis was performed in 18th week of gestation and FISH analysis was performed by simultaneous use of several probes showed tri Y and tetraplody in 12% of the investigated amniocytes and simultaneoulsly regular trisomy 13. At 35 th weeks of pragnancy intrauterine death was detected and preterm labour was induced. Autopsy and neonate cytogenetic analyses were not performed due to parent disclaiming.
12.17-P
Rapid detection of chromosomal Aneuploidies in uncultured Amniocytes by Multiplex Ligation-Dependent Amplification (MLPA) technique Muslumanoglu, H. Yurdakul, B. Durak, T. Sener, E. Tepeli, S. Demir and S. Artan Eskisehir Osmangazi University Medical Faculty Department of Medical Genetics Eskisehir-Turkey, Eskisehir Osmangazi University Medical Faculty Departments of Obstetrics and Gynecology Eskisehir-Turkey Cytogenetics is an important part of the prenatal diagnosis of numerical/structural chromosome aberrations. Various molecular technologies have been introduced to this field for rapid aneuploidy detection and diagnosis of rearrangements smaller than
5Y10 Mbs. The technique, MLPA provides relative quantification of different DNA sequences by single tube reaction is a new promising molecular technique for rapid aneuploidy detection. Aim To test whether MLPA can be used for the detection of aneuploidy of chromosomes 13,18,21,X, and Y in uncultured amniocytes, we performed a prospective study based on 500 amniotic fluid samples. Methods: Following DNA extractions from 2 ml amniotic fluids, computer-assisted MLPA aneuploidy screening was performed and then each peak area analysed by the Coffalyser programme.The results were compared with fetal karyotypes and directFISH analysis. Results: In 20 cases (4%), the result was inconclusive owing to an insufficient amount of DNA. According to conclusive 480 tests, 453 normal and 27 aneuploid results (24 autosomal trisomy, one XXY, one XXX and one monosomy X) were concordant with those of karyotyping and directFISH. There was one case of 69,XXX triploidy that could not be detected by MLPA. Conclusion: Sensitivity, specificity, and failure rate of MLPA were comparable to those of FISH and QF-PCR. We concluded that automatic computer assisted MLPA is a rapid, simple and reliable method for detection of aneuploidies in prenatal diagnostics but not for diagnosis of triploidy and structural chromosome aberrations.
12.18-P
Difficulties in interpretation of FISH analysis in prenatal diagnosis C. Villalon Villarroel, P. Cabello, A. Gonzalez de La Vega, M. C. Sanchez-Hombre, M. T. Ferro, E. Garcia-Galloway, J. M. Garcia-Sagredo and C. San Roman Medical Genetics, Hospital Universitario Ramon y Cajal, Madrid, Spain, Circagen Laboratory, Madrid We report one case of prenatal chromosomes diagnosis, in which, it has been necessary to combine the use of the available molecular techniques and the conventional techniques of cytogenetic. A 31 years old pregnant woman was referred for amniocentesis
6th ECC: Abstracts at twenty week gestation because ultrasound examination showed a single umbilical cord artery. Due to the gestational age, we decided to use the multiprobe-fish (vysis) for the more frequent aneuploidies (13, 14, 21, X, and Y). The hibridization analyses showed an extra signal of chromosome 21; this extra signal had an appearance of Bsplit or amplification^. Under the suspicion of a possible duplication in part of the chromosome 21, we had studied the parents. Karyotypes of both parents were normal, futher more we used the same 21 FISH-probe for chromosome 21 which showed normal hybridization images. Due to those difficulties in interpretation, we carried out quantitative PCR of amniotic fluid cells, showing one trialelic amplification pattern for the marker D21S11 of chromosome 21.In parallel, we made amniotic fluid cells culture, so at the end of this time we obtained chromosome spreads of the fetus, showing a normal karyotype. In the mother_s karyotype, FISH hybridization of chromosome 21 showed the same extra signal seen in the amniotic fluid, suggesting us that it would be a polymorphism. We conclude that the fetus carry the same maternal polymorphic variation of the chromosome 21. A healthy child was born after a normal pregnancy.
12.19-P
251 13. A total of 5 markers for the X and Y chromosome and 4 markers for the chromosomes 21, 18 and 13. Conventional cytogenetic analysis was also performed on all prenatal samples. Results: DNA extraction and QF-PCR were successful in all samples and they were compared with the results of the cytogenetic analysis. After the QFPCR analysis one trisomy 21, one trisomy 18, one Turner Syndrome, one Klinefelter Syndrome and one polyploidy results were obtained and also one of the sample was the mosaic for trisomy 21. All this results also confirmed by cytogenetic analysis except mosaic trisomy 21. In the karyotyping methods two anomalies, mosaic 45,X/47,XXX and translocation 47,XX,der(15),t(4;15) were found which could not be detected by QF-PCR. One of the sample was not analyzed because of maternal contamination. Conclusions: The analysis of prenatal diagnosis performed by both QF-PCR and conventional cytogenetics show the advantages of molecular technique on fetal samples. QF-PCR allows the detection of major numerical chromosome disorders within a few hours of sample collection. So it relieves anxiety of parents. The results show that QF-PCR is a rapid, simple and accurate test in the prenatal diagnosis also it shows the maternal contamination in the prenatal samples.
QF-PCR in prenatal diagnosis
12.20-P
Semiz, B. Umay, M. Yesil, H. Karadayi, A. Ozden, Y. Sabuncuoglu, Y. Saglam, C. Yilanlioglu and S. Kahraman
Is isolated fetal choroid plexus cysts and indication for Amniocentesis?
Istanbul Memorial Hospital Introduction: Quantitative Fluorescent Polymerase Chain Reaction (QF-PCR) is the newly used methods in prenatal diagnosis. It allows the detection of common chromosomal aneuploidies 13,18, 21 and XY in a few hours. This study validate the QF-PCR results in our center. Materials and Methods: Prenatal diagnosis is requested for advanced maternal age, abnormal serum screening, abnormal ultrasound findings and abnormal triple test results. 161 amniotic fluid (AF) and 24 chorionic villous sampling (CVS) samples were collected. Genomic DNA was isolated from 2Y3 ml of AF and a small villous fragment. QF-PCR was performed for chromosomes X, Y, 21, 18 and
J. M. Garcia-Sagredo, C. Villalon, M.T. Ferro, M. Talavera, A. de Leon, E. Garcia-Galloway and C. San Roman Medical Genetics, Hospital Universitario Ramon y Cajal, Madrid, Spain The objective of this study was to determine whether an isolated finding of choriod plexus cyst is an indication for prenatal diagnosis. Reviewing our series, we have study 37 pregnancies in which a second trimester ultrasonographic examination showed choroid plexus cyst as isolated anomaly. In one case the ultrasonographic revealed choriod plexus cyts plus foot varus. In all cases cytogenetic analysis of the fetus was performed by amniocentesis. The kyrotype was normal in all pregnancies
6th ECC: Abstracts
252 except in the fetus with choriod plexus cyst plus foot varus whose karyotype was 47,XX,+18. These results together with the literature review indicate that despite the anxiety arised in the pregnant women by the knowledge of this finding, the risk of amniocentesis is not acceptable if choroid plexus cyst is the unique finding.
12.21-P
Prenatal diagnosis of two cases of Mosaicism for an isochromosome of 20q
scopic lesions; the presence of isochromosome 20q cells could not be confirmed. We are investigating about the presence of partial trisomy 20 in the placenta. In the second case amniocentesis was performed at 17 week of gestation because of individual choice in a 29 years old woman without previous pregnancy. There was no family history of congenital malformations. In 5 out of 15 separated colonies of amniocytes, an abnormal karyotype of 46,XY,i(20)(q10) was noted. The pregnancy was terminated at the 21th weeks of gestation. Macroscopic analysis post-mortem reveal a fetus of 270 g without abnormal phenotype, the karyotype is under investigation.
Simi, C. Giuliani, F. Veroni, V. Nardini and S. Rossi Department of Obstetrics and Gynaecology, Cytogenetics and Molecular Genetics Laboratory, S. Claire Hospital, Pisa, Italy, Department of Oncology, University of Pisa, Pisa, Italy Prenatally diagnosed mosaicism for isochromosome 20q has been generally reported in association with a normal outcome at birth and has been rarely confirmed postnatally. Although this lack of confirmation has been attribuited to confinement of the abnormal cell to the extraembryonic lineages, isochromosome 20q has never been observed in trophoblast and stroma cells and placenta. The origin of these abnormal cells is unclear and there are few reports of long-term outcomes. While higher level of trisomy and poorer outcome were associated with male gender in free trisomy 20 mosaicism, this do not appear to be true for isochromosome 20q mosaicism. Only four cases were reported with abnormal outcome, but the range of phenotype seems greater than one might expect if due to a common mechanism. We described two new cases of mosaic isochromosome 20q revealed by amniocentesis. In the first case the 33 year old woman, with two previous miscarriage, was referred for amniocentesis at the 16th weeks of gestation because of high risk of 13, 18 and 21 trisomy. Cytogenetic diagnosis on cultured amniocytes was 46,XY(50%)/46,XY,i(20)(q10)(50%). FISH analysis was performed with 20p and q subtelomeric probes. The pregnancy was terminated because of amenorrhea and premature membrane fracture. Post mortem examination reveal a 220 g male fetus with low set ears and without macro-
12.22-P
Set up and validation of a pericentromeric clone set aimed at improved diagnosis of supernumerary marker chromosomes Valtorta Emanuele, Recalcati Maria Paola, Castronovo Chiara, Valtorta Chiara, Giardino Daniela, Larizza Lidia and Finelli Palma Istituto Auxologico italiano, Division of Medical Genetics, San Paolo School of Medicine, University of Milan, Italy., Dept. of Biology and Genetics for Medical Sciences, University of Milan The pericentromeric regions of human chromosomes are of great biological and clinical importance as they represent transition territories between non coding repetitive DNA (centromeric heterochromatin) and euchromatic regions. These regions include coding sequences interspersed in a complex mosaic structure, rich of duplicons, a reason why their sequencing is technically hard, so that a complementary (target) approach is necessary to elucidate their role in human disease. It is known that small supernumerary marker chromosomes (sSMCs), generally containing a centromeric/pericentric region, represent a chromosomal abnormality with a wide range of morphology and a highly variable incidence. One of the major problems in diagnostic laboratories
6th ECC: Abstracts is the identification of the origin and possible gene content of sSMCs: thus their detection gives rise to considerable problems in genetic counselling, particularly during prenatal testing. We have foreseen to develop a set of pericentromeric clones covering the most proximal unique DNA sequences of 43 chromosomes arms, which exclude the acrocentric p arms. For each chromosome arm we planned to prepare a core clone panel bridging the heterochromatin/euchromatin region, usually comprising 4 overlapping clones, mapped outside segmental duplications and not contiguous clones allowing a fine characterization of sSMCs. Given the complex structure of these regions, we expected difficulties in setting up the clone pane due to the selection of clones showing unique hybridization signals on the wrong chromosome or showing cross-hybridization on multiple loci. We assayed so far 320 clones, of which 125 (39%) were excluded as 42 (13%) showed wrong chromosome localization and 83 (26%) a multiple cross-hybridization. The application utility of this new tool has been checked and validated by the characterization of a few marker chromosomes, two originated from chromosome14 or 22, one from chromosome 13 or 21 and one from chromosome 2, identified during routine prenatal testing.
12.23-P
Maternal age, triple test, sonographic finding, sex ratio and associated major anomalies among fetal cases cytogenetically studied during prenatal diagnosis
253 (n=25) d) Parental anxiety (n=27) e) Abnormal triple test (n=7) f) Abnormal sonography (n=6) Among all 210 fetuses, 105 cases were male (XY), 104 were female (XX), and 1 case found to be a mosaic for sex chromosome (XX/XY). In total 11 fetuses (over 5%) had abnormal karyotypes as such: A) 46,XX,t(12;15) ; B) 47,XX,+18; C) 46,XX,t(4;5); D) 47,XXX; E) 45,X F) 47,XY, +21 (n=3); G) 47, XXY; H) 46, XY, inv10q I) mos 46, XX[25]/46,XY[7] Three of the above abnormal cases (B, in one case of F, and H) were referred because of the advanced maternal age, three (C, and F) because of the previous MR child (in case C) and previous Down child (in two cases of F), three because of abnormal sonography (A, D, and E), one with abnormal triple test (G), and one because of parental anxiety (I). Our study shows that although the use of the triple test as a screening tool could reduce the number of amniocenteses, only one out of seven of the cases with abnormal triple test result had abnormal karyotype. Sonographic marker could detect six abnormal fetuses among them three had abnormal karyotypes. However, eight fetuses with chromosomal abnormalities detected in our laboratory would be missed if only ultrasound had been used. Nevertheless, ultrasound plays an important role in prenatal diagnosis. Therefore, in cases of positive ultrasound findings, karyotyping is reasonable. Although, in the majority of cases referred because of maternal age, the fetuses had normal karyotypes, the percentage of chromosomal abnormality was about 6% which justifies the test. There was no significant difference between genders of the fetuses with either normal or abnormal chromosome composition.
12.24-P
Mahjoubi, S. Karymee, M. Khaleghian, T. Tavakol, S. Tootain and M. T. Akbari
Partial trisomy 2q and partial monosomy 10p in a fetus
NIGEB, Akbari Medical Genetics Laboratory, Tehran, Iran
Karymee, Frouzandeh Mahjoubi, M. Khalegian1, S. Tootian1 and M. T. Akbari
In this study we aimed to compare the maternal age, sex ratio, triple test results, sonographic finding, and associated major anomalies among 210 fetuses chromosomally studied in our laboratory. The reason for referral included: a) History of miscarriage/ stillbirth (n=90) b) Advanced maternal age (n=49) c) Previous child(ren) with clinical abnormality
Medical Genetic Laboratory of Akbari, Taleganee St, Tehran, Iran, Clinical Genetic Dept., National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran and 1Medical Genetic Laboratory of Akbari, Taleganee St, Tehran, Iran, Medical Genetic Laboratory of Akbari, Taleganee St, Tehran, Iran and Clinical genetic Dept. Tarbiat
6th ECC: Abstracts
254 Modaress University, Tehran, Iran We report a new case with partial trisomy 2q and monosomy 10p due to maternal translocation [t(2;10)] detected during prenatal diagnosis. A pregnant woman with recurrent miscarriages and a child with multiple abnormalities was referred to our clinic for prenatal diagnosis. Chromosomal analysis of CVS was performed according to standard cytogenetic methods using G-banding technique. The fetus found to have a derivative chromosome 10. The derivative 10 contained the partial long arm of chromosome 2 and lacked the short arm of chromosome 10. Both chromosomes 2 showed normal. Chromosomal study of both parents revealed that the mother was the carrier of a balanced translocation. Therefore, the karyotype of the fetus was ascertained as: [46,XX, der(10)t(2:10)(q32.2;p14)mat]. The fetus was spontaneously aborted in 15 weeks of gestation.
12.25-P
The possible failure rate in diagnosing major chromosomal abnormalities with an Attempt to complete shift to QF-PCR in prenatal diagnosis I. Kalelioglu, B. Karaman, S. Basaran, A. Yuksel, R. Has, L. Ibrahimoglu, A. Yıldırım, N. Kırmızı and H. Ermis University of Istanbul Aim: To determine the possible failure rate in diagnosing major chromosomal abnormalities with an attempt to complete shift to QF-PCR in prenatal diagnosis. Material and methods: The abnormal results of the amniocentesis since January 2003 were described as Bdetectable by QF-PCR^, Bnon-detectable by QFPCR^ or B variably detectable by QF-PCR^. These result also categorized as Baffects phenotype^, Bdoes not affect phenotype^ and Bunknown whether to affect phenotype^. Posible failure rates of QF-PCR in detecting major chromosomal abnormalities and chromosomal abnormalities which could affect the phenotype were calculated.
Results: Of the 2122 cytogenetic results, 75 (3.5%) major chromosomal abnormalities detected during study period. Of these, 22 (29.3%) were Bnondetectable by QF-PCR^, 50 (66.6%) were Bdetectable by QF-PCR^ and 3(4%) was described as Bvariably detectable by QF-PCR^. On the basis of expected 65% average detection rate in last group, consisting of three mosaics, 23 of 75(30.6%) major chromosomal abnormalities would be failed to be diagnosed with an attempt to complete shift to QF-PCR in prenatal diagnosis. Excluding two sex chromosome abnormalities, one denovo balanced translocation and chromosomal abnormalities that do not affect phenotype, 60 major chromosomal abnormality results were categorized as Baffects phenotype^. Of these, 9 (15%) were Bnon-detectable by QF-PCR^, 48 (80%) were Bdetectable by QF-PCR^ and 3(5%) was described as Bvariably detectable by QF-PCR^. On the basis of expected 65% average detection rate in last group, 10 of 60 (16.6%) chromosomal abnormalities that could affect the phenotype would be failed to be diagnosed with an attempt to complete shift to QF-PCR in prenatal diagnosis. Conclusion: 30.6% of major chromosomal abnormalities and 16.6% of chromosomal abnormalities that affect the phenotype were expected to be failed to be diagnosed in full prenatal diagnosis with QFPCR.
12.26-P
The proportion of various types of chromosome anomalies detected in amniotic fluid samples; The results of a series with 17655 cases Basaran, Gu¨ven Toksoy, Birsen Karaman, Melike Aytan, Ayse Engu¨r, H. Ibrahim Kalelioglu, Recep Has, Hayri Ermis, Kilic Aydinli and Atil Yu¨ksel ˙Istanbul University, Istanbul Medical Faculty, PREMED Genetic Diagnosis Center, Tesvikiye, Istanbul, Turkey, Istanbul University, Istanbul Medical Faculty, Department of Obstetrics and Gynecology, Capa, Istanbul, Turkey In the last 2 decades, important changes have been occurred in the prenatal diagnosis of chromosomal
6th ECC: Abstracts anomalies like as improvement of high resolution banding technique, screening tests using biochemical and ultrasonographic markers, fluorescence in situ hybridisation (FISH), comparative genomic hybridisation, micro array techniques. It is expected that using these new techniques may change the already known proportions of the type of chromosome anomalies in post- and prenatal karyotyping. On the other side, interphase FISH and quantitative fluorescent PCR (QF-PCR), are designed for the targeted detection of common trisomies. These technologies are reliable and faster than fetal karyotyping. These techniques could be offered in the genetic counselling prior to invasive procedure. Therefore it is gaining more importance to determine the incidence and proportions of different categories of chromosomal anomalies in the new era. We evaluated retrospectively the cytogenetic results of a series with 17655 amniotic fluid samples analyzed in two laboratories. The chromosome anomalies detected in the whole series were categorized in two periods from 1989 to1997 and from1998 to 2006 according to the type of anomaly. In this series, 635 (3.60 %) major chromosomal anomalies were detected. Among of them 392 were most common aneuploidies and triploidy, which could be detected by rapid tests (61.73 %). This rate was in the first period 59.40 % and in the second period 62.35 %. Of the 635 major anomalies, 91 (14.33 %) were sex chromosome aneuploidy, 289 (45.51 %) were trisomies for chromosome 21, 18 and 13, 15 (2.36 %) were aneuploidies for other autosomes, 12 (1.89 %) were triploidy, 161 (25.35 %) were balanced structural, 46 (7.24 %) were unbalanced structural anomalies and 21 (3.31 %) were marker chromosomes. In this study, the influence of the new techniques and indications on the proportions of the categories of chromosomal anomalies in fetal karyotyping will be discussed.
12.27-P
Fetal craniosynostosis and exophthalmus with normal karyotype Artigas-Lo´pez, A. Pe´rez-Juana, A. Valiente Martin, A. Alonso Sanchez, S. Moreno Laguna and M. A. Ramos-Arroyo
255 Hospital Virgen del Camino A 35 year-old healthy woman with an uneventful pregnancy went for her routine morphologic ultrasound examination at her 20th week of gestation. The study revealed anomalies of the face: shallow orbits, abnormal skull shape, as well as malfoposition of hands and feet. An amniocentesis was carried out and the chromosomes were normal, 46,XX. Parents decided to interrupt the pregnancy. After therapeutic abortion a phenotypic and radiological evaluations of the foetus were performed. The head showed partial craniosynostosis of coronal sutures, flat occiput, pseudoexophtalmus, maxillary hypoplasia, macroglossia, low set ears and high arched palate. Skeletal findings were remarkable for broad and medially deviated thumbs, clinodactyly and radio-humeral synostosis. This feature is uncommon but quite typical in craniosynostosis syndromes like Apert, Antley-Bixler and Pfeiffer syndromes. A DNA analysis of the fibroblast growth factor receptor 2 gene (FGFR2) identified a de novo mutation (Y340C) located in Exon 10 (IIIc) of the gene causing a nucleotide change (1019A9G). This mutation is commonly associated with the most severe Pfeiffer phenotype with a poor prognosis.
12.28-P
Prenatal diagnosis of de novo translocation Down syndrome and the determination of parental origin using QF-PCR Park, B. Y. Lee, M. H. Lee, J. Y. Park, M. Y. Kim and H. M. Ryu Laboratory of Medical Genetics, Medical Research Institute, Cheil General Hospital & Women_s Healthcare Center, Seoul, Korea, L, Department of Obstetrics and Gynecology, Cheil General Hospital & Women_s Healthcare Center, Seoul, Korea We report two cases of Down syndrome with unusual structural rearrangement of chromosome 21. In case 1, a 21q21q translocation chromosome comprising two chromosome 21 long arm is seen. In case 2, we showed an unbalanced translocation with a derivative chromosome 19 resulting from a duplication of the
6th ECC: Abstracts
256 long arm segment 21q and a translocation between the short arm of chromosome 19 and the long arm of the chromosome 21 with a breakpoint in 19p terminal region, der(19)dup(21q)t(19p;21q). Telomeric translocations are rare abnormality. we identified the telomeric sequences were retained at the translocation breakpoint on the derivative chromosome using fluorescence in situ hybridization. The parent_s karyotypes were normal in both cases. Molecular study of the parental origin of the rearranged chromosome 21 was carried out by quantitative fluorescent polymerase chain reaction(QF-PCR) using small tandem repeat(STR) markers.
breakpoints were localized at the molecular level,. Clearly, no genotype-phenotype correlation exists in this case when considered in the context of the size of the deletion. In addition to cytogenetic analysis by G Banding and FISH using probes WCP 18 and Telvysion 18q (Vysis), QF-PCR was performed(at General Lab, Barcelona, Spain) to determine the breakpoints at the molecular level. The following STRs markers of chromosome 18 were done: D18S535 18q21.1, D18S386 (absent in the fetus), D18S391 18p11.32-p11.31, D18S499 18q21.33 normal in the fetus. Our case shows that the 18q deletion syndrome may, therefore, reflect a much broader phenotypic spectrum than previously recognized.
12.29-P
12.30-P
Familial chromosome 18q22 deletion, found at prenatal diagnosis
Automated detection of rare male fetal cells in peripheral blood of pregnant women using molecular cytogenetic techniques
Trujillo, Carlos, El Badawi Baher and Abeer Abdallah Hassanat1 Erfan & Bagedo Hospital. Instituto de Ciencias de la Salud, Medellin, Colombia The 18q deletion syndrome has been proposed as a contiguous gene syndrome with the spectrum of defects depending upon the overall size It can be interpreted as having its basis in haploinsufficiency of multiple genes. The phenotype is highly variable, but is characterized by mental retardation, short stature, hypotonia, hearing impairment, and foot deformities. 18q22deletion syndrome is characterized by, growth retardation, microcephaly, palpebral ptosis, and micrognathia. The syndrome is often accompanied by selective IgA deficiency and associated autoimmune disease. We present a familial case, first detected at 15 weeks of pregnancy, present in the father as a balanced translocation 13p;18q and in a 3 year old son with the deletion 18p22. By the time we have finished the karyotype in the father and the son, the mother had already done an abortion of her pregnancy. The 3 year old boy, that was described as happy normal boy, has a primary hypothyroidism on treatment. On clinical examination he presents frontal bossing, and carp mouth shaped. There are not abnormalities in the upper and lower limbs. His weight and growth are in the 25th percentile. In the current study, using QF-PCR the
Gadji, O. Samassekou, F. Hemmings, S. Ayub, E. Bouchard, M. W. Kilpatrick, T. Tafas, P. Tsipouras, K. Krabchi and R. Drouin Universite de Sherbrooke, Ikonisys Inc., New Haven, CT Background: Molecular cytogenetic techniques have provided definitive evidence of the presence of fetal nucleated cells in the peripheral blood during pregnancy. We have shown that it is possible to reliably and reproducibly identify fetal cells in maternal blood of all pregnant women and to quantify all fetal nucleated cells. This number fluctuated between 2 to 6 cells per mL of maternal blood between 18th and 22nd weeks of gestation in euploid pregnancies and 4 to 32 fetal cells in aneuploid pregnancies. Objective: The aim of our study is to compare manual and an automated slide scanning system and fluorescent spot counting from Ikonisys Inc. Methods: We used a simple and rapid harvesting method without any enrichment procedures, followed by either Fluorescent in situ hybridization (FISH) or Primed IN Situ (PRINS) labeling technique. Detection of fetal cells was carried out using chromosome-
6th ECC: Abstracts centromeric coupled to fluorochromes for FISH or specific primers for chromosomes X and Y for PRINS reaction. PRINS or FISH techniques were performed on blood specimens provided by healthy pregnant women carrying a male fetus. On the average 25 slides were prepared from 1 mL of maternal blood. We used a system to scan automatically for cells that bear X and Y fluorescence in situ hybridization signals. Each slide was thoroughly evaluated using standard manual microscopy and the automated image acquisition and display capabilities of the Ikoniscope fastFISH amnio Test System. Results: All cells found using standard manual microscopy were also found by the automated system. But, more fetal cells were found using the automated system. The total number of fetal cells identified using the Ikoniscope Platform V1.0 was at least twice the number found using standard manual scanning. Conclusion: Our data suggest that the automated system is capable of providing accurate and rapid identification and display of all male cells and FISH Y PRINS signals.
257 any obvious structural abnormality. FISH analysis with a chromosome 21 painting probe and a locus specific probe for the critical Down syndrome region detected an additional signal on the long arm of chromosome 7. The unbalanced karyotype was confirmed by hybridization with a chromosome 7 specific subtelomeric probe [(46,XY,der(7)t(7;21) (q34;q21)pat]. Parental karyotypes showed a paternal balanced translocation 46,XY,t(7;21)(q34;q21). The mother opted for termination of the pregnancy because of the poor prognosis of the fetus. In genetic counselling, information was obtained that an uncle of the father clinically shows Down syndrome which had hitherto not been confirmed by cytogenetic investigation. Cytogenetic and molecular cytogenetic analysis in this patient revealed a numerical and structural aberrant karyotype with the balanced reciprocal translocation and an additional chromosome 21. This chromosomal aberration can be either the result of an interchange trisomy or an independent nondisjunction event. This case illustrates that a Bconventional^ prenatal diagnosis regimen (i.e. Bexcluding^ Down syndrome due to malsegregation of a familiar translocation) could have lead to a false diagnosis.
12.31-P
Interphase FISH to detect fetal aneuploidy due to cryptic unbalanced chromosome rearrangement undetected by karyotyping B. Pabst, M. Wu¨stemann, P. Javaher-Haghighi, J. Schmidtke and K. Miller Hannover Medical School We report on a prenatal diagnosis of an unbalanced translocation involving chromosomes 7 and 21 in a fetus with an abnormal facial profile, retrognatia, hypoplastic nose, cleft lip and palate, ventriculomegaly, hypoplastic left heart, pyelektasis and shortened humeri. Amniocentesis was performed at the 18th week of gestation because of increased nuchal translucency and fetal malformations. Interphase FISH on uncultured amniocytes with probes for chromosome 13, 18, 21, X and Y revealed three signals for chromosome 21. The chromosome analysis resulted in a normal numeric karyotype without
12.32-P
Prenatal diagnosis in turkish pregnant on chromosomes 21, 18, 13, and xy with quantitative fluorescent pcr methods B. Dolek, B. Kesim, A. Dag˘demir, G. Yolay, S. Erog˘lu, G. Karatas¸, Z. Candemir and Z. Laleli Duzen Laboratories Group, Department of Molecular Genetics, 2Duzen Laboratories Group, Department of Cytogenetics BQuantitative Fluoresent-Polymerase Chain Reaction (QF-PCR)^ method gives rapid prenatal diagnosis for chromosomal aneuploidies. Common chromosomal aneuploidies, 21, 18, 13, and XY, in 1000 Turkish prenatal cases at risk were evaluated. Multiplex PCR assays based on amplification of STR sequences which are tetra nucleotides by using flourescent primers, and visualization and quantification of STR
6th ECC: Abstracts
258 peaks by using automated DNA sequencer with a software were carried out. All findings obtained from QF-PCR method were confirmed with traditional karyotyping analysis. As a result, detemining of common trisomy abnormalities with QF-PCR methods has a great impact for rapid, accuracy, and simple prenatal diagnosis.
13.1-O
The formation of isochromosome 12p in 8 cases with Pallister-Killian syndrome O. Uyguner, A. Ghanbari, A. Uzumcu, B. Karaman, H. Kayserili, B. Wollnik, M. Yuksel-Apak and S. Basaran Istanbul Medical Faculty, Istanbul University, Current address, Center for Molecular Medicine Cologne (CMMC), Institute for Human Genetics, Cologne, Germany Pallister-Killian syndrome (PKS) is a clinically welldefined dysmorphic syndrome characterized by a tissue-limited mosaicism for an additional isochromosome 12p [46/47,+i(12p)]. Although improving, our current knowledge on mechanism(s) leading to formation of isochromosomes is still limited. Therefore, increasing numbers of such cases are required to be studied. Here we report the results of molecular genetic studies in 8 PKS cases to identify the parental origins and formations of isochromosomes. In all cases, clinical diagnosis of PKS was confirmed in cultured fibroblast cells by using GTG banding analysis and fluorescence in-situ hybridization technique. Molecular genetic analysis was performed using 15 STR markers located on the short arm of chromosome 12. The parental origins were determined in 6 out of 8 cases, 5 maternal and one paternal. The other 2 cases were not detectable due to either low rate of mosaicism (G30%) or nonquantitative property of polymerase chain reaction. Three possible mechanisms, described per two cases, leading to formation of additional isochromosomes based on molecular genetic data were suggested; Mechanism 1: nondisjunction in meiosis I and a centromeric misdivision either prior to/concurrent with meiosis I or during meiosis II, Mechanism 2:
premeiotic nondisjunction followed by centromeric misdivision in either meiosis or a postzygotic centromere misdivision following nondisjunction in meiosis II, Mechanism 3: postzygotic nondisjunction and centromere misdivision. Our study of tetrasomy 12p cases implicated that the possibilities of isochromosome formations could not be simplified under a single mechanism.
13.1-P
Studies on the association between VDR gene polymorphisms and susceptibility to tuberculosis in the Romanian population V. Stoian, N. Constantin, A. Simon-Gruita, F. Stanciu, G. Duta-Cornescu, D. Banica, R. Tuduce and P. Cristea University of Bucharest, Faculty of Biology, Institute of Pneumophtiziology M. Nasta, Bucharest, University Politehnica of Bucharest Epidemiologic and laboratory studies suggest a correlation between vitamin D metabolism and immunity to TB; single nucleotide polymorphism (SNP) on vitamin D receptor (VDR) gene seems to influence in certain ethnic groups the host response to Mycobacterium tuberculosis. VDR gene located on chromosome 12 (12q12-14) has 15 exons span on approximately 75 kb. The goal of our study is to find out whether VDR gene variants are associated in the Romanian population with the susceptibility to TB. The case-control study carried out on TB patients and healthy control group tries to identify two VDR gene polymorphisms, defined by the restriction endonucleases ApaI and TaqI. For VDR genotyping, PCR-RFLP and ARMS-PCR methods were used. With the first method a 740 bp amplified DNA fragment is subjected to the restriction enzyme digestion. The second method uses sequence specific primers to amplify the four haplotypes generated by ApaI and TaqI polymorphisms. Thus, wild and mutant alleles (A, T and a, t respectively) and the corresponding genotypes (AA, Aa, aa and TT, Tt, tt) were identified. The results were statistically analyzed to determine the possible association between these polymorphisms and sensibility/resistance to TB
6th ECC: Abstracts in the Romanian population. Preliminary data show that the wild allele A frequency in TB patients (0,64) is greater than in control group (0,56), but allele T frequency is approximately equal in both groups (0,61 in patients and 0,60 in control). The genotype frequencies revealed the heterozygote predominance for ApaI polymorphism with a higher value registered in TB patients (0,64 and 0,52 respectively). For the TaqI polymorphisms the TT genotypes were better represented in TB patients (0,77) than in the control (0,43) but exceeded the frequencies of the other genotypes. For further development of the study a comparison regarding the correlation between these polymorphisms and TB susceptibility in different geographic zones of Romania will be done.
259 nant melanoma, these results correlated with an increase in the number of mitosis, especially anaphase figures, as detected by cytogenetic analysis. Interestingly, the chromosomes exhibited marked segregation defects at the arms level, but not at the centromeres. Our data suggests that the abnormalities observed in B16F0 and B16F10 cells may be due to defects of the molecular mechanisms in which an active proteasome complex is required, such us the timely degradation of cyclins and securin mediated by the anaphase promoting complex. Project granted from RETICS G 3/179 and Gobierno Vasco SAIOTEK
13.3-P 13.2-P
Defective chromosome segregation: Cell type specificity of the proteasome inhibitor MG132 ´ lvarez, E. Martin, M. Martin, L. Parada M. A and A. Garcia-Orad Carle´s Dept. of Genetics, Faculty of Medicine, University of the Basque Country, Cell Biology and Stem Cells Unit, CIC BioGUNE, Bilbao, Spain The proteasome is a macromolecular complex that removes denatured, damaged or improperly translated proteins from cells and regulates the level of proteins such as cyclins, securin, aurora kinases and transcription factors. Attachment of ubiquitin to these proteins is required for proteolytic degradation by the proteasome. MG132, MG115, Lactacystin, Epoxomicin and Bortezomib\ are potent inhibitors of the proteasome complex. To explore the cytogenetic effect of proteasome inhibitors, we investigated the effect of MG132 and Bortezomib\ on chromosome structure and dynamic of mouse and human cell lines. G7, B16F0, B16F10, HeLa cells were treated during the exponential growing phase with 10j5 M and 10j6 M of MG132 and 10j9 M of Bortezomib\ for 6 and 24 hours and then processed for chromosome and flow cytometry cell cycle analyses. We found that MG132, but not Bortezomib, induces cell arrest in G2-M in all cell lines studied. In B16F0 and B16F10 cells, derived from a malig-
Cytogenetic findings in Joubert syndrome Yosunkaya Fenerci, E. Karaca, D. Kuru, A. Cirakoglu, M. Seven, A. Deviren, S. Hacihanefioglu, A. Yuksel Istanbul University Cerrahpasa Medical School Joubert syndrome is a rare, genetic disorder that is characterized by absence or underdevelopment of cerebellar vermis and a malformed brain stem. The most common features include ataxia, an abnormal breathing pattern called hyperpnea, sleep apnea, abnormal eye and tongue movements, and hypotonia. Other malformations such as extra fingers and toes, cleft lip or palate, tongue abnormalities, and seizures may also occur. There may be mild or moderate retardation. We report 13 cases of Joubert syndrome. One of them has 46,XX,t(X;2)(p11.1;q37) karyotype whose mother showes the same genotype too and another has 46,XX,t(2;12)(q23;q21) karyotype. We also discussed clinical features of cases comparing with each other and literature.
13.4-P
Study of the frequency of BP2-BP3 inversion (Class II) in parents of Angelman and Prader Willi syndrome patients
6th ECC: Abstracts
260
Villatoro, L. Armengol, L. Comadran, E. Gabau, X. Estivill, M. D. Coll and M. Guitart
Mikelsaar, Alar Su¨nter and Peeter Toomik
Corporacio´ Sanita`ria Parc Taulı´, Genetics Laboratory, Center for Genomic Regulation, Program Genes and Disease, Corporacio´ Sanita`ria Parc Taulı´, Paediatric service, Universitat Auto`noma de Barcelona, Departament de Biologia Cellular. Fisiologia, Immunologia
Recently, the large filamentous striated-muscle protein titin has been observed in non-muscle cells, and has been proposed to have a nuclear function as a chromosomal component contributing to structure and elasticity. In this study, we further analyze this phenomenon. Different human cell-lines of neural origin were used to characterize the localization of titin. Immunofluorescence microscopy with different commercial titin-specific monoclonal antibodies: 9D10 (DSHB), 9B9 (Chemicon), 2Q1063 (USBiologicals), and T11(Abcam) shows different localization and expression characteristics of titin in the nucleus and cytoplasm of cells examined. In accordance with this are also data obtained by immunoblotting. Monoclonal antibody 9D10 did not show any nuclear localization, but was highly reactive with cytoplasm. Antibody T11 has a clear fine punctate reaction with nucleus, and very weak reaction with cytoplasm. Antibodies 9B9 and 2Q1063 have very peculiar granular ( with granules of varied size) reaction with nuclei, and usually no or very weak reaction with cytoplasm; localization to condensed chromosomes is not observed with any of antibodies and methods used. These results are somewhat different from data of other authors obtained on cells of other origin. As there are some data on the possible cross-reaction of anti-titin antibodies with other nuclear proteins (f.e. AHNAK), the expression of titin in non-muscle cells needs further investigation; though, it is possible that this cross-reactivity is restricted only to some of anti-titin antibodies, not to others. We are using 2D-electrophoresis and ESI-MS to prove the expression of titin in nuclei and cytoplasm of neural cells studied. The function of titin as a human chromosomal protein needs further investigation.
The aetiology of many genomic disorders has been found to be influenced by the genomic architecture of the regions involved in the rearrangements. Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are clinically distinct genomic disorders mapped to chromosome bands 15q11-q13. In the case of AS, it has been postulated that the existence of genomic inversions could promote an abnormal recombination between segmental duplications flanking the 15q11-q13 genomic region which results in the interstitial deletion of this region in the offspring (Gimelli et al. 2003). In this study we report the analysis of BP2-BP3 chromosome inversion in 7 mothers of AS and 7 fathers of PWS patients with class II deletion, and in 23 controls from the general population. The type of deletion was identified using ten microsatellites from the region 15q11-q13 (i.e. D15S18, D15S542, D15S1035, D15S912, D15S11, D15S128, D15S113, D15S97,GABRB3 and D15S1233). Molecular cytogenetic characterization of the inversion was carried out by fluorescent in-situ hybridisation (FISH), using BACs probes RP11322N14 (located close to breakpoint 3 Y BP3) and RP11-494F2 (located near breakpoint 2 Y BP2). We examined the fluorescent signals in 50 informative lymphocyte metaphases in each individual of the study to evaluate the presence of inversion An average of 88% (range 74Y96 %) of all evaluated metaphases had the two probes in the expected order. We conclude that our results support that BP2-BP3 polymorphism inversion is not present in the Spanish population, which makes it unlikely that the inversion could be a major susceptibility factor in the generation of the 15q11-q13 Class II deletion in the offspring.
University of Tartu
13.6-P
Chromosomal aberrations in blood lymphocetes of petrochemical workers Berdina
13.5-P
Institute of Biochemistry and Genetic
Is titin a human nuclear and chromosomal protein?
A cytogenetic examination carried out in the inhabitants of Ufa (Bashkortostan Republic) and workers
6th ECC: Abstracts of the petrochemical industrial complex of Ufa, living in the same town, revealed high level of spontaneous chromosomal variability in industrial group. The frequencies of cell with chromosomal aberrations (estimated per 100 cells) in control group and industrial groups were 2.67% and 5.6% respectively, and the total number of aberrations constituted 3.2% and 7.0%, respectively. These frequencies were several times higher compared to the summarized literature data on the control levels. The high average aberration level was caused by the elevated proportion of chromatid-type aberrations and paired fragments. The reasons for this are unclear.
261 paternally inherited partial duplication of 9p13.199p21.1, it was found that the causative event leading to rearrangement most likely occurred during postzygotic cell divisions. The paternal inheritance could be shown in case of partial deletion of 9q. The molecular genetic studies made it possible to delineate the breakpoints more precisely in both partial trisomy 9p and interstitial deletion 9q. Our results implied the utility of molecular genetic techniques in order to identify the parental origins of and to delineate the structural chromosomal abnormalities. To answer the questions when and how the structural chromosome abnormalities occur, an increase in the number of cases and further future analyses would be required.
13.7-P
Identification of parental origins and delineation of structural abnormalities involving chromosome 9 A. Uzumcu, A. Ghanbari, B. Karaman, Z. O. Uyguner, H. Kayserili, B. Wollnik, M. Yuksel-Apak and S. Basaran Istanbul University, Istanbul Medical Faculty, Current Address We studied 5 cases with de novo structural chromosome abnormalities involving chromosome 9; one each case with additional isochromosome 9p, full trisomy 9p, trisomy for 9p13.1-99p21.1, deletion of 9p22-9pter and deletion of 9q with unclear breakpoints by using molecular techniques to determine the parental origin of the anomalies and further to delineate the breakpoints of the chromosomal rearrangements. Molecular genetic analyses were performed using 15 STR markers located on chromosome 9p and 6 STR markers on 9q. Parental origins of chromosomal abnormalities in three cases were identified while two cases with full trisomy and with partial deletion of 9p revealed no information about the parents in whom the rearrangements were raised. The chromosomal anomalies in two cases were of paternal origin whereas only case showed maternal inheritance. Based on the molecular genetic findings; the isochromosome 9p was maternal in origin and the formational mechanism was considered to be due to non-disjunction in meiosis II followed by post-zygotic centromere misdivision. In case of
14.8-P
Array-CGH screening in 100 patients with mental retardation M. Fenzy-Doco, E. Landais, A. Schneider, N. Bednarek, P. Sabouraud, J. Motte, J. Couchot, E. Lagonotte, C. Leroy and D. Gaillard Service de Ge´ne´tique, CHU Reims, IFR 53, France, Service de Pe´diatrie, CHU Reims, France, Service de Pe´diatrie, CHG, Charleville, France Mental retardation (MR) is a major problem affecting 3% of the population. Chromosome imbalances larger than 5 Megabases are detected by 550 band resolution R or G band karyotype. The Array-CGH is able to detect interstitial smaller deletions or duplications. We report on the results obtained by molecular karyotyping with 1 Mb BAC and PAC array-CGH screening in a population of 100 patients affected by MR with or without multiple congenital anomalies (MCA). For 25 patients of this study, an abnormal karyotype had been previously identified. We used the 1 Mb BAC and PAC Array (VIB Leuven). Six patients were analysed by an experiment using a triangle testing. The data were analysed with the arrayCGHbase software provided by J. Vermeesch. Results: Copy number variants (CNV) were found in 45% of patients : 24 known and 7 not yet described. Array-CGH confirmed and mapped the unbalanced karyotype rearrangements in all 25
6th ECC: Abstracts
262 patients with known cytogenetic abnormality. For two of these patients, additional deletions and duplications improved the cytogenetic analysis and therefore modified the genetic counselling. Among the 75 remaining MCA/MR patients : Two had large deletions and one had a large duplication involving homogeneously R-stained regions of 1p (3.2 Mb), 10q (2.2 Mb) and 11q (1.5 Mb) loci. Nineteen patients had rearrangements involving a single BAC or PAC clone. For three cases, the mother became pregnant during the study and a prenatal diagnosis could be offered. These results will be reported and discussed together with the clinical data. Grant : AOL 2003-2005 Y PHRC 2005 CHU Reims
14.9-P
A 17q21.31 microduplication (including MAPT) and a 2q22.3q23.1 microdeletion (including ACVR2A) detected by routine array-CGH analysis using 244k Agilent oligoarrays in two patients with mental retard M. Kirchhoff, A. M. Bisgaard, M. Duno, F. J. Hansen, H. Rose and M. Schwartz Department of Clinical Genetics, Rigshospital, Department of Pediatric Neurology, Rigshospital Two cases with de novo chromosomal imbalances detected by routine screening using 244 k Agilent oligoarrays are presented. In case 1, a microduplication of 17q21.31 was found (approximately 0.5 Mb). The duplication is reciprocal to the recently described 17q21.31 microdeletion and includes the MAPT gene. The patient is a nine-year-old girl with severe psychomotor developmental delay. Her facial dysmorphism includes a low anterior and posterior hairline, a small nose with a flat root, a long philtrum, and small widely spaced teeth. In addition, she has microcephaly, abnormal fingers and toes, and hirsutism with very long hairs on her back. In case 2, a microdeletion of 2q22.3q23.1 was found (approximately 0.4 Mb). The deletion includes the ACVR2A gene, which has been associated with cranio-facial development in mice. The patient is a three-year-old girl. Her psychomotor development is approximately
12 months delayed. Her facial dysmorphism includes lateral extension of eyebrows, a low anterior hairline, long palpebral fissures, a high nasal bridge giving the impression of deep-set eyes, a bulbous nasal tip, a thin upper lip, and micrognathia/retrognathia. In addition, she is microcephalic, hypermobile and hypotonic. Beside the two patients an outline will be presented from seven months of routine CGHanalysis using 244k Agilent oligoarrays of patients with mental retardation and dysmorphic features.
14.10-P
Male-to-female sex reversal due to an õ250 Kb deletion upstream of NR0B1 (DAX1) M. Smyk, J. S. Berg, A. Pursley, F. Curtis, B. Fernandez, G. A. Bien-Willner, J. R. Lupski, S.W. Cheung and P. Stankiewicz Dept. of Medical Genetics, Institute of Mother and Child, Warsaw, Poland, Dept. Molecular & Human Genetics, Baylor College of Medicine, Houston, TX, Baylor Dept. Molecular & Human Genetics, College of Medicine, Houston, TX, Disciplines of Medicine and Genetics, Memorial University of Newfoundland, Dept. Molecular & Human Genetics, Baylor College of Medicine, Houston, TX; Dept. of Medical Genetics, Institute of Mother and Child, Warsaw, Poland Sex determination and differentiation is a complex cascade involving a number of dosage sensitive genes. Although mutations in many of these genes have been identified, the cause for sex reversal remains unknown in the majority of patients. NR0B1 (DAX1) is a dosage sensitive gene on chromosome Xp21.2 that plays a critical role in the development and function of the reproductive and adrenal systems. Deletion of NR0B1 results in congenital adrenal hypoplasia, whereas NR0B1 duplication in 46,XY individuals leads to gonadal dysgenesis and a female phenotype. We describe a 20 year old 46,XY female manifesting primary amenorrhea, a small immature uterus, and gonadal dysganesis, in whom the initial examination using array-CGH showed a loss in copy number detected by one BAC interrogating clone (RP11662D2) that harbors NR0B1. No signs of adrenal
6th ECC: Abstracts insufficiency were present in the patient. Surprisingly, FISH with this clone showed the presence of the fluorescence signal on Xp21. Using PCR, we found that NR0B1 was present in the patient; however, we identified a 257,782 bp deletion located 11,320 bp upstream (proximal) to NR0B1 and õ75 kb distal to GK1. The deletion truncated 53% of the BAC clone RP11-662D2, which explains the discrepancy between array-CGH and FISH results. No additional nucleotides were found at the junction. The deletion was also found in the patient_s mother. Using bioinformatics and comparative genomics, we identified within the deletion several potential cis-acting regulatory elements upstream of NR0B1 as well as 27 potential consensusbinding sites for SF1; the latter is thought to be a negative regulator of DAX1. Loss of regulatory sequences apparently resulted in a position effect upregulation of NR0B1 expression. We propose that this genomic region and by extension those surrounding the dosage sensitive SRY, SOX9, and SF1 genes, should be examined for copy number variation (CNV) in patients with sex reversal.
14.11-P
Application of HR-CGH and Chromosomal Microarray Analysis (CMA) in the Cohort of 112 patients with mental retardation B. Nowakowska, E. Bocian, P. Stankiewicz, M. Smyk, E. Obersztyn, Z. Ou, J. Li, K. Borg, S. W. Cheung and T. Mazurczak Dept. of Medical Genetics, Institute of Mother and Child, Warsaw, Poland, Dept. of Molecular & Human Genetics, Baylor College of Medicine, Houston TX, USA, Dept. of Medical Genetics, Institute of Mother and Child, Warsaw, Poland, Dept. of Molecular & Human Genetics, Baylor College of Medicine, Houston TX, USA Advances in molecular cytogenetics enable detection of small chromosomal aberrations in 5Y20% of patients with mental retardation (MR). The aim of this study was to compare two genome-wide screening techniques, high-resolution comparative genomic hybridization (HR-CGH) and targeted array CGH, termed also Chromosomal Microarray Analysis (CMA). In contrast
263 to conventional CGH, HR-CGH enables genome-wide screening for DNA copy-number changes with 3Y5 Mb resolution. Array CGH is a new powerful technology capable of identifying chromosomal imbalances with the resolution depending only on the size and distance between the arrayed interrogating probes. CMA version 5.0 (853 BAC/PAC clones) enables detection of DNA copy-number changes in more than 60 chromosomal regions of known diagnostic significance and in all subtelomeric regions in a single test. In this study, we analyzed 112 patients with unexplained MR and other features suggestive of chromosomal abnormality, with apparently normal or balanced karyotypes using HR-CGH (35 patients) and/or CMA (92 patients). HRCGH detected seven interstitial deletions in 35 (20%) patients. CMA revealed 34,8% (32/92) abnormalities, among which 11 (11,8%) were clinically relevant, 19 (20,5%) cases were interpreted as polymorphic variants and two (2,1%) were of uncertain significance. HRCGH and CMA findings varied in size from 0.5 Mb to 12.9 Mb and were all validated by FISH. In summary, our results show that HR-CGH and array CGH techniques have high detection rates of genomic imbalances in the tested groups. Both methods have become important components in cytogenetic diagnostics, particularly for detecting cryptic constitutional chromosome imbalances in patients with MR, in whom the underlying genetic defect is unknown.
14.12-P
MYB tandem duplication: a novel recurrent chromosomal aberration in T-cell acute lymphoblastic leukemia J. Tchinda, J. E. O_Neil, A. Gutierrez, T. A. Look and Charles Lee Brigham and Women_s Hospital, Dana-Farber Cancer Institute Analyses of recurrent chromosomal aberrations in leukemia have lead to identification of many clinically important oncogenes and tumor suppressor genes. Abnormalities of the chromosomal region 6q have been observed frequently in leukemias, mostly as deletion. In this study we investigated nature and frequency of a novel duplication 6q in childhood Tcell acute lymphoblastic leukemia (T-ALL). Twenty
6th ECC: Abstracts
264 T-ALL cell lines were screened for DNA copy number changes by oligonucleotide microarraybased CGH. A gain of a õ200Y300 kb fragment of the chromosomal region 6q23.3 was detected in eight cell lines, involving the genes MYB and AHI1. Fluorescence in situ hybridization on DNA fibers (Fiber-FISH) with fosmid clones characterized the gain as tandem duplication. This was confirmed using nested long-range PCR followed by sequencing. The frequency of the duplication in patients presenting with T-ALL was determined by Multiplex ligation probe amplification (MLPA) with selfdesigned probes. 2/8 (25%) patients showed a duplication. In order to exclude a constitutional event, 14 additional diagnosis samples with matching remission samples were analyzed by MLPA. Duplication of the MYB and AHI1 probes was detected in three diagnosis samples (21%) and in none of the remission samples. The presence of the MYB duplication seems not to correlate with a specific disease course. Since the number of patients samples analyzed in this study is small, this can only be considered as a trend. A recurrent t(6;7)(q23;q32) involving MYB or AHI1 has been reported before in childhood T-ALL. We hereby report a novel recurrent abnormality with high frequency in T-ALL. MYB is a transcriptional activator that plays an important role in the control of proliferation and differentiation of hematopoietic progenitor cells. Despite intensive investigations, the target genes of MYB that are specifically involved in development of neoplasms are still unknown. Subsequently, the mechanism through which MYB duplication contribute to leukomogenesis is not clear.
14.13-P
ArrayCGH and molecular cytogenetics in determination of prognostic subgroups of diffuse large B-cell lymphoma (DLBCL)
Diffuse large B-cell lymphoma (DLBCL) is the most frequent lymphoma in adults, accounting for 30%Y40% of lymphoid neoplasms. Genetically, DLBCL are characterized by clonal chromosomal aberrations such as distinct chromosomal translocations, gene amplifications, deletions and other mutations. Three major subgroups of DLBCL with prognostic significance were identified by gene expression profiling, termed germinal center B-cell-like DLBCL (GC-DLBCL), activated Bcell-like DLBCL (ABC-DLBCL), and primary mediastinal DLBCL (PMBL). The recent studies confirmed that these prognostic subgroups may be identified using molecular cytogenetic methods in at least some of DLBCL patients. The aim of this study was to use arrayCGH, and molecular cytogenetic methods for determination of the distinct subgroups of DLBCL and compare these results with clinical and histo-pathological findings. We analyzed a cohort of 22 cases with histo-pathological diagnosis of DLBCL. We used K3 BAC/PAC arrays with õ1 Mb resolution coverage of the genome (Leiden University Medical Center, Leiden, The Netherlands) and scanner GenePix 4200A (AXON) with an appropriate software. Out of 22 analyzed cases, 17 displayed DNA copy number changes determined by arrayCGH. Correlation between losses or gains of sites and prognostic subgroups, as well as, International Prognostic Index (IPI) were evaluated. FISH was used for determination of recurrent translocations and confirmation of some gene gains and losses. Using all methods i.e. cytogenetics, FISH and arrayCGH we confirmed the chromosomal changes in all 22 cases and identified all three prognostic subgroups. In summary, arrayCGH has lead to the identification of several genetic markers with prognostic significance in DLBCL, which in some cases are of a size amenable for identification of possible target genes. This work is supported by grant MSM 6198959205.
14.14-P
M. Jarosova, H. Pospisilova, T. Papajik, M. Holzerova, J. Balcarkova, R. Plachy, L. Kucerova, K. Szuhai and K. Indrak
A de novo partial duplication of the long arm of chromosome 17 in a newborn with prenatal suspicion of Ellis-van Creveld syndrome
University Hospital, University Hospital, Department of Pathology, Leiden University Medical Center, Leiden, The Netherlands
W. Courtens, D. Lederer, Y. Gillerot, C. Debauche, J. M. Biard, M. Ravoet, C. Sibille and M. Freund
6th ECC: Abstracts Cliniques Universitaires St-Luc Brussels- Center of Human Genetics, Cliniques Universitaires St-Luc Brussels- Dept. of Neonatology, Cliniques Universitaires St-Luc Brussels- Dept. of Obstetricss We report a female infant born at 37 weeks of gestation in whom a de novo pure partial duplication of the long arm of chromosome 17 has been diagnosed. Fetal ultrasounds performed at 29 weeks of gestation showed growth retardation, short limbs, polydactyly, cardiopathy, and hydrocephaly. The clinical diagnosis of Ellis-van Creveld syndrome was evoked. Amniocentesis was performed and revealed a partial duplication of chromosome 17, confirmed by FISH analyses. Parental karyotyping was normal, indicating a de novo anomaly in the child. Parents decided to continue the pregnancy. At birth, the baby had dysmorphic features, including small and low-set ears, micrognathia, midface hypoplasia, long philtrum, down-turned corners of the mouth with thin lips, low-set and wide-spaced nipples, short neck, pre- and postaxial hexadactyly of upper and lower limbs, single palmar crease, rhizomelia, wide anterior fontanel, hyperlaxity of knees, hirsutism, a VSD, and hydrocephaly. She was hypotonic, had feeding difficulties, and died after ten days of life from a necrotizing enterocolitis. Postnatal karyotyping confirmed the partial duplication of chromosome 17q. Microarray CGH analyses confirmed the duplication of chromosome 17q for the region localized between q21.31 and q23.2. A pure partial duplication of the long arm of chromosome 17 for this region has only rarely been reported so far. Clinical findings present in our case are compared to those of other reported cases with dup(17q).
14.15-P
A de novo 2q interstitial deletion in a patient with a turner phenotype Giglio, E. Andreucci, I. Ricca, S. Guarducci, U. Ricci, I. Sani, L. Nanni, S. Seminara, M. Genuardi and O. Zuffardi Medical Genetics, Department of Clinical Pathophysiology, University of Florence and AOU Meyer, Florence, General Biology and Medical Genetics, University of Pavia, Pavia, Department of Paediatrics, Auxology Unit, AOU Meyer, Florence
265 We report on a patient with a de novo interstitial deletion of the long arm of chromosome 2 involving the region 2q13-q14.2. She was the only daughter of unrelated parents and came to our observation for postnatal growth retardation, moderate mental retardation and minor dysmorphisms. At the age of 13+6/ 12 years, weight was Kg 37 (3-Y10- centile), height 133 cm (GG3- centile) and OFC 53,1 cm (50- centile). She presented with short stature, triangular face with bitemporal narrowing, webbed neck and a low posterior hairline, drooping eyelids, thin nose, highly arched palate, shield chest, mild cubitus valgus, multiple pigmented nevi, atrial septal defect, and mild hypothyroidism. Overall, the phenotype was evocative of Turner syndrome. Two independent postnatal karyotypes on peripheral blood and cytogenetic investigation of cutaneous fibroblasts were normal, thus excluding chromosomal mosaicism. Molecular analysis of the SHOX gene was normal. Array-CGH analysis allowed us to identify and characterize a 2q de novo interstitial deletion of about 8 Mb with proximal and distal breakpoints at 113,120 Mb and 122,079 Mb, respectively. The deleted region contains several genes, among which PAX8 and INHBB. PAX8 is involved in thyroid follicular cell development and expression of thyroid-specific genes, and loss of function mutations affecting it cause a form of hypothyroidism. INHBB codes for a bB subunit of activin dimers. Activins are TGF-b superfamily members, that act as regulators of growth and differentiation in several tissues and cell types. Inhibins/activins are involved in regulating a number of diverse functions, such as hypothalamic and pituitary hormone secretion, gonadal hormone secretion, insulin secretion, nerve cell survival, embryonic axial development and bone growth, depending on their subunit composition. Therefore, INHBB may be a good candidate to explain the growth retardation observed in this patient.
14.16-P
De novo monosomy 6q25.2-qter characterized by aCGH in a fetus with an increased nuchal translucency and TOF: implication for a new cardiac locus?
6th ECC: Abstracts
266
Kolomietz, David Chitayat, Julita Mazurkiewicz and Eleizabeth Winsor Mount Sinai Hospital Approximately 15 patients with distal deletion of the long arm of chromosome 6 have been reported. The cases described have all been de novo. Here, we report on the first case of a de novo terminal deletion of the long arm of chromosome 6 involving bands 6q25.2-qter detected by prenatal diagnosis. Amniocentesis was performed in the 16th week of gestation, because of fetal abnormalities detected by ultrasound examination, including increased nuchal translucency and Tetralogy of Fallot (TOF). Conventional cytogenetic and molecular cytogenetic techniques were applied to determine the fetal karyotype. Analyses of the parental chromosomes yielded normal results, indicating a de novo aberration. Array CGH analysis was performed to accurately determine the deletion breakpoints. We compare the phenotype of this fetus with those already reported in literature. In particular, heart defects are frequent findings in patients reported with similar deletions. Future in silico analysis of the deleted region will potentially lead to possible candidate genes residing in this region.
14.17-P
A complex chromosome rearrangements involving chromosomes 1, 10, and 14 in a man with infertility B. Bajelan, F. Mahjoubi, S. Karymee, M. Khaleghian, S. Tootain, T. Tavakol, Saltanatpour and M. T. Akbari Akbari Medical Genetics Laboratory, Tehran, Iran, Clinical Genetic Dept., National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran and Akbari Medical Genetics Laboratory, Tehran, Iran Congenital complex chromosomal rearrangement (CCR) compatible with life is rare in man. We describe a complex and unique apparently balanced translocation involving chromosomes 1, 10, and 14 with 3 breakpoints, in a patient who was referred to
our clinic because of infertility. Conventional karyotyping identified a complex rearrangement involving 3 breakpoints: 1q21.2, 10q21.1, 14q22. The relationship between this apparently balanced and complex rearrangements and possibly produced unbalanced gametes responsible for high reproductive failure is discussed.
14.18-P
Duplication 10 (q24-qter), A case report Mahjoubi, Samaneh Kareemy and Samiramees Totian NIGEB Distal duplication of 10q is a very rare chromosomal disorder in which the distal portion of the long arm of one chromosome 10 appears three times. The aberration is characterized by prenatal and postnatal growth retardation; hypotonia; severe mental retardation; and severe delay in the acquisition of skills requiring coordination of mental and muscular activities. Affected infants and children may also have distinctive malformations of the head and facial area; defects of the hands and/or feet; and/or skeletal, heart, kidney, and/or pulmonary abnormalities. The range and severity of symptoms and physical findings may vary from case to case, depending upon the exact length and location of the duplicated portion of chromosome 10q. We present clinical and cytogenetic data on a 2.5 months old boy with partial duplication of 10q (de novo in origin). The patient was referred to us with the clinical diagnosis of Down syndrome. The patient had multiple anomalies including a simian crease, low set ears, microcephaly, hypertelorism, cleft palate, coarse facies, microphthalmia, hypotonia, and growth retardation. The patient suffered from recurrent respiratory infections which caused his death at age 11 months. Chromosomal study was performed on his blood lymphocytes. In all cell examined an abnormal chromosome 10 (with additional material on 10q) was detected. Comparing clinical features of the patient with phenotype characteristic of a few reported cases of duplication of 10q, we believe that the case represent a duplication of 10q (24-ter). Fluorescence in situ
6th ECC: Abstracts hybridization studies confirmed the duplication of the above-mentioned segment of chromosome 10.
14.19-P
13q deletion in family with a cryptic translocation t(13;15)(q12;q13) detected by array-CGH Ramos-Arroyo, A. Bengoa-Alonso, A. Pe´rezJuana, S. Moreno Laguna, M. Artigas-Lo´pez and I. Nadal Hospital Virgen del Camino Cryptic chromosome rearrangements are found in 10Y20% of patients with mental retardation (MR) and normal conventional karyotype. The large number of low copy repeat sequences in the pericentromeric regions of acrocentric chromosomes makes them a hotspot for chromosomal rearrangements. We present clinical, array-CGH and FISH studies of a girl with moderate MR and major congenital anomalies due to an unbalanced cryptic t(13;15) translocation, inherited through her father. The proband, a 15 year-old girl at the time of genetic evaluation, had facial dysmorphic features, microcephaly, moderate MR, short stature, minor lower limb anomalies, vaginal atresia and chronic renal failure due to vesico-ureteral reflux detected prenatally. Partial agenesis of the corpus callosum and dilatation of the lateral and third ventricles were observed on CT scan. G-banded karyotype and screening for subtelomeric rearrangements by FISH were normal. ArrayCGH studies were undertaken and a 13q11-q12 deletion and a 15q11-q13 duplication were detected. FISH analysis with RP11-187L3 and RP11-26P6 clones (13q12.11), and D15Z1 (15p11.2), D15S10 (15q11-q13) and PML (5q22) commercial probes confirmed the results, demonstrating an unbalanced translocation involving chromosomes 13 and 15. Parental FISH studies and methylation-sensititive PCR analysis showed that the father was the carrier. Patient_s karyotype was then established as 46, XX, j13, +der(15)t(13;15)(q12;q13)pat. Conclusions: 1. This is the first report of a familial cryptic 13q deletion showing a severe phenotype of the partial 13q deletion syndrome. The implication of the paternally derived duplication of the proximal 15q
267 and/or a gene position effect on the patient_s phenotype can not be excluded. 2. Cryptic translocations involving different acrocentric chromosomes may be the cause of a substantial number of cases with MR and apparently normal karyotype.
14.20-P
Chromosome 13q14.2-q14.3 and 15q26.2-qter deletions detected by array-CGH in two patients with Cornelia de Lange syndrome Roversi, C. Gervasini, P. Castronovo, R. Pfundt, S. Russo, D. Milani, A. Selicorni, A. Musio, E. F. Schoenmakers and L. Larizza Division of Medical Genetics, San Paolo School of Medicine, University of Milan, Italy, Department of Human Genetics, Radboud University Nijmegen Medical Centre, The Netherlands, Laboratory of Molecular Genetics, Istituto Auxologico Italiano, Milan, Italy, Clinica Pediatrica, Universita` degli Studi di Milano, Fondazione Policlinico, Milan, Italy, Institute of Biomedical Technologies, Human Genome Department, Consiglio Nazionale delle Ricerche, Italy Cornelia de Lange syndrome (CdLS) is a rare, dominantly inherited, multisystem disorder characterized by peculiar facial dysmorphisms, upper limb abnormalities, growth and cognitive retardation. Mutations in NIPBL and SMC1L1 genes, encoding a regulatory and a subunit of the cohesin complex respectively, account for up to 55% of the CdLS patients. Further genetic heterogeneity, suggested by the high percentage of mutation negative patients, is attested by the recent involvement of a third gene (SMC3). In addition several chromosomal rearrangements have been reported in CdLS-like patients raising the issue of clinical heterogeneity of CdLS. Array based comparative genomic hybridisation (array-CGH) may be an helpful tool to 1) evaluate novel loci that might harbor additional CdLS genes and 2) define clinical entities overlapping with CdLS due to chromosomal abnormalities. Nineteen patients fitting the clinical CdLS diagnosis but negative to NIPBL and SMC1L1 mutations were tested by a full coverage array-CGH. Two carriers of copy number
6th ECC: Abstracts
268 losses at two distinct genomic regions were detected: in both cases deletions were de novo and affected the paternal chromosome. A female patient presenting with severe growth restriction, typical facial dysmorphisms, heart defects, gastroesophageal reflux and moderate MR, showed a 15q26.2-qter deletion, sized õ8 Mb. Among the deleted 28 genes, IGF1R, which haploinsufficiency has been associated with pre and post-natal growth retardation, is included. A male patient, displaying classical facial dysmorphisms, hirsutism, growth (G3%) and psychomotor delay, epilepsy, had an interstitial 13q14.2-q14.3 deletion, sized 1 Mb and encompassing 8 genes. Recently this region has been reported to include genes with a polymorphic not imprinted monoallelic expression from either the maternal or paternal copy. However in silico analysis of the mapped genes did not reveal potential candidates. Patients such as those here described represent a resource to disclose distinct genetic alterations in cases with phenotypic similarities.
populations with an average purity of 84%, and co-hybridised with normal reference DNA onto UCSF 1.4 Mb BAC arrays. Reference DNA was taken from the same individual for all array hybridisations, and we identified sites of normal copy number variations (CNVs) in this reference in a separate study by array hybridisation against 20 non-CLL samples. In addition, approximately 10% of CLL samples were also hybridised against DNA extracted from the same patients_ non-leukaemic neutrophils. Known recurrent copy number changes, such as deletions of 13q14, 11q22-23, 17p13, and trisomy 12, were detected in 27 (54%), 9 (18%), 8 (16%), and 7 (14%) samples, respectively. Novel sites of recurrent copy number changes that are not recognised as sites of normal CNV and have not been previously correlated with CLL have also been identified. These sites have high potential to assist future improved clinical stratification and better adjusted treatment regimes.
14.22-P 14.21-P
High-resolution genomic profiling of Chronic Lymphocytic Leukaemia by Array CGH S. Moon, J. McKenzie, U. Jewell, P. Ganly and C. Morris Christchurch School of Medicine and Health Sciences, University of Otago at Christchurch, New Zealand, Canterbury Health Laboratories, Christchurch Hospital, New Zealand Chronic lymphocytic leukaemia (CLL) is the most common form of leukaemia in adults in the western world. Research into the genetic basis of CLL has successfully improved survival rate, but further advances are hampered by resolution limits of conventional genetic screening techniques such as cytogenetics, FISH, and metaphase CGH. We have applied high-resolution microarray CGH to analyse DNA copy number imbalances in a cohort of 50 CLL patient samples and identified genetic imbalances that have not previously been recognised, but correlate with disease progression and treatment outcome. Sample DNA was extracted from CLL cell
Genome wide screening for tumour related rearrangements in mouse cancer model N. Conte, O. Dovey, R. Banerjee, G. Lefebvre, N. Carter and A. Bradley Wellcome Trust Sanger Institute Cancer in humans is typically a very heterogeneous disease and it is thus difficult to analyse genetically. One of the main thrusts of cancer research over the past 25 years has been to identify genes that are mutated in cancer. The Bradley laboratory is interested in performing one of the largest comprehensive analyses of the Bcancer genome^ in a cancer prone mouse model: irradiated bloom deficient mice. Loss of the DNA helicase Bloom function has been described in human Bloom syndrome and leads to a breakdown in the maintenance of genome integrity, in particular hyper-recombination and cancer predisposition. This gene has been knocked out in mice by the Bradley lab, and like in the human syndrome, bloom deficient mice are cancer prone in a wide variety of different cell types including carcinomas, sarcomas and lymphomas. The laboratory has
6th ECC: Abstracts developed an automated method to generate a genome wide molecular profile of a tumour in a single experiment using BAC-CGH arrays (comparative genomic hybridisation). In combination, we are using short term culture of cells extracted from tumours and look for translocations using M-FISH. Thus, this model provides an opportunity to identify genomic regions or genes that are frequently rearranged in cancer. Analysis of tumour DNA extracted from Bloom mouse cancer model will provide information of frequent deleted and amplified region. This study requires the analysis of hundreds of tumours and comparisons of rearrangements from tumours of the same types. Identification of sites of rearrangements will be useful in order to identify new genes involved in cancer. Once identified, these genes could be deleted in mice in order to evaluate their potential function in cancer. This will yield potential new diagnostic opportunities and perhaps might suggest new therapeutic approaches.
269 development of protocols capable of producing consistently high quality results, the introduction of new equipment, and the interpretation and reporting of the data. The automation of many of the processing stages such as labelling and hybridisation is likely to play an important role in consistency. As demand for array CGH investigations increases the use of automation will allow for high throughput whilst at the same time reliving staff from very repetitive work. The need for laboratory accreditation and external quality assessment will be discussed.
15.1-P
Barley chromosomes as a tool for mutation, tissue culture and gene localization studies N. Gozukirmizi and A. Altinkut Istanbul Univ., Tubitak, MRC, RIGEB
14.23-P
Microarrays in the diagnostic laboratory E. Maher, F. Sharkey and D. Fitzpatrick South East Scotland Cytogenetics Service, MRC Human Genetics Unit, Edinburgh Microarray Comparative Genome Hybridisation (array CGH) allows for the detection of copy number changes throughout the entire genome at a resolution that far exceeds that of conventional cytogenetics. Although initially developed in research laboratories the technology has now matured so much that array CGH investigations are now beginning to be part of the standard repertoire of tests offered by diagnostic cytogenetics laboratories. The types of referrals for which microarray analysis is appropriate include, characterising known chromosomal abnormalities, patients with an apparently balanced karyotype but with an abnormal phenotype, and children with learning difficulties and dysmorphic features. The transition of array CGH techniques out of the research environment into the diagnostic clinical laboratory setting raises many challenges. These include the availability of suitable arrays, the
This presentation summarizes the cytogenetical studies which were performed by our group using barley as an model organism for mutation, tissue culture and gene localization research. During mutation studies; barley seeds were treated with X (16000, 20000, 32000 r) and gamma (2000, 8000, 12000 r) rays before sowing. At a suitable phase of spike development, flower buds of the treated and untreated control groups were fixed in 1:3 aceto-alcohol and Feulgen smear preparations were made. The percentage of abnormal cells is increase with increasing dosage of treatment. During tissue culture studies; callus cultures were induced from mature embryo explants of barley in Murashige- Skoog medium(MS) supplemented with 1 mgl-1 2,4-D. Calli at different ages(10, 22, 45, 360 and 540 days after culture) were transferred to MS medium lacking 2.4-D for plantlet regeneration and some part of these calli were fixed in 1:3 aceto-alcohol. Feulgen smear preparations were made for chromosome analyses. Abnormalities in number and structure of chromosomes increase with the age of calli. For gene localization studies; chromosomes were prepared from young roots of barley. A genomic BAC DNA library of Triticum tauschii was screened for clones containing the marker Xabc156 which is mapped 11.6 cM, from Dn4 on one side in wheat chromosome
6th ECC: Abstracts
270 1DS. Cot-1 DNA was prepared from genomic DNA of barley. The BAC clones of Xabc156 (red) and P18S5SrDNA (green) were labeled with digoxigenin11-dUTP and biotin-14-dATP respectively by nick translation. FISH was carried out as described previously (Lapitan et al. 1997). FISH signals of Dn4 gene appeared co-localized with p15S5SrDNA on barley interphase nuclei and long arm of chromosome 5 of barley metaphase chromosomes. Lapitan, N.L.V., Brown, S.E., Kennard, W., Stephens, J., and Knudson, D. 1997. FISH physical mapping with barley BAC clones. Plant J. 11: 149Y156.
were conserved with respect to genome. DNA sequences of repetitive gene are extremely diverse in the genomes of Musa. While sub-families of repetitive genes could be identified, most families were not specific to particular diploid species (or genome), indicating that the divergence and amplification had occurred in the common ancestor. Study of diversity of DNA sequences of repeated genes gives a broad insight into genome organisation, evolution and the diversity of banana, enabling progress towards gene discovery and exploitation for plant breeding.
15.2-P
15.3-P
DNA and genome diversity in bananas and plantains (Musa)
Developmental responses to salinity in bread and durum wheat roots
Azhar Mohamad and Pat Heslop Harrison
A. Altinkut Uncuoglu and Aysen Yumurtaci
University of Leicester
Tubitak
Bananas, genus Musa, are giant perennial herbs with a small genome of 600 Mbp. Cultivars and their relatives in section Eumusa, including the A (Musa acuminata), B (M. balbisiana) and S (M. schizocarpa) genomes have a basic chromosome number, n, of 11 and occur as diploid (2n=2x=22), triploid (2n= 3x=33) and tetraploid (2n=4x=44) plants with a centre of diversity in South-East Asia. Other species (Rhodochlamys, Callimusa) have a basic chromosome number of n=10. Abiotic and biotic stresses are major factors affecting banana production, and it is important to measure and characterize genetic diversity within the gene-pool at the molecular level. Genes which are repeated many times in the genome include the rDNA, genes related to retroelements, and signalling genes that are related directly to plant stress responses and resistances. Chromosome analysis showed diversity in ploidy and 5S rDNA number from banana cultivars. Primers designed from genomic and EST databases were used to characterize sequences containing Nucleotide Binding Sites (NBS) and Leucine-Rich Repeat (LRR) motifs associated with disease resistance. In Arabidopsis, there are 400 of these genes and the number is similar in banana. PCR product sequences were used to generate a tree and four significant gene clusters were identified. Neither NBS nor LRR sequences
Salt stress inhibits plant growth and development. We investigated the importance of cellular levels of the primary root growth response of Triticum aestivum and Triticum durum to salt stress. Effects of salt stress on root growth, mitotic index, nuclear volume, vacuolization, nucleolar distortion, cytoplasmic free Ca+2 concentration and starch content were investigated in Turkish bread wheat (Triticum aestivum cvs. Yildiz-salt sensitive, Dagdas-salt tolerant) and durum wheat (Triticum durum cvs. C1252-salt sensitive, Meram-salt tolerant) genotypes which were treated with 150 mM NaCI over a 6 d period. Treatment of wheat seedlings with salt resulted in a decrease in root elongation and cell division both for bread and durum wheat genotypes at 48 h. According to control, bread wheat root length decrease was 49% for Dagdas, 53.34% for Yildiz, in durum wheat; this decrease was 25.34% for Meram, 53.68% for C1252. Mitotic index showed a more significant decrease in sensitive genotypes (70.21% for Yildiz 82.36% for C1252) of bread and durum wheat plants rather than tolerant ones (40.8% for Dagdas, 73% for Meram). Calculated nucleolar volume of salt treated all bread and durum wheat genotypes besides Dagdas showed a decline at 48 h ranged from 1.57 105 to 2.13105. Vacuolization and nucleolar distortion appeared on DAPI stained preparations of both bread and durum
6th ECC: Abstracts wheat genotypes. Accumulation and distribution of cytoplasmic free Ca+2 stained by Indo-1 in bread and durum wheat genotypes showed an increase in salinity although there was no difference between salt treated groups. There was a clear reduction in starch content in salt treated genotypes of tetraploid wheats, which were stained with potasium iodur at 48h; especially C1252 was weakly stained with potasium iodur. It was also observed that Dagdas, the tolerant bread wheat genotype, had the most starch content among salt treated groups of bread and durum wheat genotypes.
15.4-P
Karyotype of Matthiola Trojana T.Dirmenci, F.Satil and G.Tu¨men (Brassicaceae), endemic to Turkey E. Martin, A. Duran and T. Dirmenci Selc¸uk University, Balikesir University Matthiola trojana T.Dirmenci, F. Satil & G.Tu¨men is an endemic species belonging to the family Brassicaceae. In this research, chromosome number and morphology were determined in this species. Somatic chromosome number was counted as 2n=12. The karyotype consisted of four pairs of metacentric chromosomes and two pairs of submetacentric chromosomes. Chromosome length varied from 2.44Y4.27 mm. A karyogram and idiogram were drawn based on centromeric index and arranged in order of decreasing size.
15.5-P
New chromosome counts in Hesperis L. (Brassicaceae) from Turkey ¨ nal A. Duran, E. Martin and Fatma U Selc¸uk University, Gazi University Hesperis L. is a genus in the Brassicaceae family and has 27 species in Turkey. In this study, Hesperis L. which grows up naturally has five taxa and their chromosome number was defined for the first time. These taxa are Hesperis schischkinii Tzvelev, H. anatolica A.Duran, H. pendula DC. subsp. dirmilen-
271 sis A.Duran, H. o¨zcelikii A.Duran and H. aspera Fourn. as a order of floristic. Their diploid chromosome numbers were counted: Hesperis schischkinii, H. anatolica and H. aspera species were 2n=14, and H. pendula subsp. dirmilensis ve H. o¨zcelikii taxa were 2n=12. There is one double satellite metaphase chromosome only in H. anatolica in these five Hesperis taxa.
15.6-P
Repeated sequence similar to the FokI satellite of Vicia faba in the Lupinus genome Naganowska, A. Kaczmarek and B. Wolko Institute of Plant Genetics, Polish Academy of Sciences The Lupinus genus comprises numerous species, many of them important for sustainable agriculture. The genus phylogeny is still unclear and relationships among contemporary forms are not well determined. Investigations of genome structure can be useful for discussion concerning genus evolution as well as for studies aimed on lupin use as a crop. This work makes a part of larger lupin genome studies aimed on genetic and physical mapping. The FokI repeated element (59 bp) has been considered as species specific for Vicia faba genome and was not detected in any other taxa. We confirmed the presence of a similar sequence within the genome of Lupinus species using a PCR reaction. The reaction was performed with two primers designed and synthesized for the whole FokI sequence as well as with the 29-nucleotide fragment as one primer. Amplified fragments were sequenced. Simultaneously, we analyzed physical localization of the FokI repeat directly in mitotic Lupinus chromosomes on cytological preparations, using the PRINS (primed in situ DNA labeling) reaction. The PRINS procedure is useful for detecting short DNA sequences in chromosomes as it is fast, sensitive, does not require labeled DNA probes and a minimum of sequence information is sufficient to design and synthesize oligonucleotide primers. The indirect PRINS variant was applied, with the use of fluorochrome-conjugated antibodies for signals revealing. Permanent squash
6th ECC: Abstracts
272 preparations were made from root meristems of lupin seedlings. The discussion of results concerns relationships among species studied.
arrestment studies in plants. The existance of a mono-astral configuration gives a clue for the first time in this study that an Eg5 like kinesin motor protein, which functions in the formation of mitotic spindles, could also be present in Pisum sativum.
15.7-P
Monastrol causes mitotic arrestment in Pisum Sativum T. Hekimbasi and T. San Gebze Institute of Technology The effects of monastrol, which is known to be an inhibitor of human kinesin microtubule motor protein Eg5, were investigated on the root tip cells of Pisum sativum aiming to obtain a clue of an Eg5 like protein existing in plants. Studies pointing out Eg5 like protein existence in fungi have been restricted to Saccharomyces and Aspergillus only. Seedlings of P. sativum were treated with monastrol dissolved in DMSO. Sterile distilled water and DMSO groups were used as controls. Mitotic preparations were made at 6 and 24 hrs intervals. Results of the study showed that monastrol does not seem to effect the initiation of mitosis, but caused a mono-astral configuration of chromosomes at metaphase. This configuration is known to be unique in cells effected by monastrol that inhibits Eg5 motor protein of microtubules. In the treatment groups, only the cells at metaphase stage seemed to be effected by the inhibitor, where as no significant negative influence on the cells at prophase stage could be seen (p90.01). It was detected that arrested cells at metaphase, effected by monastrol, could not proceeded to further mitotic stages. The number of mono-astral configurations is observed to be correlated with the the duration of inhibitor treatment (pG0.01). In the 24 hrs monastrol treatment groups, mono-astral configuration numbers increased significantly in comparison with the 6 hrs treatment group (pG0.01). In the 24 hrs group, some cells exhibited polyploidy. Observations suggests that monastrol, which is a target protein for cancer treatments, could also be suitable for mitotic
15.8-P
Chromosomal diversity and karyotypes in diploid and polyploidy species in the grass genus Bromus L. Metin Tuna1, Trude Schwarzacher2 and J. S. Heslop-Harrison 1
Namik Kemal University, Faculty of Agriculture, Department of Field Crops, 59030, Tekirdag, Turkey., 2University of Leicester, Department of Biology, Leicester LE1 7RH, U.K., University of Leicester, Department of Biology, Leicester LE1 7RH, U.K. Studies of the genome structure, evolution and diversity of the grass genus Bromus have been hindered by the morphologically similar chromosomes which make karyotyping difficult using classical cytogenetic methods. Therefore, we know little about the relationships within the Bromus genus and about phylogeny including the origin of polyploids. We used fluorescence in situ hybridization on Bromus species for chromosome identification to generate more informative karyotypes and to find candidate diploid and tetraploid progenitors for cultivated ployploid species. Fluorescence in situ hybridization by using 5S and 45S rDNA as probe made it possible to identify nearly half of the chromosomes in all species tested except tetraploid B. ciliatus. B. ciliatus had signal on only four chromosomes and its karyotype was the most distinct. Genomic relations of the Bromus species will also be discussed based on karyotypes developed in the study and the prospects for resynthesizing polyploids considered.
6th ECC: Abstracts
Satellite Abstracts Affymetrix Satellite Symposium
1-S The European Cytogenetic Initiative (ECI): Molecular karyotyping of 120 patients with unexplained mental retardation by Mapping 500K SNP arrays A. Dufke1, D. J. McMullan2, B. B. A. de Vries3, E. C. Rattenberry2, M. Bonin1, S. Jacobs5, ¨ . Altug-Teber1, H. Enders1, A. Riess1, O E. V. Davison2, T. Kleefstra3, S. Vermeer3, N. Van Slobbe-Knoers3, O. Riess1, L. Brueton4 and J. A. Veltman3 1
University of Tuebingen, Department of Medical Genetics, Tu¨bingen, Germany; 2West Midlands Regional Genetics Laboratory, Birmingham Womens Hospital, Birmingham, United Kingdom; 3Radboud University Nijmegen Medical Centre, Department of Human Genetics, Nijmegen, The Netherlands; 4West Midlands Clinical Genetics Unit, Birmingham Womens Hospital, Birmingham, United Kingdom; 5 Affymetrix, Inc, Santa Clara, USA Mental retardation affects about 3% of the population. Chromosomal aberrations and genetic monogenic diseases are a frequent cause; however, in about 40% of moderate/severely affected patients the aetiology of the disease remains unknown. Routine cytogenetic diagnostics may only detect deletions/ duplications of more than 5Y10 Mb in size. However, de novo submicroscopic chromosomal imbalances account for appr. 10Y15% of patients with mental retardation and congenital malformations (MR/CM) indicating a true diagnostic need for tools detecting aberrations of smaller size. Such technologies as highresolution array-CGH and molecular karyotyping on SNP arrays have been developed during the last years and may be used for genome wide screening of submicroscopic gains and losses. In order to assess the sensitivity of SNP arrays for molecular karyotyping, the Departments of Human/ Medical Genetics in Nijmegen, Birmingham and Tu¨bingen, as well as the industrial partner Affymetrix have formed a collaboration to facilitate Map-
273 ping 500K array analysis of 120 trios (father, mother, affected child with unexplained MR/CM). In addition, 40 patients with previously confirmed submicroscopic copy number variations (CNVs) including subtelomeric rearrangements and interstitial deletions/duplications of at least ~200 kb as well as a panel of known microdeletion syndromes were reanalyzed on the Mapping 500K array platform. The main purpose of the study was to assess the validity of the Affymetrix Mapping 500K arrays in diagnostic settings of unexplained MR/MC. All known submicroscopic copy number changes were unequivocally detected on the Mapping 500K arrays. In those patients where aberrations were previously analyzed by high-resolution array CGH, the deletion/duplication sizes were found to be in accordance with the SNP array results. In the cohort of 120 patients with unexplained MR/ MC a total of 17 de novo CNVs had been found by the time of writing, including 12 deletions (1q23.3-q22, 1q42, 2q23, 3p14, 5q14, 11q24-qter, 12q24.2, 16pterp13.3, 17p13.3, 18q22.3-qter, 19p13.2, Xq25) and 5 duplications (5p15.33, 8q12.3, 15q23, 16q23.2-qter, 18pter-p11.2). These CNVs varied in size from 700 kb to 12 Mb. In addition, besides numerous inherited small CNVs, a large maternally transmitted deletion of ~5 Mb on 16p13.11-p12.3 was detected. In conclusion, we provide evidence that high resolution SNP typing using the Mapping 500K arrays is a reliable approach to detect subtelomeric and interstitial aberrations and to define the respective sizes of the aberrations. The diagnostic yield of this approach is significant and warrants a rapid implementation of these genome wide microarrays in a clinical setting.
Agilent Satellite Symposium
2-S Advances in clinical research using high density array - CGH Chromosome rearrangements are commonly associated with multiple disease states and syndromes. Researchers and clinicians can employ several techniques to detect chromosome changes, which include karyotyping, Fluorescence In-situ Hybridization, Spectral Karyotyping and conventional CGH.
274 Today the power of array-based Comparative Genomic Hybridization (aCGH) is being more and more accepted in cytogenetics research and is now being widely used for high resolution genome wide profiling of human tumors and other genetic diseases, for the identification of DNA copy number changes and for the precise mapping of chromosomal breakpoints associated with specific disease phenotypes. In this symposium you will hear about latest advances in the use of high density oligonuleotide microarray-based comparative genomic hybridization (aCGH) in Cytogenetics Research. Confirmed speakers are: Prof Dr Orsetta Zuffardi, Universita` di Pavia, Italy, Dr John A Crolla, Wessex Regional Genetics Laboratory, UK and Francisco Cifuentes, Agilent Technologies, USA
Ikonisys Satellite Symposium: Ikoniscope\ Robotic Microscopy in Cytogenetics and Rare Cell Detection
3-S Fully automated FISH examination in prenatal and bladder cancer diagnosis Jan Wauters Department of Medical Genetics, Cytogenetics and Molecular Cytogenetics, Antwerp University, Belgium In a first study, the efficacy of a fully automated system for FISH analysis as a rapid screen for common chromosome abnormalities in prenatal diagnosis was compared to standard manual FISH analysis in 152 amniotic fluid samples. Following hybridization with a standard panel of five chromosome FISH probes, one set of slides was evaluated using manual microscopy. The other set was evaluated using an automated microscopy system. A diagnostic outcome was obtained for all 152 samples using manual microscopy and for 146 of 152 (96%) samples using automated microscopy. Three cases of aneuploidy were detected. For those samples for which a diagnostic outcome was determined by both manual and automated microscopy, 100% concordance was observed. All FISH analysis results were confirmed by karyotype.
6th ECC: Abstracts To validate the basis of the automated analysis, we compared the automated FISH signal counts with those determined by two indepentdent experienced operators examining the identical images. The robustness of the automated system was demonstrated by the high degree of reproducibility between two separate instruments operating in two locations. These data suggest that an automated microscopy system is capable of providing accurate and rapid enumeration of FISH signals in amniocytes. In a second study we introduce automated FISH based testing for bladder cancer treatment and monitoring into the Flemish Population. Invasive bladder cancer is ranked at the 7th position of the different tumor incidences in the Flemish region and bladder cancer is an oligo-symptomatic, a silent disease. Therefore, early signs of primary bladder cancer are often overlooked and cancer is diagnosed only after invasive procedures. Superficial bladder cancer has a high tendency to recur and, in a significant subset of patients, to progress. Close followYup of these patients over time is both appropriate and mandatory. In most patients followYup is provided by cystoscopy and urine cytology. However, cystoscopy is an invasive and expensive procedure and cytology has a relatively poor sensitivity for the detection of bladder cancer, particularly in histologically well or moderately differentiated tumors. Noninvasive diagnosis and monitoring of bladder cancer is a highly attractive alternative for both the doctor and the patient. Before control cytoscopy, a fresh urine is split: one half for normal urine cytology, the other half for FISH. Given an abnormal cytology, a biopsy will be taken. The abnormal cytology will be compared with FISH. Given an normal cytology and an abnormal FISH, a biopsy will be taken too. The "golden standard is and remains the biopsy obtained by cytoscopy. Cytology and FISH will be compared to each other conscerning sensitivity and specificity. The primary endpoint is that FISH has a better sensitivity and higher specificity than cytology. However, it might be possible that FISH leads to an unnescessary high number of cytoscopies and biopsies being taken. (secondary endpoint : FISH overestimates the number of positive cases). The study utilizes the ThinPrep\ UroCyti approach for preparation of slides from urine samples, the UroVysion \ Bladder Cancer Kit for hybridization of those slides with FISH probes for
6th ECC: Abstracts chromosomes 3, 7 and 17 (aneuploidy are typically associated with progression of urothelial carcinoma) and the chromosome 9p21 locus (deletions of the P16 gene are early appearing and most common genetic changes in urothelial carcinoma), and the Ikonisys\ oncoFISHi Bladder application for the automated analysis of the slides.
4-S Detection of circulating tumour cells in peripheral blood with an automated scanning fluorescence microscope (Ikoniscope\) Triantafyllia Ntouroupi and Walter Bodmer Cancer and Immunogenetics Laboratory, Weatherall Institute of Molecular Medicine, University of Oxford, UK The detection of circulating tumour cells (CTC) in the blood has significant potential for diagnosis and treatment decisions. The presence of circulating tumour cells appears to be an early marker for recurrence and relapse, and published studies have suggested that CTC levels may reflect the response to chemotherapy and the presence of metastatic growth of the tumour. Circulating tumour cells may occur at frequencies of less than one cell per 106 peripheral blood mononuclear cells, and so need special techniques for their detection.
275 The aim of this research is to develop a highly sensitive, reliable, and potentially quantitative detection method for rare cancer cells in the blood. Blood samples were collected from 18 colorectal cancer patients, 17 prostate cancer patients and 3 healthy controls. Mononuclear cells and epithelial cells are separated on Ficoll-Hypaque density gradient. The cells are then labelled using the monoclonal antibodies Cam5.2 directed against epithelial specific Cytokeratins 7/8/19 and AUA1 directed against EpCam, which is expressed on most carcinomas, but only on a minority of normal epithelial cells. The slide preparations are analyzed using a robotic digital microscopy platform (Ikoniscope\), specifically designed by the company Ikonisys for high throughput detection of rare cells. Target cells are automatically identified by scans at low (10) magnification, and all identified targets are revisited and verified at high (100) magnification. Potential cancer cells, showing positive reactions with both monoclonal antibodies, were detected in most of the cancer patient samples but in none of the healthy controls. An advantage of this procedure is the possibility of combining fluorescent in situ hybridization (FISH) with immunofluorescence, for the detection of aneuploidy in the circulating tumour cells. Further work will focus on analyzing more patient samples from various cancer types and establishing a correlation between tumour stage, disease progression and response to therapy with the presence, characterization and number of circulating tumour cells in the blood.
276
6th ECC: Abstracts
Late Abstracts
We present the clinical findings of the patients at two different ages, comparing our results with the available data from the literature.
Pentasomy: follow-up of two cases in Venezuela
Prenatal diagnosis of a Bde novo[ unbalanced translocation t (X;14) Y Cytogenetic and FISH studies
Vera L, D_Elia G, Gonzalez D, Rivas T and Fassrainer A Children_s Hospital BJ.M. de Los Rios[, Department of Medical Genetics, Caracas, Venezuela
M. L. Fonseca Silva, J. Aguiar, M. Mota Freitas, Conceic¸a˜o Brito and M. Pinto Instituto de Gene´tica Me´dica Jacinto de Magalha˜es, Porto, Portugal
Pentasomy X is a rare gonosomal abnormality. There have been only 110 cases reported, with higher incidence in females than in males. The incidence is 1 in 85.000 male live births in postnatal diagnosis. Clinical abnormalities are similar in both sexes and can be described as abnormal facial features, heart, skeletal and limb anomalies, and developmental delay. Two cases are presented: a 11 month old female and a 10 month old male, both referred for genetic diagnosis because of abnormal features. Both pregnancies underwent gestational complications. Clinical examination of the patients revealed similarities: epicanthal folds, hypertelorism, deep settled nose, abnormal helix, cardiopathy, low birth weight and height. Few differences were observed. The female showed microcephaly, simian creases on both hands, and had had three reported pneumonias and one middle ear infection since birth. The male had hypotony, joint hyperlaxity, occipital prominence, and dimples on the abnormal helix, inverted nipples and ambiguous genitalia. Paraclinical examinations also revealed a cortical atrophy, and hypoplasia of the corpus callosum as well as an atrioventricular septum defect and ventriculomegaly. The karyotype of the first patient was 49,XXXXX, and of the second patient was 49,XXXXY in all examined blood cells. A second clinical examination of the female and the male at the ages of 7 and 6 years respectively, revealed 4 pneumonias and a severe otitis by the female before heart surgery. She also developed a severe mental retardation. The male had hypospadias, bifid scrotum and an included phallus. He developed epilepsy and hypothyroidism.
Unbalanced X;autosome translocations are rare events and the majority of cases described in the literature involve derivative chromosomes from a maternal balanced translocation leading to a partial autosomal trisomy. The resulting phenotypes vary from mild to severe depending on the chromosome imbalance (size and content of the duplicated segment) but also on the X inactivation pattern. In these situations there is a selective inactivation of the abnormal X spreading into the autosomal chromatin to avoid partial trisomy of the autosomal segment. In the very rare cases that imply a monosomic imbalance, the normal X can be inactivated in order to allow the survival advantage of the conceptus. We present a case of a prenatal diagnosis performed in a 24 year old woman referred for cytogenetic studies at 21 weeks of gestation because of foetal malformations detected on ultrasound. Conventional cytogenetic analysis of GTG-banded metaphases from amniotic fluid cells revealed a karyotype 45,X,der(X)t(X;14)(p22.3;q11.2)dn. FISH studies with a specific subtelomeric probe for the short arm of chromosome X demonstrated the absence of fluorescent signal on the translocated chromosome. Parents decided to terminate this pregnancy. Although X inactivation studies were not yet performed, it is likely that this is one of the rare cases where the normal X is preferentially inactivated in order to allow the survival, since monosomy chromosome 14 is lethal in utero. Moreover, the foetal abnormalities found on ultrasound are compatible with those present in patients with deletion of
6th ECC: Abstracts 14q11.2Y14q13 previously described in the literature. For academic reasons, further studies are planned to clarify the inactivation pattern.
BPure[ Partial 13q Duplication: Two cytogenetically similar cases M. Mota Freitas1, N. Oliva Teles1, C. Vieira1, J. Ribeiro1, J. Pinto-Basto1, A. Sousa2, A. Fortuna1 and M. Pinto1 1
Instituto de Gene´tica Me´dica Jacinto de Magalha˜es, Porto, Portugal; 2Hospital Conde de S.Bento, Santo Tirso, Portugal Many 13q partial trisomies have been published to date although most of the reports are based on patients with derivative chromosomes from balanced familial translocations who, concomitantly, show partial monosomy for the other chromosomal segment involved in the translocation. However, Bpure[ 13q partial trisomies are rare events resulting in the majority of cases from intrachromosomal, direct or inverted duplications. To our knowledge, extra material from the long arm in the short arm of the same acrocentric chromosome has never been published.
277 We present two cases: a 1 year old girl with psycomotor retardation and congenital cardiopathy and a 12 year old boy with mental retardation, craniofacial dysmorphies, precocious puberty and normal karyotype. In the first case routine cytogenetic analysis using GTG banding showed a mosaic abnormal chromosome 13, with extra material on the short arm, of unknown origin Y CBG and AgNOR banding excluded the presence of heterochromatic material. The karyotypes of both parents were normal. To identify the origin and composition of the extra material in 13p, fluorescent in situ hybridization (FISH) was performed which allowed us to identify the extra material as 13q31Y13qter. In the second case, using chromosome-specific telomere fluorescence in situ hybridization (FISH) probes, we identified a chromosome 13 with two signals corresponding to the subtelomeric region 13q, one of them attached to the short arm of chromosome 13. It has not been possible to determine the origin of this dup(13q) since the parent_s karyotypes have not been available to date. The authors compare the phenotypes of both patients, establish the correlation between them and similar cases described in the literature and postulate the mechanisms that originated these two cytogenetic abnormalities.
6th ECC: Author Index
278
Author Index Abad, C. 4.6-P, 4.7-P Abad, M. C. 7.110-P, 7.111-P Abazi-Stamboulieh 7.106-P Abdelmoula, N. 1.208-P, 1.207-P Abdelmoula, N. B. 1.206-P Abedini, S. S. 9.7-P Abeer, A. H. 12.29-P Abildinova, G. 7.42-P, 7.43-P Aboura, A. 1.36-P, 1.212-P, 5.1-O, 7.34-P Acarsoz, D. 12.15-P Ac¸c¸, Alvarez, A. 1.234-P Adam, Z. 7.41-P Adamova, K. 1.11-P Adela. 1.234-P Adinolfi, M. 12.1-P Adir, V. 1.40-P Adjiman, S. 1.73-P Aghazadeh, A. 7.4-P Aghili, H. 7.57-P, 7.58-P, 7.59-P Agiolucci, M. 1.222-P Aguayo, A. 7.32-P Akalin, I. 7.100-P Akasaka, T. 7.2-O Akbari, M. T. 1.197-P, 7.105-P, 12.23-P, 12.24-P, 14.17-P Akbas¸, E. 1.93-P Akbas, H. 1.248-P Akhlaghpour, S. 7.70-P Akhlaphpoor, S. 2.5-P Akopyan, H. 3.7-P Akpulat, U. 1.188-P, 1.192-P Aksakal. 1.227-P Aksoy, F. 1.178-P Aktan, E. 1.188-P Aktan, M. 7.92-P Aktas¸, D. 1.109-P, 1.110-P, 1.111-P, 1.142-P, 1.151-P, 1.166-P, 1.176-P, 3.15-P Alacacioglu, I. 7.114-P Alafaki, H. 7.23-P Alanay, Y. 1.109-P, 1.110-P, 1.111-P, 1.142-P, 1.151-P, 1.166-P, 1.176-P, 3.15-P Alaoui, N. 2.1-P Alar, S. 13.5-P Alatas, E. 1.158-P Albano, F. 7.96-P Alcala´, A. 1.234-P ¨ . 1.163-P Aldemir, O Alegre, M. 1.28-P Aleksiu niene˙, B. 1.51-P, 1.55-P Alfaro Arenas, R. 1.205-P Algaba, F. 7.93-P Alikas¸ifog˘lu, M. 1.109-P, 1.110-P, 1.142-P, 1.151-P, 1.166-P, 1.176-P, 3.15-P Alkan, T. 1.46-P Alkan. 1.139-P Alkhalaf, M. 3.3-P
Allemani, C. 7.98-P Almeida, C. 1.132-P Alonso Sanchez, A. 5.9-P, 12.27-P Aloui, N. 1.233-P, 1.234-P, Alp, M. N. 1.236-P, 1.249-P Alparslan Pinarli, F. 1.21-P, 1.39-P, 1.60-P Altinkut, A. 15.1-P Altinkut Uncuoglu, A. 15.3-P ¨ . 9.1-P, 1-S Altug Teber, O Altunoglu. 1.165-P Alvarez, A. 1.233-P ´ lvarez, M. 13.2-P A ´ lvarez, S. 7.1-O A Alves, C. 1.120-P Aly. 7.78-P Amare Kadam, P. 7.21-P, 7.22-P Amiel, A. 7.5-P Amir, I. 3.1-O Amouri, A. 1.206-P, 1.208-P, 1.220-P Anagnostopoulos, A. 7.11-P Anal, O. 3.19-P Anastasiadis, A. 7.38-P Anastasiadou, V. 9.5-P Anastasiou, A. 1.8-P Andreescu, N. 1.59-P, 1.106-P Andresen, B. S. 9.8-P Andreu, S. 12.7-P Andreucci, E. 14.15-P Andreucci. 5.2-O Angiolucci, M. 1.224-P Anichini, C. 37-L Anson, J. 29-L Anton, E. 1.114-P, 4.2-O Antonacci, F. 2.1-O Antonazzo, P. 7.98-P Antonenko, V. 1.3-P, 1.133-P Apak-Yu¨ksel, M. 1.63-P, 1.67-P, 1.90-P, Apostol, P. 7.9-P, 7.13-P Aragones, N. 3.17-P Arber, C. 7.80-P Archidiacono, N. 2.1-O Arghir, A. 7.82-P, 7.83-P, 7.87-P, Arghirescu, S. 7.104-P Arias, A. 7.56-P Armengol, L. 13.4-P Arnante, M. E. 7.110-P, 7.111-P Arora, B. 7.22-P Arpag, S. 1.182-P Arroyo-Mun˜oz, M. E. 1.1-O Artan, S. 1.163-P, 1.164-P, 3.16-P, 5.7-P, 12.17-P, Artigas-Lo´pez, M. 5.9-P, 12.27-P, 14.19-P Asci, R. 1.60-P Ashok kumar, S. 7.22-P Astier, L. 7.53-P Astrea, G. 3.14-P
Atayurt, Z. 10.2-P, 10.4-P, 10.5-P, 10.7-P, 10.8-P Athanasiadou, A. 7.11-P Atzeni, M. 1.224-P Aubard, V. 1.230-P Auletta, F. 32-L Avci, Z. 7.63-P Avila, 1.185-P Avonds, W. 4-L Ay, M. E. 1.91-P Ayan, S. 7.115-P Aydin, D. 7.89-P, 7.116-P Aydinli, K. 12.26-P Aydogdu, F. 1.182-P Aydos, K. 1.244-P Aypar, E. 1.218-P Ays¸egu¨l, B. 1.128-P, 1.215-P Aytan, M. 12.26-P Ayub, S. 12.30-P Azadbakht, M. 2.5-P Azakli, Z. 12.15-P Azzena, A. 1.222-P, 1.224-P, 7.112-P Babic´, I. 1.15-P Babicka, L. 7.18-P, 7.19-P, 7.37-P Babicz, M. 7.77-P Bacino, C. 1.5-O Backs, L. 37-L Backx, L. 1.2-O Bademci, G. 1.163-P, 1.164-P, 3.16-P, 5.7-P Badenas, C. 12.5-P Baena, N. 1.117-P, 1.233-P Bafalliu, J. A. 1.33-P Bagatir, G. 7.67-P, 7.72-P, 7.73-P, 7.89-P, 7.90-P, 7.91-P, 7.92-P, 7.116-P Bagci, G. 1.186-P Bagci, H. 1.60-P, 1.238-P, 7.16-P Bag˘cı, O. 1.170-P Bag˘cı, 1.158-P, 1.169-P Bagherizadeh, I. 7.70-P Bag˘lama, B. 1.170-P, 1.175-P, 1.180-P Bag˘lama, 1.183-P Bagnulo, R. 3.10-P Bahce, M. 1.228-P Bailly, M. 4.11-P Bajelan, B. 14.17-P Baka, M. 7.1-P Baker, A. 7.4-O Bal, F. 1.188-P Bal, 1.192-P Balasar, 1.125-P Balasas, T. 7.2-O Balcarkova, J. 7.40-P, 14.13-P Balci, S. 1.89-P, 1.93-P, Balci, 1.218-P Baldinger, R. 1.154-P
6th ECC: Author Index Balestrino, M. 1.222-P Balkan, M. 1.249-P Balkan, 1.236-P Balog˘lu, A. 1.192-P Baltaci, V. 1.20-P Ballarati, L. 1.119-P, 1.135-P Ballini, A. 3.10-P Banavali, S. 7.21-P, 7.22-P Banerjee, R. 14.22-P Banica, D. 13.1-P Baranovskaya, L. 1.3-P Baratelo, W. R. S. 1.69-P Barbarii, L. 5.2-P, 5.5-P Barber, J. C. K. 1.153-P Barbera, F. 7.98-P Bardel, M. 1.230-P Bardi, G. 6.5-P Bar-el, H. 1.40-P Bargagna, S. 3.14-P Bari, M. 1.173-P Barisic, I. 1.25-P, 1.27-P Baro´, C. 7.53-P Barquinero, J. F. 7.25-P, 7.26-P, 7.27-P, 7.28-P, 7.29-P, 7.30-P, 7.31-P Barranco, L. 1.58-P, 12.7-P Barren˜a. 1.130-P Barrie`re, P. 4.3-P Barrios, L. 7.25-P, 7.26-P, 7.27-P, 7.28-P, 7.29-P, 7.30-P, 7.31-P Barros, A. 1.131-P, 1.132-P Bartsch, O. 6.1-O, 1.218-P Basak, M. 7.88-P Basaran, N. 1.105-P Basaran, S. 1.63-P, 1.64-P, 1.65-P, 1.67-P, 1.90-P, 1.128-P, 1.143-P, 1.144-P, 1.165-P, 1.167-P, 1.174-P, 1.192-P, 1.4-O, 7.116-P, 10.3-P, 12.15-P, 12.25-P, 12.26-P, 13.1-O, 13.7-P Bashiardes, S. 9.4-P Basinko, A. 7.39-P Batalle, R. 1.28-P Bataneant, M. 7.104-P Batar, B. 1.171-P Baumer, A. 1.154-P Baumer. 1.4-O Baverel, F. 1.161-P Baverel. 1.160-P Baylon, H. 7.110-P, 7.111-P Bayrak, A. 7.67-P, 7.72-P, 7.73-P, 7.89-P, 7.90-P, 7.91-P, 7.92-P Baytan, B. 7.47-P Bazdiara, I. 7.38-P Bazin, A. 1.48-P, 5.1-P Beaudet, A. 1.5-O Beaujard, M. P. 1.36-P Beavis, J. C. 7.3-O Becker, R. 12.8-P Beckers, F. 4.4-P Beder, L. B. 7.74-P, 7.97-P
279 Bednarek, N. 14.8-P BeeLing, Ng. 7.3-O Begovic, D. 7.62-P Beheshty, Z. 7.105-P Behjati, F. 1.140-P, 7.70-P, 9.7-P Belengeanu, A. 1.18-P, 1.59-P Belengeanu, V. 1.18-P, 1.106-P, 1.115-P Belkaid, M. 7.49-P Belyayev, A. 21-L Belzunces, N. 1.233-P, 1.234-P Bellesme, C. 1.70-P Belli, S. 37-L Bellini, M. 3.2-O Bellucco, F. T. S. 1.124-P Bembea, M. 5.5-P Ben Jemaa, L. 1.54-P, 1.82-P Ben Rekaya, M. 1.220-P Benet, J. 10.1-P, 4.6-P, 4.7-P, 4.10-P Benevento, A. 7.48-P Bengoa-Alonso, A. 14.19-P Benkhaled, L. 7.26-P, 7.27-P Bennour, 7.107-P Bentivegna, A. 1.103-P, 1.156-P Benzacken, B. 1.212-P, 5.1-O Berbec, N. 7.87-P Berdina, 13.6-P Bereket, A. 1.238-P Berens, M. L. M. 1.81-P Beresheva, A. 1.12-P, 3.9-P Berg, J. S. 14.10-P Bergere, M. 4.11-P Berker-Karauzum, S. 1.113-P, 1.186-P, 7.99-P Berland, H. M. 4.4-P, 4.5-P Bernard, P. 9.3-P Bernardi, F. 37-L Bernardi, G. 32-L Bernues Martı´nez, M. 1.205-P Beskorovainaya, T. 1.150-P Beusen, L. 4-L Beyazyurek, C. 1.79-P, 1.80-P, 1.92-P, 1.104-P, 1.181-P, 1.203-P, 10.5-P, 10.6-P, 10.11-P Beyazyurek. 10.16-P Beyer, V. 7.80-P, 7.84-P Bezkorovajna, H. 3.7-P Bhatt, S. 4.1-P Bhouri. 1.210-P Biard, J. M. 14.14-P Bica, V. 5.2-P Bicak, U. 1.4-P Bickmore, W. 2-L Bien-Willner, G. A. 14.10-P Bilalovic, N. 1.66-P Billi, C. 1.8-P Biri, A. 1.32-P Birinci, N. 1.171-P, 1.182-P, Birollaud, K. 1.84-P Birsen, K. 1.128-P Bisgaard, A. M. 14.9-P
Bisgin, A. 1.114-P, 1.186-P, 4.2-O Blandin, T. 7.84-P Blazek, B. 7.40-P Blood, K. A. 7.3-O Bobrow, M. 29-L Boccone, L. 1.49-P Bocian, E. 14.11-P Bodmer, W. 4-S Bodner, L. 7.20-P, 7.24-P Bodurog˘lu, K. 1.109-P, 1.110-P, 1.142-P, 1.151-P, 1.166-P, 1.176-P, 3.15-P Boieiro, F. 1.120-P Bolat, F. 1.123-P Bonaglia, M. C. 36-L, 37-L Bonati, M. T. 1.119-P, 1.135-P Bonelli, A. 3.14-P Bonetti, F. 7.17-P Bonin, M. 9.1-P, 1-S Bonneau, D. 1.204-P Bonnet, N. 4.5-P Bonnet-Garnier, A. 4.4-P Bora, E. 1.105-P, 3.19-P Bora, Makay, B. 3.19-P Borekci, B. 1.37-P, 1.85-P, 1.139-P Borg, K. 14.11-P Borochowitz, Z. 1.40-P Borrad, J. 7.4-O Borrell, A. 12.5-P, 5.3-P Bo¨sch, N. 6.6-P Botelho, P. 7.52-P Bottani, A. 5.11-P Bouayed Abdelmoula, N. 1.220-P Bouchard, E. 12.30-P Bougeon, S. 7.80-P, 7.84-P Bougneres, P. 1.68-P, 1.70-P Bouhoutsou, D. 7.1-P Bourikas, G. 7.38-P Bourthoumieu, S. 1.230-P Bouscary, D. 7.34-P Bouvatier, C. 1.68-P, 1.73-P Bouvier, R. 1.84-P Bovo, T. 4.8-P Bown, N. 7.4-O, 7.108-P Bozkurt, K. 1.188-P Bradley, A. 14.22-P Braha, E. 1.116-P Braham, R. 1.47-P Brajenovic´-Milic´, B. 1.14-P, 1.15-P Brezinova, J. 7.18-P, 7.19-P Brigitte, F. 6.1-O Brishevac, L. I. 1.147-P Brisset, S. 1.216-P, 10.12-P, 12.14-P Brueton, L. 9.10-P, 9.11-P, 1-S Bruguera, J. 5.3-P, 12.5-P Bryan, J. 7.71-P Buchholz, T. 10.9-P Budak, T. 1.248-P, 1.249-P Buenerd, A. 1.84-P Buiatiotis, S. 7.48-P
6th ECC: Author Index
280 Buitenhuis, C. 7.69-P Bukulmez, A. 1.31-P Bukvic, D. 3.10-P Bukvic, N. 3.10-P Bulakbasi, T. 1.121-P, 1.123-P, 12.13-P Bu¨rki, N. 6.6-P Burlibasa, L. 3.21-P, 4.2-P Burul. 1.227-P Bustamante-Aragones, A. 30-L, 9.2-P Busuito, R. 7.48-P Cabada, J. M. 1.234-P Caballı´n, M. R. 7.25-P, 7.26-P, 7.27-P, 7.28-P, 7.29-P, 7.30-P, 7.31-P, 7.93-P Cabello, P. 12.18-P Cabezo´n, M. 7.55-P Caferler, J. 1.170-P C ¸ ag˘layan, S. 1.213-P Caguioa, P. 7.110-P, 7.111-P C ¸ akar, 1.235-P Calabrese, G. 37-L Calasanz, M. J. 7.1-O Calgaro, A. 4.5-P Cama, A. 7.81-P Camelia, B. 3.21-P Campbell, L. J. 7.14-P Campo, E. 7.56-P Campos, L. 7.12-P Can, C. 3.16-P Canan Vergin 7.76-P Candan, S. 1.167-P Candemir, Z. 1.227-P, 1.228-P, 12.32-P Caner, V. 7.16-P Cangul, H. 1.56-P, 1.61-P, 7.47-P, Cankaya, T. 1.105-P C ¸ ankaya, T. 1.126-P Canturk, M. 1.164-P Capdevila, N. 1.233-P Capkova, P. 1.11-P Capra, V. 7.81-P Caputo, V. 2.4-P Carcassi, C. 1.222-P, 1.224-P, Cardero-Merlo, R. 1.72-P, 9.2-P, Cardone Maria Francesca 2.1-O Cardos, G. 7.82-P, 7.83-P, 7.87-P Caria, P. 7.102-P Carmen Ramos 6.1-O Carreira, I. M. 1.94-P, 1.95-P, 1.96-P, Carrera, M. 12.3-P Carrilho. 2.6-P Carrio´, A. 7.49-P, 7.56-P Carter, N. 14.22-P Carter, N. P. 29-L, 9.6-P, 12.12-P Carvalho, B. 1.136-P Carvalho, F. 1.136-P Castrillo, A. 7.65-P, 7.94-P, 7.95-P Castronovo, C. 1.156-P, 12.22-P, 14.20-P, Catala`, A. 7.32-P Catala`, V. 1.100-P Cattoretti, G. 7.54-P
Cefle, K. 1.144-P, 7.67-P, 7.72-P, 7.73-P, 7.88-P, 7.89-P, 7.90-P7.91-P, 7.92-P, 7.116-P, Cegan, M. 7.44-P Ceganova, L. 7.44-P Celasun, B. 7.63-P Celep, F. 1.217-P Celewicz, Z. 12.16-P C ¸ elik, T. 1.110-P Cellamare, A. 2.1-O Cengiz, B. 7.97-P Cengiz. 7.74-P Cermak, J. 7.18-P, 7.19-P, Cernach, M. C. 1.124-P Cernelc, P. 7.66-P Cervantes, F. 7.56-P Cervera, J. 7.109-P Cesur, S. 1.241-P Cetin, Z. 1.184-P, 1.113-P, 7.99-P Chernykh, V. 1.23-P Ciccone, R. 37-L, 5.2-O Cifuentes, F. 37-L Cigudosa, J. C. 7.1-O Cihi, V. 1.232-P Cilingir, O. 1.164-P, 5.7-P Cilingir. 3.16-P Cimbalistiene, L. 1.55-P, 175-P C ¸ imen, I. 1.163-P, 3.16-P Cimponeriu, D. 7.9-P, 7.13-P Cinar, A. 1.168-P Cioata, I. 1.107-P Ciocoiu, F. 3.21-P Cirakoglu, A. 1.168-P, 1.179-P, 1.182-P, 13.3-P Cirigliano, V. 29-L, 1.58-P, 12.1-P, 12.7-P, 12.9-P, Cisneros, A. 1.233-P Ciudad, J. 7.94-P Clarence, Ch. K. O. 1.240-P Clark, C. 5.6-P Clark, L. 7.71-P Clarke, J. T. R. 9.8-P Clay, O. 32-L Clement, P. 1.73-P Clement-Sengewald, A. 10.9-P Closca, M. 7.83-P Clusellas, N. 1.146-P, 5.3-P Cobo, F. 7.49-P Coessens, B. 1.3-O C ¸ okıs¸ılak, T. 1.192-P C ¸ olak. 1.235-P Coleman, L. 9.10-P Colesniuc, R. 7.87-P Colin, E. 1.204-P Colognato, R. 3.14-P Coll, M. D. 13.4-P Collins, J. 7.35-P Comadran, L. 1.117-P, 13.4-P Coni, P. P. 7.102-P
Constantin, N. 13.1-P Constantinescu, A. 5.5-P Constantinou, M. 1.225-P Constantinou. 1.226-P Conte, N. 14.22-P Contostanou, S. 1.141-P Coppede, F. 3.14-P Cordeiro, I. 1.185-P Cornillon, J. 7.12-P Correia, H. 1.120-P Coskun Ucar, H. 1.152-P, 1.153-P Cosse, C. 5.10-P Costa, D. 7.49-P, 7.56-P, Costa, M. 1.233-P, 1.234-P, 4.10-P Costantini, M. 32-L Couchot, J. 14.8-P Courtens, W. 7.101-P, 14.14-P Covic, M. 1.78-P, 1.116-P, Craina, M. 1.106-P Craven-Bartle, J. 7.29-P, 7.30-P, 7.31-P, Crawford. 1.148-P Crea, F. 12.2-P Crespo, I. 7.95-P Cretu, A. 1.107-P Cristea, P. 13.1-P Crolla, J. 10.10-P Crolla, J. A. 15-L Crosti, F. 1.103-P, 7.54-P Cruz, C. 1.187-P Cuatrecsasas, E. 1.100-P Cucu, N. 3.21-P, 4.2-P Curtis, A. 7.4-O Curtis, F. 14.10-P Cuzzi, J. F. 4.8-P Chaabouni, H. 1.54-P, 1.82-P, Chaabouni, M. 1.54-P, 1.82-P, Chabrol, B. 5.11-P Chadli, E. 1.200-P Chaieb, l. 1.47-P Chaieb, M. 1.47-P Chaze, A. M. 1.48-P Chebotarev, A. N. 3.18-P, 3.22-P, Chelu, G. 7.82-P, 7.87-P, Chelly, I. 1.54-P, 1.82-P, 9.4-P, Chen, J. 9.8-P Chernykh, V. 1.129-P, 1.133-P Chernykh 1.150-P Chessa, L. 3.12-P Cheung, S. W. 1.5-O, 14.10-P, 14.11-P, Chi, H. 7.46-P Chia, W. K. 1.240-P Chinault, A. C. 1.5-O Chiryaeva, O. 1.194-P Chitayat, D. 14.16-P Chivu, M. 7.83-P Chokairi, O. 1.200-P Christopoulou, S. 1.16-P Christopoulou, V. 1.138-P Chrzanowska, K. H. 1.6-P
6th ECC: Author Index Chua, Y. L. 7.3-O Chukhrova, A. 1.150-P Chukhrova. 1.133-P Chung, W. 7.46-P D’Addabbo Pietro 2.1-O Dag˘demir, A. 12.32-P Dakhno, F. V. 1.147-P Dalpra`, L. 1.103-P, 1.209-P, 7.54-P, Daniely, M. 7.2-P Dastugue, N. 6.1-O Dauwerse, J. G. 1.134-P Davidson, P. 7.86-P Davison, E. V. 1-S, 9.10-P, 9.11-P Davut, P. 1.128-P De Amicis, A. 3.12-P de Boer, E. G. 1.41-P De Braekeler, E. 4.3-P, 7.15-P, 7.39-P, 7.45-P, De Brouwer, A. 9.4-P De Canal, G. 1.135-P De Gregori, M. 37-L, 5.2-O de la Chica, R. A. 1.50-P de la Fuente, A. 10.1-P de la Iglesia, C. 12.3-P de Lara, A. 1.146-P de Leeuw, N. 9.2-O de Leon Rodriguez, A. 3.17-P, 7.79-P, 12.20-P, de los Santos, N. 1.234-P De Moor, B. 1.3-O De Paepe, A. 17-L De Potter, P. 7.101-P De Preter, K. 17-L De Ravel, T. 10.10-P de Vega, J. M. 7.29-P, 7.30-P, 7.31-P, de Villa, E. 7.110-P de Vries, B. B. A. 11-L, 9.2-O, 1-S, Dean, J. C. S. 5.6-P Debauche, C. 9.3-P, 14.14-P Debrock, S. 10.2-O, 10.10-P Decker. 1.214-P Dehelean, L. 7.104-P Dehgan, T. 1.4-O, 10.3-P Deidda, S. 1.222-P Deidda. 7.112-P del Rey, J. 7.93-P Delahaye 5.1-O Delezoide, A. L. 1.245-P Delhanty, J. D. A. 4.1-O, 10.1-O Delimitreva, S. 4.9-P Demidova, I. 1.12-P, 1.39-P Demir, C. 1.53-P Demir, D. 1.246-P Demir, Hale. 1.178-P Demir, S. 12.17-P Demir, T. 1.31-P Demir, Z. 1.63-P, 1.64-P, 1.90-P, Demircan, K. 7.97-P Demirhan, O. 1.53-P
281 Demirkan Fatih 7.114-P Demirtas, H. 1.145-P Denguezli, W. 1.45-P, 1.210-P Deniz Erol 1.243-P Derbent, M. 1.122-P Dessouki, N. 1.52-P Dettori, T. 7.102-P Deviren, A. 1.168-P, 1.179-P, 1.182-P, 1.189-P., 13.3-P D’Hooghde, T. M. 10.2-O, 10.10-P Diaconu, C. 7.83-P Diaz, P. A. 7.50-P Diaz-Recasens, J. 9.2-P Dibskaya, Ye. 3.2-P Dibskiy, S. 3.2-P Diego Alvarez, D. 1.1-O, 1.72-P, 9.2-P Dimitriadou, E. 1.138-P, 1.141-P, Dincol Guncag 7.67-P, 7.72-P, 7.73-P, 7.88-P7.92-P, Dirmenci, T. 15.4-P Divane, A. 7.1-P Dixon, C. 6.1-P Diz-Kucukkaya Reyhan 7.73-P Dobyns, W. B. 7-L Doco-Fenzy, M. 6.1-O Dodurga, Y. 7.16-P Dogan Hasan 3.20-P Doganis, D. 7.1-P Doglioni, C. 7.96-P Dolatkhah, H. 7.4-P Dolek, B. 12.32-P Domanic, N. 1.171-P Domingo, A. 7.53-P Dominguez, M. C. 1.117-P Dominguez Monpell, R. 3.5-P Dominis, M. 7.62-P Doneray, H. 1.137-P Donmez Altuntas, H. 2.3-P Donoghue, J. 1.16-P Doria 1.131-P Doria S. 1.132-P Doshi A. 10.1-O Douet-Guilbert, N. 4.3-P, 7.15-P, 7.39-P, 7.45-P, Doummar, D. 1.161-P Dovey, O. 14.22-P Dragomir, L. 7.83-P Dreyfus, F. 7.34-P Drosos, G. 7.23-P Drouin 7.113-P Drouin, R. 12.30-P Drozniewska. 1.155-P Drunat, S. 1.245-P, 5.1-O, Duarte, G. 1.120-P Duarte, J. J. 7.109-P Dubourg, C. 1.36-P Ducos, A. 4.4-P, 4.5-P, Dudkina, V. 1.194-P Dufke, A. 1-S, 9.1-P,
Duman Nilgun 7.89-P Duman 7.88-P Duno, M. 14.9-P Dupont, C. 1.161-P Dupont, J. M. 1.54-P, 1.70-P, 1.160-P, 1.161-P, Duraes, I. 1.187-P Durak, B. 1.163-P, 1.164-P, 3.16-P, 5.7-P, 12.17-P Duran, A. 7.25-P, 15.4-P, 15.5-P Duran, H. 1.249-P Duszenko, E. 1.155-P, 7.77-P Duta-Cornescu, G. 13.1-P Dutta 2.9-P Duzcan, F. 1.158-P, 7.16-P Duzcan Fusun 1.238-P Duzcan, S. E. 7.16-P Dvorackova, J. 7.44-P Dyer, M. J. S. 7.2-O Dyomina, E. 3.4-P Echevarria. 1.130-P Edery, P. 1.84-P Edwards, P. A. W. 7.3-O Eed, M. 1.99-P Eggermann, T. 1.102-P Eghbali, A. 7.60-P Egmund-Petersen, M. 12.1-O Egriboz 1.202-P Ehresmann, T. 1.17-P Eichler, Evan, E. 2.1-O Ekici, F. 1.247-P El Badawi Baher 12.29-P El Gerzawy, A. 1.99-P El Kamel Lebbi, I. 1.220-P EL Omri, H. 7.107-P El Rub, My. 1.1-P Elboim, L. 7.2-P Eleveld, M. J. 9.1-O Elghezal, H. 1.45-P, 1.47-P, 1.210-P Elhan, A. H. 1.244-P Elion, J. 5.1-O Elliott, A. 7.4-O, 7.108-P Emanuel, B. S. 1.124-P Enders, H. 1-S Engiz, O. 1.89-P Engr, A. 1.4-O, 10.3-P, 12.26-P en-Nouhi, G. 1.200-P Enriquez 7.110-P Enriquez, M. L. D. 7.111-P Entezami, M. 12.8-P Ercal, D. 3.19-P Ercelen 10.13-P Ercelen, N. 1.152-P, 1.153-P Erdal Ince 1.20-P Erdal, M. E. 1.91-P Erdel, M. 1.219-P, 1.221-P Erdem, O. 2.3-P Erdinc Yuksel 7.75-P, 7.76-P,
6th ECC: Author Index
282 Erdog˘an, K. M. 1.176-P ¨ . 1.213-P Erdog˘an Mu¨jgan, O Eren, S. 1.182-P Ergul, E. 1.62-P Ergun, M. 1.97-P Ergun, M. A. 1.32-P, 1.76-P, 1.98-P Ergun Sertan 7.88-P Erjavec Skerget, A. 7.3-P Erkal. 7.89-P Erkal, H. 1.144-P, 7.116-P, Erkal, O. 1.98-P Erkan, Levent. 10.13-P Erkanli, S. 1.123-P Ermis, H. 12.25-P, 12.26-P Erog˘lu, S. 12.32-P Ertan Ay 7.75-P Ertl-Wagner, B. 1.26-P Escabias, T. 1.100-P Esclaire 1.230-P Eser 1.215-P Eser, B. 1.31-P Eser Betu¨l 1.213-P Esmaeili Nieh, S. E. 9.7-P Espi, L. 12.9-P Espinet, B. 7.32-P, 7.51-P, 7.53-P, 7.61-P, 7.64-P, Espinosa, A. 7.50-P, 7.94-P, Estivill, X. 13.4-P Estrach, T. 7.61-P Etlik, O. 1.202-P Eustache 1.160-P Evans, M. 29-L Evke, E. 1.56-P, 1.61-P, 1.62-P, 1.71-P Exeler, J. R. 1.162-P Faa, G. 7.102-P Faas, B. 12.1-O Fabijanic, I. 7.62-P Faed, M. J. W. 4.1-O Faedda, A. 1.49-P Fahri Sahin 7.75-P Faik, H. 1.99-P Fakir, M. 1.140-P Fanelli, M. 3.10-P Faravelli, F. 1.156-P Farcas, S. 1.18-P, 1.115-P Farre´, M. 1.100-P Fassas, A. 7.11-P Fauth, C. 1.221-P Fay, S. 10.12-P Fazzi, E. 37-L Federico, C. 32-L Fedorova, I. 1.194-P Fejgin, M. 7.5-P Feliu, E. 1.34-P, 7.55-P, Fenzy-Doco, M. 14.8-P Ferda Percin, E. 1.32-P Fernandes, G. 1.187-P Fernandes, S. 1.131-P, 1.132-P
Fernandez, A. 12.9-P Fernandez, B. 14.10-P Ferna´ndez, C. 1.233-P, 1.234-P, Ferna´ndez, E. 10.1-P Ferna´ndez, L. 1.118-P Ferra˜o, J. 1.96-P Ferreira, B. 7.1-O, 7.61-P Ferrer, A. 7.64-P Ferrero, G. B. 37-L Ferreti, R. 12.3-P Ferro, J. 1.118-P Ferro, M. T. 3.17-P, 7.79-P, 7.109-P, 12.18-P, 12.20-P, Feuth, T. 12.1-O Fichera, M. 37-L Fidanboy, M. 1.248-P Fiegler, H. 29-L, 12.12-P Filip, V. 5.5-P Filkova, H. 7.41-P Finelli, P. 1.119-P, 1.135-P, 12.22-P Fiorentino, F. 10.3-O, 10.6-P, 10.15-P Fiori Sanso`, S. 7.48-P Firescu, R. 7.104-P Firouzabadi, G. 1.140-P Fischetto, R. 37-L Fistik Tevhide 1.213-P Fitzpatrick, D. 14.23-P Flandrin, P. 7.12-P Florensa, L. 7.53-P, 7.64-P, Florentin, L. 1.8-P Florina, N. 1.173-P Floris 7.112-P Floris, A. 1.224-P Floropoulou, G. 7.23-P Fojkar, M. 1.232-P Fortin, D. 7.113-P Fragouli, E. 4.1-O Frau 7.102-P Freedman, J. 3.1-O Fresser, F. 1.221-P Freund, M. 14.14-P Friberger, A. 7.2-P Frijns, J. P. 1.2-O, 10.10-P Frikha, R. 1.206-P Froyen, G. 9.4-P Fryns, J. P. 10.2-O Fryns, J. P. 4-L Furau, G. 1.106-P Furtado, J. 1.120-P Fuster, C. 1.33-P, 1.38-P, 1.50-P, 5.4-P, 12.1-P Gabau, E. 1.117-P, 13.4-P Gavrila, L. 7.9-P Gacina, L. 1.231-P, 1.232-P Gadji 12.30-P Gadji, M. 7.113-P Gadjos, V. 1.216-P Gaillard, D. 14.8-P
Gaitatzi, M. 7.11-P Gajdulewicz, M. 1.6-P, 1.9-P, Gala, J-L. 7.101-P Galkina, V. 1.23-P Gallardo, F. 7.61-P Gallardo, F. L. 1.1-O Gambini, C. 7.81-P Gamerdinger, U. 1.102-P Gandoura, N. 1.54-P Ganly, P. 14.21-P Garcı´a. 1.130-P Garcia Calde´s, M. 9-L Garcı´a Miguel, P. 7.79-P Garcı´a-Barcina 1.130-P Garcia-Galloway, E. 12.18-P, 12.20-P, Garcı´a-Muret, M. P. 7.61-P Garcia-Orad Carle´s, A. 13.2-P Garcı´a-Peiro´, A. 4.6-P, 4.7-P, Garcia-Sagredo, J. M. 3.17-P, 7.79-P, 12.18-P, 12.20-P Gargouri, B. 1.208-P Garijo 1.130-P Garnier Bonnet, A. 4.5-P Garre`, M. L. 7.81-P Garrido, C. 1.100-P Garshasbi, M. 9.7-P Gaspar, I. 1.185-P Gaucherand, P. 1.84-P Gavrila, L. 4.2-P, 7.13-P, Gedik, A. 1.236-P Gelabert, A. 7.93-P Gembruch, U. 1.102-P Genesca`, A. 3.11-P, 3.13-P, Genuardi, M. 14.15-P, 5.2-O, Gerard, M. 1.245-P Gerssen-Schoorl, K. 1.19-P Gervasini, C. 14.20-P Gervasini 1.156-P Ghanbari, A. 13.1-O, 13.7-P Ghasemi Firouzabadi, S. 7.70-P, 9.7-P, Giardino, D. 1.119-P, 1.135-P, 12.22-P Giglio 14.15-P Giglio, S. 5.2-O Gijsbers, A. 1.134-P Gil Bellosta, C. 7.65-P Gil, L. 1.30-P Gillerot, Y. 14.14-P Gimelli, S. 37-L Ginevra, G. 3.10-P Giovanna Floridia 6.1-O Giovannotti, M. 2.4-P Giovannucci-Uzielli, M. L. 1.156-P Giraldo, J. 1.50-P Giray, O. 3.19-P Gisselsson, D. 7.117-P Giuliani, C. 12.21-P Giulotto, E. 2.1-P Giunti, L. 5.2-O Godet, J-M. 10.12-P
6th ECC: Author Index Gogniat, C. 7.84-P Gokce, G. 7.115-P Go¨kc¸en 1.188-P Go¨kc¸en, A. 1.192-P Goldberg-Bittman, l. 7.5-P Gollin, S. M. 8-L Gomes, F. 7.95-P Go´mez. 1.130-P Go´mez, C. 7.49-P Go´mez-Pastrana, C. 1.30-P Gomy, I. 4.8-P Gonzalez de La Vega, A. 12.18-P Gonzalez, S. 1.172-P Gonza´lez-Huix, J. A. 1.28-P Gonza´lez-Meneses, A. 5.4-P Gonza´lez-Neira, A. 7.1-O Gorbachevskaya, N. 1.12-P Gorduza, V. 1.78-P, 1.116-P, Gorovenko, N. G. 1.147-P Gourgouveli, E. 6.5-P Govea Callizo, C. 1.205-P Goze, O. F. 7.115-P Gozukirmizi, N. 15.1-P Gramescu, M. 1.116-P, 1.78-P Granada 7.109-P Granada, I. 1.34-P, 7.53-P, 7.55-P Granell, M. 7.56-P Grati, F. R. 7.98-P Grau, J. 1.34-P, 7.55-P, Greslikova, H. 7.41-P Gribble, S. M. 9.6-P Grigoriadou, M. 1.87-P Grigorieva, S. A. 3.18-P, 3.22-P, Grimoldi, M. G. 7.48-P Gross 1.214-P Grugni, G. 1.119-P Grygien´czo-Raz´niewska, E. 1.157-P Guarducci, S. 14.15-P, 5.2-O, Guastadisegni, M. C. 7.96-P Gu¨c¸er, S¸. 1.111-P Guc-Scekic, M. 7.7-P Gucuyener, K. 1.97-P Gudzenko, S. 1.150-P Gue´ganic, N. 7.45-P Guerneri, S. 37-L Guesnu, M. 7.34-P Gug, C. 1.107-P, 7.104-P Guichet, A. 1.204-P Guille´n-Navarro, E. 1.33-P Guitart, M. 1.117-P, 4.6-P, 4.7-P, 13.4-P Gujral, S. 7.22-P Gu¨l Akyar Halide 1.177-P Gul, E. 7.115-P Gu¨l, Z. A. 1.125-P Gulbay, G. 1.57-P Gulec Ceylan, G. 1.243-P Gultekin, E. Y. 7.115-P Gulten, T. 1.56-P, 1.61-P, 1.62-P, 1.71-P, 7.47-P
283 Gultomruk, M. 1.152-P, 1.153-P, 10.13-P Gunduz 7.97-P Gunduz, E. 7.74-P, 7.97-P Gunduz, M. 7.74-P Guner, S. 1.39-P, 1.60-P, 1.122-P Guney, A. 1.104-P Guney Taser. 1.203-P Gur, A. 1.92-P, 1.104-P Guray Saydam 7.75-P Gu¨rsel, I. M. 1.182-P Gusma˜o, D. 4.8-P Gutierrez, A. 14.12-P Gutierrez-Serrano, M. 1.72-P Gutkowska, A. 1.6-P, 1.9-P, Guven, G. S. 1.168-P, 1.179-P, 1.182-P Gu¨ven, M. 1.171-P Gu¨ven, S. 1.171-P Gu¨zel, A. I. 1.53-P Gvimradze, K. 7.85-P, 7.103-P Gyftodimou, Y. 1.87-P Hacihanefioglu, S. 1.168-P, 1.171-P, 1.179-P, 1.182-P, 1.223-P, 5.8-P, 13.3-P Hacker, A. M. 1.124-P Hafizi, L. 7.58-P Hagen, A. 12.8-P Hagnefelt, B. 12.10-P Hajdinjak, T. 7.3-P Hajek, R. 7.41-P Haldun Oniz 7.76-P Hale Oren 7.76-P Hale S¸amlı 1.215-P Hallıog˘lu, O. 1.93-P Hamamah, S. 4.1-P Hamilton, S. J. 14-L Hammad, S. 1.99-P Hammoud, I. 4.11-P Hannechi, H. 1.45-P Hans 1.127-P Hansen, F. J. 14.9-P Hansmann, D. 1.102-P Hansmann, M. 1.102-P Hansson 1.134-P Haralambopoulou, A. 7.23-P Hardizi 1.200-P Harmas, V. 1.74-P Harper, J. C. 10.1-O Harrison, C. J. 7.2-O Has, R. 12.25-P, 12.26-P Hasan, A. 1.125-P Hassanein, N. 1.77-P Hastings, R. J. 6.1-O, 6.3-P Hatzikyriakou, R. 7.23-P Hatzipouliou, A. 1.8-P, 1.16-P Haus, O. 1.155-P, 7.77-P Haveric, A. 6.2-P Haveric, S. 6.2-P Havlovicova, M. 1.74-P Hazar, V. 7.99-P
Hehir-Kwa, J. 9.2-O Heilbronner, H. 9.1-P Heinimann, K. 6.6-P Heinrich, U. 1.26-P Heinrichs 1.127-P Hekimbasi, T. 15.7-P Heljic, S. 1.66-P Helmy, N. 1.1-P Helmy, N. A. 1.99-P Helszer, Z. 1.225-P Hellens, S. W. 9.6-P Hemmings, F. 12.30-P Hennig, C. 1.237-P Henriques, J. 1.187-P Hermosilla, M. 7.55-P Herna´ndez-Rivas, J. M. 7.109-P Herranz, R. 3.5-P Herrero, M. 12.7-P Herrero Moreno, M. 1.58-P Herrero, T. 1.34-P Herry, A. 7.39-P Heshmati, Y. 1.140-P Heslop-Harrison, J. S. 19-L, 20-L, 15.2-P, 15.8-P Heye, B. 1.162-P Hidar, S. 1.47-P, 1.210-P Higueras, T. 1.58-P Hinescu 7.83-P Hladikova, B. 1.11-P Hobson, G. M. 38-L Hochstenbach, R. 9.1-O Hoebeeck, J. 17-L Holzerova, M. 14.13-P, 7.40-P Hoovers, J. M. 1.81-P Horelli-Kuitunen, N. 1.242-P, 10.17-P Horst, J. 1.162-P Hosseinimehr, S. 2.5-P Housein, H. A. 1.99-P Houskova, L. 7.19-P Howarth, K. L. 7.3-O Howatson, A. 1.148-P Howell, R. 6.3-P Howell Rod 6.1-O Hrabal, P. 7.37-P Huber, J. 1.69-P Huh, J. 7.46-P Huijsdens, K. 1.41-P Hulten, M. 12.2-P Hurtado, N. S. 2.2-P Huseyin Yuce 1.243-P Hussein, H. 1.52-P Hussein, I. R. 1.77-P Hyden-Granskog, C. 10.17-P Iakovaki 6.5-P Iancu, D. 5.5-P Iannuzzi, L. 6-L Ianotto, J. C. 7.45-P Ibrahimoglu, L. 12.25-P
6th ECC: Author Index
284 Ibrulj, S. 1.66-P, 6.2-P Ievseienkova, O. G. 1.147-P Ikbal, M. 1.46-P Il’ina 1.129-P Il’ina, E. 1.150-P Ilgin-Ruhi 7.100-P Ilhan Yilmaz, S. 1.145-P Iliszko, M. 1.157-P Imamoglu, N. 2.3-P Impera, L. 7.96-P Imrie, S. 1.148-P Indrak, K. 7.40-P, 14.13-P Infantes, F. 1.72-P, 9.2-P Ingster, O. 1.204-P Ioannides, M. 9.5-P Iourov, I. 1.12-P, 1.13-P, 3.8-P, 3.9-P Isimbaldi, G. 7.54-P Isin, S. 1.92-P, 1.104-P Ismail, S. 1.77-P Iurlo, A. 7.48-P Ivanov, V. 1.3-P Izci Ay, O. 1.91-P Jacobs, S. 1-S Jacobsen, N. 20-L Jain, H. 7.22-P Jakiel, A. 1.191-P Jakiu niene˙, D. 7.8-P Jakobeit, M. 1.26-P Jaksic, B. 7.62-P Jalalyfar, H. 7.105-P Jallas, M. 12.9-P Jansen, P. 7.69-P Janssen, J. 12.1-O Jardim, A. 1.96-P Jarosova, M. 14.13-P Jarosova, M. 7.40-P, 7.68-P Jauch, A. 1.237-P Javaher-Haghighi, P. 12.31-P Jazbec, J. 7.66-P Jeftic, D. 7.7-P Jeggo, P. A. 7-L Jencikova, N. 1.24-P Jensen, E. 7.94-P Jewell, U. 14.21-P Jezela-Stanek, A. 1.6-P Jichova, J. 1.74-P Jime´nez, R. 12.3-P Jordana, J. 2.1-P Jotterand, M. 7.80-P, 7.84-P Jovanovic, P. 1.231-P Jovanovic, P. J. 1.232-P Joy 7.86-P Juraszek, A. 1.155-P Jurca, C. 5.5-P Kaabi, Y. 1.220-P Kabre, S. 7.22-P Kacem, O. 1.220-P
Kaczmarek, A. 15.6-P Kahraman, S. 1.79-P, 1.80-P, 1.92-P, 1.104-P, 1.181-P, 1.203-P, 10.3-O, 10.2-P, 10.4-P, 10.5-P, 10.6-P, 10.7-P, 10.8-P, 10.11-P, 10.15-P, 10.16-P, 12.19-P Kahrizi, K. 1.140-P, 9.7-P Kalayoglu-Besisik Sevgi 7.67-P, 7.73-P Kalelioglu, H. I. 12.26-P Kalelioglu, I. 12.25-P Kalkan, R. 5.7-P Kaloutsi, V. 7.38-P Kałuz˙ewski, B. 1.226-P, 12.16-P, Kałuz˙ewski 1.225-P Kalle Simola 6.1-O Kamal, A. 1.77-P Kamel, A. K. 1.99-P Kamel, A. 1.52-P Kamel, I. El. 1.36-P Kan, D. 1.97-P Kan Derya 1.32-P Kanavakis, E. 9.5-P Kant, S. G. 1.134-P Kaplan, T. 7.2-P Kapovic, M. 1.14-P, 1.15-P Kara, N. 1.39-P, 1.60-P, Kara Nurten 1.21-P Karabulut, H. G. 7.100-P Karaca, E. 13.3-P Karaca 1.189-P Karadayi, H. 1.79-P, 1.80-P, 1.92-P, 1.181-P, 1.203-P, 10.3-O, 12.19-P Karadayi 10.15-P Karadogan, I. 7.99-P Karaer, K. 1.76-P, 1.97-P Karagozoglu, H. 1.104-P, 10.5-P Karaguzel, A. 1.217-P Karaman, B. 1.4-O, 1.63-P, 1.64-P, 1.65-P, 1.67-P, 1.90-P, 1.143-P, 1.144-P, 1.165-P, 1.167-P, 1.174-P, 1.190-P, 1.192-P, 7.116-P, 10.3-P, 12.25-P, 12.26-P, 13.1-O, 13.7-P Karaman Birsen 1.238-P Karampela, M. 12.10-P Karapanou, S. 12.10-P Karatas, G. 12.32-P Karayel, M. 1.247-P Karayianni, V. 12.10-P Kardum, I. 7.62-P Kareemy Samaneh 14.18-P Kariminejad, A. 7.60-P Kariminejad, M. H. 7.57-P, 7.58-P, 7.59-P, 7.60-P Karimi-Nejad, R. 7.57-P, 7.759-P Karimloo, M. 7.70-P Karkakaletsi, M. 1.8-P, 1.16-P Karkucak, M. 1.61-P, 1.62-P, 7.47-P Karlikaya, G. 10.3-O, 10.4-P, 10.6-P, 10.11P, 10.15-P, 10.16-P Karsten Held 6.1-O
Karymee 12.24-P Karymee, S. 12.23-P, 14.17-P Kasljevic, E. 1.134-P Kater-Baats, E. 12.1-O Katosova, L. D. 3.18-P, 3.22-P Kavak, Z. N. 1.105-P Kavalar, R. 7.3-P Kavcic, H. 7.66-P Kavecan, I. 1.231-P Kavecan. 1.232-P Kaya 1.126-P Kaya, O. 1.101-P Kaygusuzoglu, E. 1.57-P Kaymak, A. 1.98-P Kaynak, H. 1.101-P Kayserili, H. 1.63-P, 1.64-P, 1.65-P, 1.67-P, 1.90-P, 1.143-P, 1.165-P, 1.167-P, 1.174-P, 1.238-P, 12.15-P, 13.1-O, 13.7-P Kazamia, K. 12.10-P Kazmina, N. 1.7-P Keles, S. 1.228-P Kelten, E. C. 7.16-P Kendirli, T. 1.20-P Kennerknecht, I. 1.162-P Keresteci Emir 1.180-P Keromnes, G. 4.3-P Keser, I. 1.113-P, 1.184-P Kesim, B. 12.32-P Keyhani, E. 7.70-P Keyhani, M. 7.105-P Khaleghian, M. 12.23-P, 12.24-P, 14.17-P Khaleghian 7.105-P Khelif, A. 7.107-P Khurs 1.201-P Khurs, O. 1.108-P Kidron, D. 7.2-P Kieback 1.237-P Kilani, O. 1.220-P Kilic 1.153-P Kilic, G. 1.152-P Kilpatrick, M. W. 12.30-P Kim, M. 1.43-P Kim, M. Y. 12.28-P Kirchhoff, M. 14.9-P Kirgiz, M. 1.4-O, 10.3-P Kirmizi, N. 1.63-P, 1.64-P, 1.65-P, 1.143-P, 1.167-P, 12.25-P Kisner, K. 7.3-P Kitisiou-Tzeli, S. 9.5-P Kitsiou, S. 1.8-P Kivanc, C. 1.128-P Kleefstra, T. 1-S Klehr-Martinelli, M. 10.9-P Kleinfinger, P. 5.1-P Klopocki, E. 12.8-P Knegt, A. C. 1.41-P Knoll, U. 12.8-P Kno¨pfle, G. 1.102-P Koc, A. 1.32-P, 1.76-P, 1.97-P, 1.98-P
6th ECC: Author Index Kocak, I. 1.21-P, 1.22-P, 1.39-P Kocaoglu Guclu, B. 2.3-P Kocarek, E. 1.74-P Kocbas, A. 1.64-P, 1.174-P, Kodet, R. 7.68-P Kokalj Vokac, N. 7.3-P Koken, G. N. 1.31-P Koken, R. 1.31-P Kokkinou, S. 7.23-P Koksal, V. 1.202-P Kolaitis, G. 1.87-P Kolialexi, A. 9.5-P Kolomietz 14.16-P Kolotii, A. 1.12-P, 3.8-P, 3.9-P Konialis, C. 12.10-P Koolen, D. 9.2-O Kooper, A. 12.1-O Kooy, F. 12-L Konstantinou, M. 12.16-P Korac, P. 7.62-P Koronioti, K. 7.1-P Korucuoglu Umit 1.32-P Kose, G. 3.19-P Koshkarova, K. 7.42-P Kosmaidou, Z. 9.5-P Kosmidis, H. 7.1-P Kosyakova, N. 1.2-O, 1.94-P Kosyakova, N. V. 3.18-P, 3.22-P Kosztola´nyi, G. 27-L Kotsianidis, I. 7.38-P Kotzot, D. 1.221-P Koubi, V. 5.1-P Kourousis, C. H. 7.10-P Kousoulidou, L. 9.4-P Kozler, P. 7.37-P Kozlowska, J. 1.191-P Krabchi, K. 12.30-P Krajewska-Walasek, M. 1.6-P, 1.9-P Kramar, F. 7.37-P Kraoua, L. 1.54-P, 1.82-P Krasovskaja, N. 1.51-P Kravetz, V. 1.12-P, 3.8-P, Krejci, M. 7.41-P Kristoffersson, U. 13-L Kroes 7.69-P Kron 1.214-P Kronberger, G. 1.5-P, 1.10-P Krskova, A. 1.11-P Krstic, A. D. 7.7-P Krstic, A. 1.231-P, 1.232-P Kucerova, L. 14.13-P Kucˇinskas, V. 1.51-P, 1.55-P, 1.75-P Kuglik, P. 7.41-P Kulak, V. 1.35-P, 1.201-P Kulikowski, L. D. 1.124-P Kupesiz, A. 7.99-P Kurilo, L. 1.133-P, 1.150-P Kurinnaya, O. 1.12-P Kurt, H. 1.182-P
285 Lefebvre, G. 14.22-P Lefort, G. 1.48-P, 4.1-P Legius, E. 10.10-P Leibovitch, I. 7.2-P Leita˜o, A. 2.6-P Lelorc’h, M. 1.82-P Lemos, F. 1.132-P Lemos, R. 1.187-P Leroy, C. 14.8-P Levina, L. 1.3-P Levy, E. R. 6.1-P Lew, S. 7.2-P Li, J. 14.11-P Labrune, P. 1.216-P, 12.14-P Licheri, V. 1.224-P Lacaze, S. 4.4-P Licheri 7.112-P Lacin, S. 10.11-P Liehr, T. 1.2-O, 1.2-P, 1.13-P, 1.38-P, 1.89-P, Lakoma, I. 7.40-P 1.94-P, 1.108-P, 1.111-P, 1.237-P, 3.8-P, Laczmanska, I. 1.191-P 3.9-P, 4.1-P Lagonotte, E. 14.8-P Lim, D. 9.10-P Lai, M. L. 7.102-P Lima 1.132-P Lakhal, B. 1.47-P Lima, V. 1.131-P Lalatta, F. 37-L Liman, B. C. 2.3-P Lale Satiroglu-Tufan, N. 1.238-P Lindou, A. 7.23-P Laleli, Y. 1.228-P Lissitsina, J. 1.211-P Laleli, Z. 12.32-P Lissoni, S. 1.103-P, 7.54-P Laleli. 1.227-P Ljubic, A. 1.149-P Lalou, I. 1.138-P, 1.141-P Lo Cunsolo, C. 7.96-P Lamb, C. 9.11-P Lo Curto, F. 7.17-P Lambert, J. C. 5.11-P Locatelli, F. 7.33-P Landais, E. 14.8-P Lohmann, L. 1.73-P Landeras, J. 1.118-P, 10.14-P Lombroso, R. 4.11-P Landowski, J. 12.8-P Lonoce, A. 7.96-P Langlois, M. L. 4.3-P Look, T. A. 14.12-P Largo, C. 7.1-O Larizza, L. 11.119-P, 135-P, 1.156-P, 3.2-O, Lopes, M. C. 7.95-P Lopez, I. 1.33-P 12.22-P, 14.20-P Lo´pez-Ga´lvez, J. J. 1.30-P Laroudie, M. 12.14-P Lorda-Sanchez, I. 1.1-O, 1.72-P, 9.2-P Lasan Trcic, R. 7.62-P, 12.6-P Lourie, R. 7.71-P Lauc, G. 12.11-P Lovreglio, P. 3.10-P Lauda-Swieciak, A. 1.155-P Lowe 7.108-P Laureano, L. A. F. 1.69-P, 4.8-P Lowther, G. 1.148-P Laureys, G. 17-L Luleci, G. 1.113-P, 1.184-P, 1.186-P, 1.246-P, Laver, S. 10.1-O 7.99-P Lavoura, N. 1.94-P Lungeanu, A. 7.83-P, 7.87-P, 1.173-P, 7.82-P Lazaridou, A. 7.6-P, 7.10-P Le Bris, M. J. 4.3-P, 7.15-P, 7.39-P, 7.45-P Lupski, J. R. 1.5-O, 14.10-P Lupu, A. 7.83-P Le Caignec, C. 25-L, 1.230-P, 10.2-O Lloret, M. 1.30-P Le Cornec, G. 7.86-P Lloreta, J. 7.93-P Le Du, N. 1.245-P Lloveras, E. 1.58-P, 12.1-P, 12.7-P Le Tessier 1.160-P Lebbar 1.160-P, 1.161-P Maaloufova, J. 7.18-P Lebbar, A. 1.54-P Maazoul, F. 1.54-P, 1.82-P Leclercq 1.160-P Mabboux, P. 10.12-P, 1.216-P Lederer, D. 14.14-P MacKinnon, R. N. 7.14-P Lee, B. 1.43-P Madrigal, I. 1.117-P, 5.3-P, 5.4-P Lee, B. Y. 12.28-P Madureira, C. 1.131-P, 1.132-P Lee, C. 9.9-P, 14.12-P Maegawa, G. H. B. 9.8-P Lee, M. 1.43-P Magini, P. 37-L Lee, M. H. 12.28-P Magnani, E. 2.1-P Lee, Y. 1.43-P Kurtul 1.166-P Kuru, D. 1.168-P, 1.179-P, 1.182-P, 1.223-P, 13.3-P Kuskucu, M. 1.179-P, 5.8-P Kus¸kucu 5.8-P Kutlu, P. 10.2-P Kutlu, U. 10.2-P, 10.4-P, 10.5-P, 10.7-P, 10.8-P Kutsev, S. 3.9-P Kuuse, K. 1.88-P Kuznetzova, T. 1.194-P
6th ECC: Author Index
286 Magnani, I. 3.2-O Maher, E. 24-L, 14.23-P Maher, E. J. 6.1-P Mahjoubi, F. 1.195-P, 1.196-P, 1.197-P, 1.198-P, 1.199-P, 2.7-P, 7.105-P, 12.23-P, 12.24-P, 14.17-P, 14.18-P Mahmoodi, H. 7.60-P Mahmoudzadeh, A. 2.5-P Mahmutyazicioglu, K. 1.223-P Maillo, A. 7.50-P, 7.65-P, 7.94-P Ma¨kinen, S. 10.17-P Makowska, I. 1.191-P Malgara, R. 7.48-P Malheiro, I. 2.6-P Malikova, M. 1.74-P Malisˇ, J. 7.68-P Maloney, V. K. 1.153-P Maltby, E. 3.6-P Maludrottu, A. 1.224-P Malvestiti, F. 1.119-P Manal F Ismail 7.78-P Mandron, I. 1.129-P Mania, A. 10.1-O Manisali, E. 1.16-P Manolakos, E. 1.159-P Manor, E. 7.20-P, 7.24-P Manouchehri, F. 1.195-P, 1.196-P, 1.197-P, 1.198-P, 1.199-P Manoukian, S. 7.98-P Mansilla, E. 1.1-O Mantziou, T. 1.138-P Mantzouratou, A. 4.1-O, 10.1-O Maraschio, P. 37-L Marczak, A. 1.6-P, 1.9-P, Margarit, E. 1.193-P, 5.3-P Margaritis, D. 7.38-P Marijt, E. 7.69-P Marikova, T. 1.74-P Marion, V. 7.45-P Markaki, A. 12.10-P Markevych, N. 3.7-P Markova, E. 1.7-P Marlin, S. 1.36-P Marongiu 7.112-P Marongiu, A. 12.1-P Marongiu, R. 1.222-P Marques, B. 1.95-P, 1.120-P, 1.136-P Marta Rodriguez de Alba 6.1-O Martelli, L. 1.69-P, 4.8-P Martin, E. 13.2-P, 15.4-P, 15.5-P Martin, M. 13.2-P, 3.11-P, 3.13-P Martı´n Ramos, M. L. 7.109-P Martin, S. 12.7-P Martinez, J. M. 12.5-P Martı´nez, M. 1.118-P Martı´nez, M. C. 10.14-P Martı´nez-Ferna´ndez, M. L. 1.1-O Martı´nez-Frı´as, M. L. 1.1-O Martinoli, E. 1.209-P
Martins, J. 1.120-P Martorana 1.224-P, 7.112-P Martorana, L. 1.222-P Martorell Riera, M. 1.28-P Maruga´n, I. 7.109-P Mascarenhas, A. 1.96-P Maserati, E. 7.17-P, 7.33-P Massie, D. 5.6-P Mastalerz-Eckelsdorf, A. 1.225-P Mata, M. 1.117-P Matin-Far, S. 7.57-P, 7.59-P Matoso, E. 1.94-P, 1.95-P, 1.96-P Mattha¨i, A. 12.8-P Mattina, T. 37-L Matulevicˇiene˙, A. 1.51-P Mau-Holzmann, U. A. 9.1-P Maurin, M. L. 1.216-P, 10.12-P, 12.14-P Mavrou, A. 9.5-P Mavroudi, S. 7.10-P, 7.6-P Mazen, I. 1.52-P, 1.77-P Mazurczak, T. 14.11-P Mazurkiewicz, J. 14.16-P McCarthy, C. 1.29-P McConnell, C. 1.148-P McKenzie, J. 14.21-P McMullan, D. 9.10-P McMullan, D. J. 1-S, 9.11-P, Meddeb, M. 1.206-P, 1.208-P Medeira, A. 1.185-P Mediano, C. 12.9-P Mehdipour, P. 7.4-P Mekkawy, M. 1.77-P Melaragno, M. I. 1.124-P Melichercikova, J. 7.19-P Melo, J. B. 1.94-P, 1.95-P, Melotte, C. 1.2-O, 10.2-O, 10.10-P Me´ndez 10.14-P Mendez, B. 1.50-P, 12.3-P Mendes, C. 1.95-P Me´ndez, C. 1.118-P Mendilcioglu, I. 1.246-P Mendoza, J. 12.7-P Meneghelli, E. 37-L Meral Sakizli 7.76-P Meral-Gunes, A. 7.47-P Mercanton, N. 7.80-P Merelo, F. 3.5-P Merino, M. 7.50-P, 7.65-P, 7.94-P Messa, J. 37-L Mestres, M. 7.27-P Metaxotou, A. 1.159-P Michalova, K. 7.18-P, 7.19-P, 7.37-P Michels, E. 17-L Migheli, F. 3.14-P Migliore, L. 3.14-P Miguez Alvarez, L. 1.38-P Mihailov, D. 7.104-P Mihal, V. 7.40-P Mihci, E. 1.113-P, 1.184-P, 1.246-P
Mikelsaar 1.211-P, 13.5-P Mila`, M. 1.117-P, 5.4-P Milani, D. 14.20-P Milla´, F. 1.34-P, 7.55-P Miller, K. 12.31-P Miny 6.6-P Minz, M. 1.68-P, 1.70-P, 1.73-P, 10.12-P Mioara Matei 3.21-P Miozzo, M. 7.98-P Miraftabi, N. 7.58-P Mirante, A. 1.95-P Miro´, R. 6.4-P Miro 7.93-P Missirian, C. 5.10-P, 5.11-P Mitchell 5.6-P Mizrak, B. 1.4-P Mocanu, G. 7.87-P Mohamad, A. 15.2-P Mohamed, A. 1.52-P, 1.99-P Moiceanu, D. 7.9-P Mojtahedi, F. 1.140-P Mojtahedi 7.70-P Mokaddem, E. 4.11-P Molina, O. 1.114-P Molina Gomes, D. 4.11-P Mo¨lter-Va¨a¨r, T. 1.242-P Molla´, M. 10.14-P Monakchov, V. 3.8-P Moncla, A. 5.10-P, 5.11-P Montagnon, M. 5.1-P Montazeri, M. 2.7-P Moon, H. 7.46-P Moon, S. 14.21-P Moradkhani, K. 4.1-P Moraine, C. 9.4-P Morales, C. 1.193-P, 5.3-P, 12.5-P Mora´n, P. 2.2-P Morandi, F. 7.81-P Moreau, Y. 1.3-O Moreira, L. 1.131-P Morel, F. 4.3-P, 7.15-P, 7.39-P, 7.45-P Moreno, J. M. 1.30-P Moreno Laguna, S. 14.19-P, 5.9-P, 12.27-P Moreno, M. 3.5-P Morerio, C. 7.33-P Morris, C. 14.21-P Mortezapour, F. 1.196-P, 1.197-P, 1.199-P, 1.195-P, 1.198-P Morton, J. 9.10-P Mosesso, P. 3.12-P Moshtagh, A. 7.57-P, 7.58-P, 7.59-P, 7.60-P Motazacker, M. 9.7-P Motei, G. 5.2-P Motoc, R. 4.2-P Mottadelli, F. 1.156-P Motte, J. 14.8-P Mougou, S. 1.45-P, 1.210-P Mousavi, M. 2.5-P Mouzakiti, A. 7.10-P
6th ECC: Author Index Mrad, R. 1.54-P, 1.82-P Mrasek, K. 1.94-P, 1.108-P, 1.111-P, 4.1-P Mucha, B. 7.77-P Muehlematter, D. 7.84-P Mueller, D. 1.219-P Mueller 1.221-P Mu¨hlematter, D. 7.80-P Mul, A. N. 1.81-P Mu¨ller-Navia, J. 1.26-P, 1.162-P Munteanu, I. 1.115-P Murat Tombuloglu 7.75-P Murru, D. 1.49-P, 1.224-P Murru 1.222-P, 7.112-P Musio, A. 14.20-P Muslumanoglu, M. H. 5.7-P Muslumanoglu 12.17-P Mustac´, E. 1.15-P Mustafa Solak 1.215-P Mut Popescu, D. 7.83-P Mutevelli, N. 1.101-P Nadal, A. 12.5-P Nadal, I. 14.19-P Nadal, N. 7.12-P Naderi, M. 7.60-P Nagai, N. 7.74-P, 7.97-P Naganowska 15.6-P Nagatsuka, H. 7.74-P, 7.97-P Najmabadi, H. 1.140-P, 9.7-P Nakou, I. 1.138-P Nalcaci Meliha 7.72-P, 7.91-P Nanciu, Y. 5.2-P Nandini, A. 1.29-P Nanni, L. 14.15-P Narciso, C. 7.111-P Nardini, V. 12.21-P Nasiri, F. 1.195-P, 1.196-P, 1.197-P, 1.199-P Nassogne, M-C. 9.3-P Nathan, C. 1.73-P Natino, D. 7.110-P, 7.111-P Natividad, F. F. 7.110-P, 7.111-P Naumchik, I. 1.201-P Nava, P. 3.5-P Navali, N. 1.83-P Navarro, J. 4.6-P, 4.7-P, 4.10-P, 10.1-P Nayeb-Bagher, T. 7.57-P, 7.58-P, 7.59-P, 7.60-P Neagu, E. 5.2-P, 5.5-P Nedomova, V. 1.24-P Nelen, M. 9.1-O Neˇmec, P. 7.41-P Nergadze, G. 2.1-P Neri, G. 1.156-P Neroutsou 1.159-P Neuhaus 1.214-P Neumann 1.162-P Nicolae 2.8-P Nicola´s, M. 1.118-P Niculescu, A. M. 4.2-P
287 Nie, G. 9.8-P Nieselt, K. 9.1-P Nikitidou, A. 7.6-P, 7.10-P Nikitina, V. A. 3.22-P Nikitina 3.18-P Nilgun, D. 1.128-P Nillesen, W. 9.2-O Nisi Cerioni, P. 2.4-P Nobre, Y. T. D. A. 4.8-P Nogueira, S. I. 1.124-P Nomdedeu, B. 7.49-P Nordstro¨m, A.-M. 10.17-P Noris, P. 7.33-P Nor Zarina, Z. A. 1.240-P Nouchy, M. 5.1-P Nourozinia, M. 1.197-P Novak, Z. 7.40-P Novara, F. 37-L Novielli, C. 3.2-O Novotna, D. 1.74-P Nowakowska, B. 14.11-P Nozza, P. 7.81-P Ntouroupi, T. 4-S Nucaro, A. 1.49-P Nur Semerci, C. 1.238-P O’Driscoll, M. 7-L Obersztyn, E. 14.11-P Obradors, A. 10.1-P Obrenovic, M. 1.232-P Ocak, Z. 1.85-P, 1.86-P, 1.137-P, 1.139-P Ocak, Z. I. 1.44-P, 1.46-P Ochando, I. 1.30-P Ogu¨n Sercan, H. 7.76-P Ogur, G. 1.247-P Oikonomou Pagona 7.106-P Okten, G. 1.21-P, 1.22-P, 1.39-P, 1.60-P Old, R. W. 12.2-P Oliver-Benet, M. 10.1-P, 4.6-P, 4.7-P, 4.10-P Olmo, E. 2.4-P Olsfanger, S. 7.2-P Oltova´, A. 7.41-P Onaindia 1.130-P O’Neil, J. E. 14.12-P O’Neill, F. 7.108-P ¨ nen, A. 1.249-P O Oprisoni, A. 7.104-P Oral, D. 1.248-P, 1.249-P Ordoþez, E. 12.1-P, 12.7-P Orfao, A. 7.50-P, 7.65-P, 7.94-P, 7.95-P Ørgaard, M. 20-L Ormerod, E. 1.115-P Orru`, S. 1.222-P, 1.224-P Ørstavik, K. H. 3-L Ortega, M. 7.109-P Otlu, G. 1.57-P Ou, Z. 14.11-P Ouertani, I. 1.82-P Ounaies, N. 1.220-P
˜ unap, K. 1.88-P O ¨ z, E. 1.171-P O Ozalp Yuregir, O. 7.63-P, 12.13-P Ozcan Caliskan, M. 1.246-P ¨ zcan, K. 1.53-P O ¨ zcan Zeliha 1.177-P, 1.180-P O Ozcelik, T. 1.89-P ¨ zdamar, E. 1.169-P, 1.175-P, 1.180-P, O 1.183-P, 1.190-P ¨ zdamar 1.178-P O Ozdemir, M. 1.228-P, 5.7-P, 7.115-P Ozdemir 1.164-P, 1.235-P Ozden, A. 1.79-P, 1.80-P, 1.92-P, 1.104-P, 1.181-P, 1.203-P, 12.19-P Ozer, O. 1.121-P, 1.122-P, 1.123-P Ozkan, H. 22-L Ozkan, K. 1.4-O, 10.3-P Ozkan, S. 1.79-P, 1.80-P, 1.181-P Ozkutlu, Y. 1.228-P ¨ znur, M. 5.7-P O ¨ zon Hakan 1.170-P O Oztas, S. 1.37-P, 1.44-P, 1.46-P, 1.85-P, 1.86-P, 1.137-P, 1.139-P ¨ ztunc¸, F. 1.126-P, 1.178-P O ¨ ztu¨rk, H. 1.63-P, 1.67-P O ¨ ztu¨rk, S. 1.144-P, 7.116-P, 7.67-P, 7.72-P, O 7.73-P, 7.88-P, 7.89-P, 7.90-P, 7.91-P, 7.92-P Ozyilmaz, B. 1.247-P Pabst, B. 12.31-P Paetzold, U. 1.112-P Pais, A. 7.21-P, 7.22-P Pais, C. 1.94-P, 7.52-P Paiva, P. 1.96-P Pajkrt, E. 1.41-P Pala Elif 1.32-P Palandiz, S. 1.144-P Palanduz Ayse 7.90-P Palanduz, S. 7.67-P, 7.72-P, 7.73-P, 7.88-P, 7.89-P, 7.90-P, 7.91-P, 7.92-P, 7.116-P Palanova, M. 1.74-P Paliokosta, E. 1.87-P Pampalona, J. 3.11-P, 3.13-P Panagopoulos, I. 7.96-P Panarello, C. 7.33-P Pangalos, C. 12.10-P Pantelidou, D. 7.38-P Pantou, D. 6.5-P Papadopoulou, E. 9.5-P Papadoulis Nikolaos 7.106-P Papageorgiou, E. 12.12-P Papajik, T. 14.13-P Papanikolaou, K. 1.87-P Papiol, M. 5.3-P Parada, L. 13.2-P Parikh, P. 7.22-P Park 12.28-P Park, J. Y. 12.28-P
6th ECC: Author Index
288 Park, S. 1.43-P Parlier, V. 7.80-P, 7.84-P Pasalioglu, E. 1.182-P Pasantes, Luden˜a, J. 2.2-P Pasquali, F. 7.17-P, 7.33-P Patel, A. 1.5-O Patitucci, F. 7.17-P, 7.33-P, Patsalis, P. 9.4-P, 9.5-P, 12.12-P Pattyn, F. 17-L Pavan-Jukic, D. 12.11-P Pavlistova, L. 7.18-P Pavlou, K. 7.23-P Pedan, L. 3.2-P Pedro, C. 7.64-P Pehlivan Davut 7.88-P Pehlivan 12.15-P Peissel, B. 7.98-P Pekova, H. 1.24-P Peltecu, G. 1.173-P Pellestor, F. 10-L, 3.9-P, 4.1-P Pendina, A. 1.194-P Pepe, G. 3.12-P Percin, E. F. 1.76-P, 1.97-P, 1.98-P Perdeci Oktay 7.67-P, 7.88-P Pereira, A. 1.187-P Pereira, S. 1.131-P, 1.132-P Pe´rez, C. 6.4-P Perez Granero 1.205-P Pe´rez Iribarne, M. 7.32-P Perez Sastre, J. M. 3.5-P Pe´rez-Garcı´a, C. 2.2-P Pe´rez-Juana, A. 5.9-P, 12.27-P, 14.19-P Pe´rez-Vila, E. 7.64-P Perim Onal, E. 1.152-P, 1.153-P Perrin, A. 4.3-P Pessagno 1.156-P Pestereli, E. 1.246-P Peters, M. 1.242-P Petersen, M. B. 1.87-P Petit, F. 12.14-P Petkovic, I. 1.25-P, 1.27-P Petrova, L. 1.194-P Petrovic, O. 1.15-P Petrovic 1.149-P Pezzolo, A. 7.81-P Pfundt, R. 9.2-O, 14.20-P Philip, N. 5.10-P, 5.11-P Piane, M. 3.12-P Picone, O. 12.14-P Pichon 1.127-P Piferrer, M. 1.233-P Pignone, D. 23-L Pilinskaya, M. 3.2-P Pinarli Ferda Alpaslan 1.22-P Pinho, M. J. 1.131-P Pinto, C. F. 1.185-P Pinto Leite, R. 7.52-P Pinto Leite. 1.136-P Pinto, M. 1.96-P
Pinton, A. 4.4-P, 4.5-P Piotrowski, K. 12.16-P Pires, M. 1.95-P Piskin Ozden 7.114-P Pistoia, V. 7.81-P Plachy, R. 14.13-P Plaja, A. 1.58-P, 6.4-P, 12.1-P, 12.7-P Plasilova, M. 6.6-P Platonova, V. I. 3.18-P, 3.22-P Plaza-Arranz, J. 1.72-P Ploos van Amstel, J. K. 9.1-O Płowas´, I. 1.225-P, 1.226-P Podgornik 7.66-P Pogliani, L. 1.209-P Polityko, A. 1.35-P, 1.108-P, 1.201-P Polo, M. 7.79-P Polstra, A. 1.81-P Polyakov, A. 1.129-P, 1.133-P, 1.150-P Pollan, M. 3.17-P Pongsavee, M. 3.1-P Ponsa`, M. 2.1-P Poolamets, O. 1.242-P Poot, M. 9.1-O Popa, C. 1.18-P, 1.59-P Popescu, G. 1.173-P Poplawski, N. 9.8-P Port Lis, M. 1.212-P Porter 7.80-P Porter S. 7.84-P Portnoı¨, M. F. 1.36-P Pospisilova, D. 7.40-P Pospisilova, H. 7.40-P, 7.68-P, 14.13-P Pour, L. 7.41-P Pourtsidis, A. 7.1-P Poveda, M. 1.30-P Prada, G. I. 3.21-P Pramparo, T. 37-L Prat, E. 7.93-P Prata, F. 1.187-P Pressato, B. 7.17-P, 7.33-P Previdere´, C. 37-L Prevot, S. 12.14-P Prieto, M. J. 3.5-P Prigmore, E. 9.6-P Probst, P. 1.219-P Puche-Mira, A. 1.33-P Puechberty, J. 1.48-P, 4.1-P Puiu 7.104-P Pujol, N. 7.93-P Pujol, R. 7.51-P Pujol, R. M. 7.61-P Punab, M. 1.211-P, 1.242-P Punzo´n, M. M. 12.3-P Pursley, A. 1.5-O, 14.10-P Puszyk, W. M. 12.2-P Quaraglela, A. 3.10-P Quellhorst-Pawley, B. 6.1-O, 6.3-P Queralt, R. 1.193-P
Radaelli, F. 7.48-P Radice, P. 7.98-P Radoicic Savic, G. 1.231-P Radu, G. L. 3.21-P Radu, I. 7.9-P, 7.13-P Rahmani, S. 7.4-P Rahmanovic, A. 6.2-P Rahnama, M. 1.195-P, 1.196-P, 1.197-P, 1.198-P, 1.199-P Raja Aimee, R. A. 1.240-P Raje, G. 7.21-P, 7.22-P Ramos, A. 1.100-P Ramos, C. 29-L, 1.72-P, 9.2-P Ramos, E. S. 1.69-P Ramos, F. 1.94-P Ramos-Arroyo, M. A. 5.9-P, 12.27-P, 14.19-P Ranieri, D. M. 10.1-O Ransdorfova, S. 7.18-P, 7.37-P Raskina, O. 21-L Raso, A. 7.81-P Rattenberry, E. 9.11-P Rattenberry, E. C. 1-S Ravoet, M. 7.101-P, 9.3-P, 14.14-P Raymond Letron, I. 4.5-P Razazian, F. 1.195-P, 1.196-P, 1.197-P, 1.198-P, 1.199-P Rebai, T. 1.206-P, 1.208-P Rebelo, C. C. 1.69-P Rebelo, O. 7.95-P Recalcati, M. P. 12.22-P Redaelli, S. 1.103-P Reena, M. Z. 1.240-P Regeffe, B. 7.12-P Reima, I. 10.17-P Reis, F. 1.132-P Rendeiro P. 1.185-P Rendeiro. 1.187-P Res¸it Ko¨ken 1.215-P Revazova IuA 3.18-P, 3.22-P Ribas, M. 7.25-P, 7.27-P, 7.28-P, 7.29-P, 7.30-P, 7.31-P Ribeiro, E. 1.136-P, 7.52-P Ribera, J. M. 7.109-P Ricca, I. 14.15-P Ricci, U. 14.15-P Rickman, L. 29-L Riegel, M. 37-L Riegel 1.154-P Riess, A. 1-S Riess, O. 1-S, 9.1-P Rifai 1.212-P Rigler, D. 29-L Rimon, A. 3.1-O Ripamonti, F. 7.48-P Rippard, K. 1.148-P Rittinger, O. 1.5-P, 1.10-P Rius, M. 10.1-P Riva, P. 1.209-P Riyat, S. K. 1.29-P
6th ECC: Author Index Robledo, M. 7.1-O Rocas, A. 1.28-P Rocchi, M. 34-L, 37-L, 2.1-O, 7.96-P Rodrigo, L. 10.14-P Rodriguez de Alba, M. 30-L, 1.72-P, 9.2-P Rodrı´guez, L. 1.1-O Rodrı´guez, M. 12.3-P Rodriguez, P. 7.28-P Rodrı´guez-Criado, G. 5.4-P Rodriguez-Revenga, L. 1.117-P Roland, B. 7.36-P Romano, C. 37-L Romero, R. 1.28-P Rona, R. 7.2-P Rootsi, S. 1.242-P Roovere, T. 1.242-P Ropers, H. 9.4-P Ropers, H. H. 9.7-P Rosales, C. 7.110-P, 7.111-P Rose, H. 14.9-P Rosell Andreu, J. 1.205-P Rossi, E. 28-L Rossi, S. 12.21-P Rossino, R. 1.49-P Rosti 1.143-P Roth, P. 1.84-P Rousseau, G. 12.14-P Rousseau, J. 5.1-O Roversi 14.20-P Roversi, G. 3.2-O Rozsnyai, K. 1.18-P Rubio, C. 10.14-P Rubio, M. J. 5.3-P Ruchet, M.-C. 7.80-P Rudez, J. 1.231-P, 1.232-P Rueda, J. 1.30-P Ruhi, H. I. 1.244-P Ruivenkamp, C. A. L. 1.134-P Ruiz Xiville´, N. 1.34-P, 7.55-P Rumyantseva, N. 1.35-P, 1.108-P, 1.201-P Russell, L. J. 7.2-O Russo, S. 14.20-P Rusu, C. 1.78-P, 1.116-P, 5.5-P Ryabchenko, N. 3.4-P Ryu, H. 1.43-P Ryu, H. M. 12.28-P Sa´, J. 1.96-P Saad, A. 1.45-P, 1.47-P, 1.210-P, 7.107-P Sabiniewicz, R. 1.157-P Sabouraud, P. 14.8-P Sabuncuoglu, Y. 1.79-P, 1.80-P, 1.104-P, 1.181-P, 1.92-P, 1.203-P, 12.19-P Sabyrbaeva, G. 7.42-P Saccone, S. 32-L Sadeghi, F. 7.100-P Sadik, N. 1.194-P Sag, S. 1.61-P, 1.62-P, 1.71-P Sagala, J. 12.9-P
289 Saglam, B. 7.100-P Saglam, Y. 1.79-P, 1.80-P, 1.92-P, 1.104-P, 1.181-P, 1.203-P, 10.11-P, 10.15-P, 10.16-P, 12.19-P Saglam 10.3-O Sahasrabudhe, R. 8-L Sahin, F. I. 1.121-P, 1.122-P, 1.123-P, 7.63-P, 12.13-P Sahinidou, F. 1.8-P Sahinoglu, Z. 1.229-P Sahoo, T. 1.5-O Saitis, I. 1.159-P Sala, E. 1.103-P, 7.54-P Sala, M. A. 12.5-P Salamourtzi, P. 7.6-P Salar, A. 7.53-P Salehi, A. 2.7-P Salgado, R. 7.51-P, 7.61-P, Salido, M. 7.32-P, 7.51-P, 7.53-P, 7.61-P Salido 7.64-P Saloum, R. 7.11-P Saltanatpour 14.17-P Salumets, A. 1.242-P, 10.17-P Samassekou, O. 12.30-P S¸amlı, H. 1.31-P, 1.213-P San Roma´n, C. 3.17-P, 7.79-P, 12.18-P, 12.20-P San, T. 15.7-P Sa´nchez, A. 1.193-P, 5.3-P, 12.5-P Sa´nchez, R. 1.30-P Sanchez-Duran, M. A. 12.9-P Sanchez-Hombre, M. C. 12.18-P Sandu, L. 5.2-P Sani, I. 14.15-P, 5.2-O Sanlaville, D. 1.84-P Santafe´, E. 1.34-P Santava, A. 1.11-P Santavy, J. 1.11-P Santos, L. 7.52-P Santos, M. 1.33-P, 1.38-P, 5.4-P Santos, M. R. 1.185-P Santos, S. A. 4.8-P Sanz 1.172-P Sarda, P. 1.48-P, 4.1-P Sarialioglu, F. 7.63-P Sarioglu, N. 12.8-P Sarli, V. 3.14-P Sarquella, J. 1.28-P Sarri, C. 1.87-P Sasiadek, M. 1.191-P Satiroglu Tufan, N. L. 7.16-P Saunders, W. S. 8-L Savaci, S. 1.4-P, 1.57-P Savas¸og˘lu, K. 1.93-P Sayar 1.229-P Sayar, C. 1.239-P, 1.241-P Sazci, A. 1.62-P Schell-Apacik, C. 1.26-P Schinzel, A. 1-L, 37-L, 1.4-O, 1.154-P
Schluth, C. 1.84-P Schmidtke, J. 12.31-P Schneider, A. 1.48-P, 14.8-P Schoenmakers, E. F. 14.20-P Schwanitz, G. 1.102-P Schwartz, M. 14.9-P Schwarzacher, T. 15.8-P Sefa Kizildag 7.76-P Segura, A. 1.30-P Seipel 1.214-P Seirati, F. 7.70-P Selicorni, A. 14.20-P Selva, J. 4.11-P Seminara, S. 14.15-P Semiz Serap 1.238-P Semiz 12.19-P Sen Turk, N. 7.16-P S¸enel, B. 1.163-P Sener, T. 12.17-P Sennana, H. 7.107-P Senocak, E. 1.42-P Serafim, S. 1.185-P Serakinci Nedime 7.72-P Serban, M. 7.104-P Sercan Zeynep 7.114-P Sercan 7.76-P Serebrennikova, O. 1.7-P Serero, S. 1.245-P Sere´s-Santamarı´a, A. 1.100-P Serhal, P. 4.1-O, 10.1-O Serkan Ocakci 7.75-P Serrano, S. 7.51-P, 7.53-P, 7.64-P Serrat, X. 1.28-P Sertyel, S. 10.2-P, 10.4-P, 10.5-P, 10.6-P, 10.7-P, 10.8-P, 10.11-P, 10.15-P, 10.16-P Servitje, O. 7.61-P Sesen, T. 1.247-P Seven, M. 1.168-P, 1.189-P, 13.3-P Sevinc Basak 7.67-P, 7.88-P Seyfettin Uludag 1.178-P Sezer, O. 1.247-P Sezgin 1.235-P Shalaata, A. 1.40-P Shams 2.7-P Sharifah, N. A. 1.240-P Sharkey, F. 24-L, 14.23-P Shaw, C. 1.5-O Shehab, M. I. 1.99-P Shemetun, O. 3.2-P Shilova, N. 1.3-P, 1.23-P, 1.133-P, 12.4-P Shohat, M. 3.1-O Sibille, C. 7.101-P, 9.3-P, 14.14-P Siciliano, G. 3.14-P Siebert, R. 7.2-O Sierra, B. 1.205-P Sifakis, S. 1.16-P Siffroi, J. P. 1.36-P Sikkema-Raddatz, B. 1.19-P Silan 1.223-P
6th ECC: Author Index
290 Silengo, M. 37-L Silva, M. 1.120-P Sima˜o, L. 1.120-P Simi 12.21-P Simo˜es, L. 1.95-P Simon-Gruita, A. 13.1-P Simsek, E. 1.122-P Simsek Orhon, Filiz 1.20-P S¸ims¸ek Solmaz 1.213-P Sinan Beksac, M. 1.218-P Sirchia, S. 7.98-P Sirenko, V. J. 1.147-P Sirmaci Asli 1.20-P Siskova, M. 7.18-P, 7.19-P Sismani, C. 9.5-P Sisterman, Es. 9.2-O Skonieczka, K. 1.155-P Skonieczka 7.77-P Skoumpla, K. 12.10-P Skrypnik, C. 5.2-P, 5.5-P Sliuzas, V. 1.75-P Slunga-Tallberg, A. 10.17-P Smeets, D. 9.2-O Smits, A. 12.1-O Smyk, M. 14.10-P, 14.11-P Sobek, A. Jr. 1.11-P Sobek, A. Sr. 1.11-P Sodowska, H. 1.157-P Sofikitis, N. 1.141-P Sola, M. 1.28-P Solak, M. 1.31-P Solak 1.213-P Sole´, F. 7.32-P, 7.51-P, 7.53-P, 7.61-P, 7.64-P, 7.109-P Sole-Ristol, F. 6.1-O Soleimani, S. 1.195-P, 1.196-P, 1.197-P, 1.199-P Soleo, L. 3.10-P Soler, A. 1.193-P, 5.3-P, 12.5-P Soler, D. 3.11-P, 3.13-P Solg˘un, H. A. 1.53-P Solodovnikova, D. V. 1.147-P Soloviev, I. 3.8-P, 3.9-P, Solsona, E. 1.233-P, 1.234-P Sommerhuber, A. 1.5-P Song, S. 7.35-P Sonmez, F. M. 1.217-P Soszynska, K. 1.155-P Sousa, A. 1.172-P, 1.185-P Sousa, A. B. 1.185-P Sousa, M. 1.131-P, 1.132-P Sousa, P. 7.50-P, 7.94-P, Souto, M. 7.52-P, 1.136-P Soylemez, F. 1.91-P, 1.93-P, Soylemez, M. A. 1.189-P, 1.202-P, 1.241-P So¨ylemez Zafer 1.213-P Specchia, G. 7.96-P Speleman, F. 17-L Splendiani, A. 2.4-P
Tallini, G. 7.102-P Tammur, P. 1.88-P Tandog˘an, B. 1.239-P Ta˜o, H. 7.95-P Tapia, S. 12.14-P Tapia 1.130-P Taralczak, M. 1.4-O Tarasenko, T. 1.232-P Tarhan, N. 1.241-P Tarik 3.20-P Tarim, E. 12.13-P Tarkan-Argu¨den, Y. 1.168-P, 1.179-P, 1.182-P Taruscio, D. 6.1-O Tashkandi, S. 10.1-O Tas¸temir, D. 1.53-P Tatar, A. 1.37-P, 1.44-P, 1.46-P, 1.85-P, 1.86-P, 1.137-P, 1.139-P Tavakol, T. 12.23-P, 14.17-P, Tavares, M. P. 1.185-P Tavares, P. 1.187-P Tchinda, J. 14.12-P Tekes¸, S. 1.236-P Tekesin, I. 9.1-P Tekin, M. 1.20-P Tekin, N. 5.7-P Teleanu, V. 7.9-P Telvi, L. 1.68-P, 1.70-P, 1.73-P, 1.101-P Temel, S. G. 1.56-P, 1.61-P Temtamy, S. 1.77-P Tenconi, R. 1.156-P Tepeli, E. 5.7-P, 12.17-P Tercanli, S. 6.6-P Terradas, M. 3.11-P, 3.13-P Terro, F. 1.230-P Teshima 9.8-P Tevhide Fistik 1.215-P Tezcan, G. 7.99-P Thienpont, B. 1.3-O Thomaidou, L. 1.159-P Thomas, L. 1.159-P Till, M. 1.84-P Timofeeva, I. 1.7-P Timuragaoglu, A. 7.99-P Togeh, G. 7.105-P Toksoy, G. 1.229-P, 1.239-P, 1.241-P, 12.26-P Toll, A. 7.51-P Tomescu, E. 5.2-P Tabano, S. 7.98-P Toncheva, D. 4.9-P Tabernero, M. D. 7.50-P, 7.94-P, 7.95-P Toni, S. 5.2-O Tabernero 7.65-P Toomik Peeter 13.5-P Tabet, A. C. 1.245-P Tootain, S. 1.198-P, 12.23-P, 12.24-P, Tacoy, S. 1.113-P, 1.184-P 14.17-P, 14.18-P Tachdjian, G. 1.216-P, 10.12-P, 12.14-P Trabelsi 1.208-P Tafas, T. 12.30-P Trak, B. 1.186-P Taghi Arzanian, M. 7.60-P Trujillo, C. 12.29-P Tajtlova, J. 7.19-P Trujillo-Tiebas, M. J. 9.2-P Talan, O. 3.2-P Talavera Yagu¨ez, M. 3.17-P, 7.79-P, 12.20-P Trullen, E. 1.34-P Trypsianis, G. 7.38-P Talmoudi, F. 1.220-P
Splitt, M. P. 9.6-P Spodar, K. 1.6-P Sprague L James 2.1-O Squire, J. A. 1.69-P Staessen, C. 26-L Stalder, M. 7.80-P Stamatopoulos, K. 7.11-P Stana, A. R. M. 1.173-P Stana, L. 7.104-P Stanciu, F. 13.1-P Stanemir, N. 5.2-P Stankiewicz, P. 33-L, 1.5-O, 14.10-P, 14.11-P Stappert, H. 9.1-P Starke, H. 1.2-O Stary´, J. 7.68-P Stavroyianni, N. 7.11-P Steinberger 1.214-P Steinlein, O. 1.17-P Stejskal, D. 1.24-P Stejskalova´ 7.68-P Stembalska 1.191-P Stephan, J. L. 7.12-P Sterba, J. 7.44-P Stevenson, D. 5.6-P Stipoljev, F. 12.6-P Stoian, M. 1.18-P, 1.59-P Stoian, V. 13.1-P Stoicanescu, D. 1.115-P Stojkovic, O. 7.7-P Storlazzi 7.96-P Stumm, M. 12.8-P Stylianidou, G. 9.5-P Suela, J. 7.1-O Sukru, O. 1.128-P Sukru, P. 1.128-P Sultan Cingoz 7.76-P Susca, F. 3.10-P Sustercic, D. 7.62-P Suvarna, K. 3.6-P Svetlakov, A. 1.7-P Svyatova, G. 7.42-P, 7.43-P Swistek Wojciech 7.77-P Syrrou, M. 1.138-P, 1.141-P Sznajer 1.127-P Szuhai, K. 14.13-P
6th ECC: Author Index Tsanaclis, A. M. 7.113-P Tsatalas, C. 7.38-P Tsezou Aspasia 7.106-P Tsiantis, J. 1.87-P Tsipouras, P. 12.30-P Tsoplou, P. 1.159-P Tsoumani-Chroni, A. 1.141-P Tsvetkova, T. 1.23-P, 1.129-P, 1.150-P Tuduce, I. 1.107-P Tuduce, R. 13.1-P Tug, E. 1.42-P Tukun, A. 1.244-P, 7.100-P Tuna, M. 15.8-P Tunc¸, E. 1.53-P Tuncali, T. 7.100-P Tunc¸bilek, E. 1.109-P, 1.110-P, 1.111-P, 1.142-P, 1.151-P, 1.166-P, 1.176-P, 3.15-P Tural, S. 1.22-P, 1.39-P, 1.238-P Turci, A. 37-L Turcu Elena 3.21-P Turk Inanc¸, A. 1.175-P Tu¨rko¨ver, B. 1.229-P, 1.239-P, 1.241-P Tusell, L. 3.11-P, 3.13-P Tuset, E. 7.32-P Tutar Emel 10.13-P Tuuri, T. 10.17-P Tu¨ysu¨z, B. 1.101-P, 1.105-P, 1.126-P, 1.169-P, 1.170-P, 1.175-P, 1.177-P, 1.178-P, 1.180-P, 1.183-P, 1.190-P Tuysuz eyhan, B. 1.238-P Tweddle, D. 7.4-O Tzanidakis, K. 7.23-P Tzoufi, M. 1.138-P Ucur Ali 7.72-P, 7.67-P, 7.73-P, 7.89-P, 7.90-P, 7.91-P, 7.92-P, 7.116-P Ufuk Yanar 1.178-P Ulgenalp, A. 3.19-P Ulucay, B. 1.202-P Uludogan, M. 1.239-P, 1.241-P Ulutin Turgut 1.171-P Umay, B. 1.79-P, 1.80-P, 1.92-P, 1.203-P, 10.3-O, 10.15-P, 12.19-P Umay 1.181-P ¨ nal Fatma 15.5-P U Unal, S. 10.2-P, 10.6-P, 10.4-P, 10.5-P, 10.7-P, 10.8-P, 10.11-P Undar, L. 7.99-P Urbanovska, I. 7.44-P Urman Bulent 10.13-P Usurelu, D. 7.13-P Usurelu, M. 7.9-P Utermann, G. 1.221-P, 1.219-P Utine, E. 1.109-P, 1.110-P, 1.111-P, 1.166-P Utine, G. E. 1.142-P, 1.151-P, 1.176-P, 3.15-P Uvirova, M. 7.44-P Uyanik, F. 2.3-P
291 Uyguner, O. 1.64-P, 13.1-O Uyguner, Z. O. 13.7-P Uz, E. 1.89-P Uzkeser Mustafa 3.20-P Uzumcu, A. 1.64-P, 13.1-O, 13.7-P Valera, A. 1.34-P, 7.49-, 7.56-P Valiente Martin, A. 5.9-P, 12.27-P Valtorta, C. 1.119-P, 1.135-P, 12.22-P Valtorta, E. 12.22-P Valverde 1.130-P Valldeperas, A. 12.3-P Vallecillos, M. A. 1.193-P Vallespin, E. 9.2-P Valli, R. 7.17-P, 7.33-P Vall-Llovera, F. 7.55-P Van Bokoven, H. 9.4-P Van Buggenhout, G. 4-L Van Den Akker, J. 7.34-P van der Kevie-Kersemaekers, A. M. F. 1.19-P van der Ven, K. 1.112-P van Diepen, M. M. L. 1.134-P Van Esch, H. 1.2-O, 9.4-P van Hagen, J. M. 7-L Van Herreweghe 1.127-P van Kessel, A. G. 18-L, 9.2-O van Maarle, M. C. 1.41-P, 1.81-P van Melle, G. 7.84-P Van Os, T. A. M. 1.81-P van Ravenswaaij, C. 1.19-P Van Roy, N. 17-L Van Slobbe-Knoers, N. 1-S Van Vooren, S. 1.3-O van Zelderen-Bhola, S. 7.69-P Vanderzwalman, P. 10.7-P Vandesompele, J. 17-L Vanlıog˘lu, F. 10.4-P Vanneste, E. 10.2-O, 10.10-P Vanni, R. 7.102-P Varljen, T. 7.7-P Varvoutsi, M. 7.1-P Vasila, E. 12.10-P Vatev, I. 4.9-P Vatsadze, T. 7.85-P, 7.103-P Vazifehmand, R. 1.140-P, 9.7-P Veiga, L. C. 4.8-P Vekemans, M. 10.12-P Velaeti, S. 7.1-P Veliscu, M. 1.106-P, 1.115-P Velissariou, V. 1.8-P, 1.16-P, 1.138-P Veltman, J. 9.2-O Veltman, J. A. 1-S Vendrell, T. 1.58-P Vener, C. 7.48-P Ventura Mario 2.1-O Venturin, M. 1.209-P Verdonk, M. J. 7.69-P Verloes, A. 1.212-P, 5.1-O Vermeer, S. 1-S Vermeesch, J. R. 1.2-O, 10.2-O, 10.10-P
Vermeesch, J. 6.1-O, 4-L, 37-L, 1.3-O Vermeulen, J. 17-L Veroni, F. 12.21-P Vetro, A. 37-L Vialard, F. 4.11-P Vicdan, A. 7.100-P Vidal, F. 1.114-P, 4.2-O Vieira, R. 1.187-P Viguie´, F. 7.34-P Viikkula, M. 7.101-P Vila, L. 1.100-P Villa, N. 1.103-P, 7.54-P Villa, O. 7.64-P Villalon Villarroel, C. 3.17-P, 7.79-P, 12.18-P, 12.20-P Villard, L. 5.11-P Villatoro 13.4-P Viot, G. 1.161-P Virdis, M. 1.222-P Virdis 7.112-P Vital, A. L. 7.95-P Vlasak, I. 1.10-P Vlckova, Z. 1.74-P Voghouie, S. 7.58-P Voglino, G. 12.1-P Vogt, U. 10.9-P Vogt 1.214-P Voinova-Ulas, V. 1.12-P Volkan Salanci, B. 1.142-P, 1.166-P, 1.176-P Volonte`, M. 1.209-P Volosciuc, M. 1.116-P von Voss, H. 1.26-P Voronina, E. S. 3.18-P, 3.22-P Vorsanova, S. 1.12-P, 1.13-P, 3.8-P, 3.9-P Vranekovic, J. 1.14-P Vujic, D. 7.7-P Vyatkina 1.194-P Vyatkina, S. 1.133-P Wagner, J. 12.11-P Walker, J. 9.10-P, 9.11-P Wauters, J. 3-S Wegner, R.-D. 12.8-P Wells, D. 4.1-O Wettwer, M. 1.26-P Wey, E. 1.4-O White, S. 7.86-P Whiteford, M. 1.148-P Wierzba, J. 1.157-P Wijst, S. E. 9.1-O Wilmore, E. 7.108-P Wilson, E. 1.29-P Wimmer, R. 1.17-P Winsor, E. 14.16-P Woessner, S. 7.64-P Wolfs, I. 4-L Wolko, B. 15.6-P Wolstenholme, J. 9.6-P Wollnik, B. 13.1-O, 13.7-P
6th ECC: Author Index
292 Wouters, J. 31-L Wright, M. J. 9.6-P Wu, L. L. 1.240-P Wu, Q. 8-L Wustefeld 7.101-P Wu¨stemann, M. 12.31-P Wyrowinska Elzbieta 7.77-P Xandri, M. 1.34-P, 7.55-P Xanthopolou, L. 10.1-O Xanthopoulidis, G. 7.38-P Xuncla`, M. 7.29-P, 7.30-P, 7.31-P Yakinci, C. 1.4-P, 1.57-P Yakut, S. 7.99-P Yakut, T. 1.37-P, 1.56-P, 1.61-P, 1.62-P, 1.71-P, 1.137-P, 7.47-P Yanar 1.170-P Yanar, U. 1.190-P Yanar Ufuk 1.180-P, 1.177-P Yang, F. 5-L Yanik, F. 12.13-P Yararbas, K. 1.244-P, 7.100-P Yardimci, T. 1.229-P, 1.239-P, 1.241-P Yardin, C. 1.230-P Yavuz Selim 7.72-P, 7.91-P Yelke, H. 1.80-P, 1.181-P, 10.2-P, 10.3-O, 10.4-P, 10.5-P, 10.6-P, 10.7-P, 10.8-P, 10.11-P Yenerel Mustafa Nuri 7.73-P, 7.91-P Yerle, M. 4.4-P, 4.5-P Yeshaya, J. 3.1-O Yes¸il, G. 1.175-P, 1.183-P Yesil, M. 1.79-P, 1.80-P, 1.92-P, 1.104-P, 1.181-P, 1.203-P, 10.11-P, 10.16-P, 12.19-P Yesilada, E. 1.57-P
Yesılyurt, A. 1.37-P, 1.44-P, 1.46-P, 1.85-P, 1.86-P, 1.137-P, 1.139-P Yes¸im Ertan 7.75-P Yigiter, A. B. 1.105-P Yılanlıoglu, C. 12.19-P Yılanlıoglu, N. C. 1.203-P Yıldırım, A. 12.25-P Yıldırım, R. 1.248-P Yildiz, E. 7.115-P Yıldız Handan 1.213-P Yılmaz 1.177-P, 1.179-P, 1.180-P Yılmaz, E. 1.126-P, 1.177-P, 1.178-P, 1.183-P, 1.190-P, 1.238-P Yılmaz, K. 1.63-P, 1.64-P, 1.65-P, 1.67-P, 1.165-P Yilmaz, S. 1.168-P, 1.182-P, 5.8-P Yilmaz, Z. 1.121-P, 1.122-P, 1.123-P, 7.63-P, 12.13-P Yirmibes Karaoguz, M. 1.32-P Yolay, G. 12.32-P Yosunkaya Fenerci, E. 1.179-P, 1.189-P, 13.3-P Young, B. D. 16-L Yucel, S. 7.89-P, 7.116-P Yukla, M. 7.5-P Yuksel, A. 1.179-P, 1.168-P, 1.189-P, 5.8-P, 12.25-P, 12.26-P, 13.3-P Yu¨ksel-Apak, M. 1.174-P, 13.1-O, 13.7-P Yu¨ksel Erdinc¸ 1.213-P, 7.114-P Yuksel Konuk, E. 1.20-P Yuksel, S. 1.4-P, 1.57-P Yumurtaci Aysen 15.3-P Yurdakul, H. 12.17-P Yuregir, O. O. 1.121-P Yurov, Y. 1.12-P, 1.13-P, 3.8-P, 3.9-P Yurur-Kutlay, N. 7.100-P Yuvacan, E. 10.4-P
Zafer, C. 1.223-P Zafer So¨ylemez 1.215-P Zagorac, A. 7.3-P Zaitseva, T. 1.7-P Zaja˛czek, S. 1.157-P, 12.16-P Zaki, M. 1.1-P Zaklyazminskaya, E. 1.129-P Zamanian, F. M. 1.197-P Zamanian, M. 1.195-P, 1.196-P, 1.199-P Zamora, L. 7.55-P Zandi, F. 7.57-P, 7.58-P, 7.59-P Zangeneh, M. 7.57-P, 7.58-P, 7.59-P, 7.60-P Zankl, A. 1.29-P Zaoralova, R. 7.41-P Zaouali, M. 1.47-P Zarakauskaite˙, E. 1.55-P Zatterale, A. 37-L Zecca, M. 7.17-P, 7.33-P, Zedginidze, A. 7.85-P, 7.103-P Zemanova, Z. 7.18-P, 7.19-P, 7.37-P, 1.74-P Zencir, S. 7.16-P Zervas, K. 7.6-P, 7.10-P Zeyneloglu, H. B. 1.121-P Zeynep Ocak 3.20-P Zeynep Sercan 7.75-P Zhioua, F. 1.220-P Zhivkova, R. 4.9-P Ziv, M. 1.40-P Zolotuhina, T. 1.23-P, 1.3-P, 1.133-P, 12.4-P Zollino, M. 1.135-P Zordania, R. 1.88-P Zotova, N. 1.7-P Zubaidah, Z. 1.240-P Zuccotti, G. V. 1.209-P Zuffardi, O. 35-L, 37-L, 5.2-O, 14.15-P Zwolinski, S. A. 9.6-P
